ID: 1085302126

View in Genome Browser
Species Human (GRCh38)
Location 11:75464899-75464921
Sequence CTCAGTCCTGCCTCCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 276}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085302122_1085302126 1 Left 1085302122 11:75464875-75464897 CCAGAGAATGGCTGAGTCCCTAG 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG 0: 1
1: 0
2: 3
3: 18
4: 276
1085302117_1085302126 17 Left 1085302117 11:75464859-75464881 CCCTAGGAGCTGCCACCCAGAGA 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG 0: 1
1: 0
2: 3
3: 18
4: 276
1085302118_1085302126 16 Left 1085302118 11:75464860-75464882 CCTAGGAGCTGCCACCCAGAGAA 0: 1
1: 0
2: 4
3: 30
4: 222
Right 1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG 0: 1
1: 0
2: 3
3: 18
4: 276
1085302121_1085302126 2 Left 1085302121 11:75464874-75464896 CCCAGAGAATGGCTGAGTCCCTA 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG 0: 1
1: 0
2: 3
3: 18
4: 276
1085302120_1085302126 5 Left 1085302120 11:75464871-75464893 CCACCCAGAGAATGGCTGAGTCC 0: 1
1: 0
2: 1
3: 22
4: 195
Right 1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG 0: 1
1: 0
2: 3
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085302126 Original CRISPR CTCAGTCCTGCCTCCCATGG AGG Intronic
900431078 1:2603482-2603504 CCCAGTCCTGCCTGCCCTGAGGG - Intronic
900971707 1:5995570-5995592 CTCAGTCCTGCCTGGCATGCAGG + Intronic
901907700 1:12428571-12428593 CTCAGTCTTGCCTCTGATTGGGG + Intronic
902689755 1:18103274-18103296 CTCTGTCCTGACTGCGATGGAGG + Intergenic
902738136 1:18414728-18414750 ATCAGTCCTGCCTTCACTGGTGG - Intergenic
902790724 1:18766057-18766079 CTCAGCTCTGCCTGCCCTGGGGG + Intergenic
902825518 1:18971061-18971083 ATCAGTGCTGCCTCCCACCGTGG + Intergenic
903317765 1:22521925-22521947 CTCAGGCCTGCCTACCACTGAGG - Intronic
904390156 1:30179572-30179594 CTCAGTGCTGTATCCCAGGGAGG - Intergenic
905240148 1:36576154-36576176 CTTGGTCCAGCCTTCCATGGTGG + Intergenic
909273808 1:73658820-73658842 CTCTGTGCATCCTCCCATGGTGG + Intergenic
910760995 1:90730939-90730961 CTCAGTCCTGCCGCCGTTCGGGG - Intergenic
915355584 1:155253803-155253825 CTCACTCTTGCCTCCCCTGCTGG - Intronic
918640819 1:186839161-186839183 CTCACTGCTTCCACCCATGGAGG - Intronic
919342294 1:196327694-196327716 CTCACTCCTGCCGCCCAGGCTGG + Intronic
919744500 1:201000148-201000170 CTCAGTCCTTCCTCTCCTTGGGG + Intronic
920493603 1:206438238-206438260 CTCACTCCTTCATCCCCTGGTGG + Intronic
920933890 1:210412993-210413015 CCCAGTCCTGCCTCACATTGTGG - Intronic
922173475 1:223176908-223176930 CTCACTCTGTCCTCCCATGGAGG - Intergenic
922455573 1:225771106-225771128 CTCAATGCTGCCTCCTCTGGGGG - Intergenic
924414428 1:243844550-243844572 CTCACTGCAGCCTCCAATGGGGG + Intronic
924822465 1:247506588-247506610 ATCAGTGCTGCCTGCAATGGAGG + Intergenic
1063065111 10:2600088-2600110 CTGACACCTCCCTCCCATGGTGG - Intergenic
1063122636 10:3115419-3115441 CCCAGTCCTGTCCTCCATGGCGG - Intronic
1063122650 10:3115466-3115488 CCCAGTCCTGTCCTCCATGGCGG - Intronic
1065796464 10:29312713-29312735 CCCCCTCCTGGCTCCCATGGCGG + Intronic
1065882644 10:30049728-30049750 CTCTGTAATCCCTCCCATGGTGG - Intronic
1066260951 10:33729217-33729239 CTCAGGACTGTCTCCCATGTGGG - Intergenic
1068711644 10:60141383-60141405 CTCAGTCCTGCCTCCTATCTGGG - Intronic
1069888458 10:71638457-71638479 CTCAGGCCTCCCTCCCTTTGGGG + Intronic
1072519115 10:96214616-96214638 CTCACTCCTCCCTCCCCTGCGGG - Intronic
1073607982 10:104915088-104915110 TTCCATCCTGCCTTCCATGGTGG - Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1074764743 10:116692228-116692250 CTCCTTGCTGCCTCCCATGGAGG + Intronic
1074884784 10:117685157-117685179 CTCACTCCTGCCTGCCAGGCTGG + Intergenic
1077061592 11:620032-620054 CTCTGCCCTGCCCCCCATGCAGG + Intronic
1077840681 11:5971475-5971497 CTCATTCCTCCCTCACATTGTGG + Intergenic
1077848363 11:6049924-6049946 CTCATTCCTTCCTCACATAGTGG + Intergenic
1080197904 11:29633065-29633087 CCCAGCACTGCCTCCCATGAAGG + Intergenic
1081458105 11:43245212-43245234 GTCTCTCCTGCCTCCTATGGTGG + Intergenic
1083265625 11:61545665-61545687 CACAGGCCTGCTGCCCATGGAGG + Intronic
1083604780 11:63971735-63971757 GTCAGCCCTGCCCCACATGGTGG - Intergenic
1084492576 11:69486753-69486775 CCCAGCCCTGCCACCCATCGCGG - Intergenic
1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG + Intronic
1089683817 11:120134321-120134343 CTCAGACCTGCCTCGGTTGGTGG - Intronic
1090750270 11:129740756-129740778 TTCTGTCCTGGCTCCCACGGAGG - Intergenic
1090945486 11:131426071-131426093 CTCAGTGATGCCTCCCAAAGTGG - Intronic
1091374029 12:14712-14734 CTCAGACCTGCTTCCCTGGGAGG - Intergenic
1092886733 12:12930946-12930968 CTTTTTCCTTCCTCCCATGGTGG - Intergenic
1095216449 12:39555844-39555866 CTGAGTCCTGCCTGCCACTGTGG - Intronic
1095587436 12:43864122-43864144 CTGAGCCCTGCCCCCCAGGGAGG - Intronic
1096504721 12:52085539-52085561 CAATGTCCTGCCTCACATGGAGG - Intergenic
1097954498 12:65469621-65469643 CTCTGGGCTGCCTCCCATGTAGG + Intronic
1098617535 12:72547591-72547613 CTCATTCCTACCTCCCCAGGTGG + Intronic
1098648996 12:72940969-72940991 TTCTGTCCTGCCTTTCATGGTGG + Intergenic
1099540712 12:83904397-83904419 CTGTGTGCTCCCTCCCATGGAGG - Intergenic
1100547312 12:95615418-95615440 CTCAATCCTGTCTCCCATGCTGG + Intergenic
1102885920 12:116521661-116521683 CTCAGACCTTCCTTCCCTGGGGG - Intergenic
1103167031 12:118778960-118778982 CCAAGGCCGGCCTCCCATGGAGG + Intergenic
1104477269 12:129081215-129081237 CTCTGGGCTGGCTCCCATGGTGG - Intronic
1106200590 13:27533489-27533511 CGCTGTCCTTCCTCCTATGGGGG - Intergenic
1112324436 13:98433960-98433982 CTCAGATCTGTCGCCCATGGGGG + Intronic
1112487640 13:99834370-99834392 CTCAGTCCTGACTCATATAGGGG + Intronic
1113179913 13:107613032-107613054 ATGAGTCCCGCCTCCCCTGGAGG + Intronic
1113782393 13:112984063-112984085 CTCTGTCCTGCATGGCATGGTGG + Intronic
1113885449 13:113656426-113656448 CTCAGCCCTGCCTCCCGGGTAGG + Intronic
1114386515 14:22261146-22261168 CTAGGCCCTGCCTCCCAAGGTGG + Intergenic
1114449145 14:22813381-22813403 CTCAGTGCTGTCAACCATGGTGG + Exonic
1115595926 14:34909136-34909158 CTCACTCCTGTCTCCCAGGCTGG - Intergenic
1116297886 14:43136059-43136081 CTGAGTCCTGCCCCGCAGGGAGG + Intergenic
1116313054 14:43350760-43350782 CTCAGTCCTACTTCCAATGTTGG + Intergenic
1118330032 14:64807862-64807884 CTGAGGCCTCCTTCCCATGGTGG - Intronic
1118841362 14:69515412-69515434 CCCAGTACTGGTTCCCATGGAGG + Intronic
1120000745 14:79300614-79300636 CTCAGGGCTGCCTCCCAGAGAGG + Intronic
1120070945 14:80101498-80101520 CTCAGTCCTACCTCCCAAGAAGG + Intergenic
1120832861 14:89013482-89013504 CTCAGTCCTGCCTTCCTTCCAGG - Intergenic
1122035973 14:98949750-98949772 CTCCTCCCTGCCTCCCCTGGGGG + Intergenic
1122113034 14:99514882-99514904 CTCTGTCCTGCCTGGGATGGAGG - Exonic
1122929830 14:104928134-104928156 CTCAGTCCTTCCACCCCTGGGGG + Intronic
1124485177 15:30108028-30108050 CTCACTCCTGTCACCCAGGGTGG + Intergenic
1124518401 15:30389244-30389266 CTCACTCCTGTCACCCAGGGTGG - Intronic
1124540252 15:30577004-30577026 CTCACTCCTGTCACCCAGGGTGG + Intergenic
1124758401 15:32430574-32430596 CTCACTCCTGTCACCCAGGGTGG - Intergenic
1127972574 15:63973104-63973126 CCCAGTGCTGCCTCACATTGTGG + Intronic
1129868496 15:78926240-78926262 CTCAGTCCTGCCTCCCTAGAGGG + Intronic
1129910363 15:79221452-79221474 CTCGGTCCTCTCTCCCCTGGGGG + Intergenic
1131228890 15:90646376-90646398 CTGTGTCCTGCCTCTCCTGGAGG + Intergenic
1131256981 15:90869558-90869580 CTCATTCCTCCCTCTCAGGGAGG + Intronic
1132454331 16:14283-14305 CTCAGACCTGCTTCCCTGGGAGG - Exonic
1132872990 16:2123908-2123930 CACCGTCCTGCCCCCCATGGGGG - Intronic
1133533936 16:6682266-6682288 CACAGCCCTGCCTCCTCTGGAGG + Intronic
1134552078 16:15143087-15143109 CACCGTCCTGCCCCCCATGGGGG - Intergenic
1135767364 16:25189248-25189270 CTCACTCCTGTCACCCATGTTGG + Intergenic
1136238819 16:28932041-28932063 CTCGGGCCTGACTTCCATGGGGG - Exonic
1139386467 16:66575568-66575590 CTCACTATTGCCTCCCATGAGGG - Intronic
1139553979 16:67694389-67694411 CTCAGCTCAGCCTCCCAAGGTGG + Intronic
1139593936 16:67947554-67947576 CCCAGTCCTGGCACCCACGGTGG + Intronic
1140711160 16:77678724-77678746 CTCACTCCTGTCTCCCAGGCTGG - Intergenic
1140785876 16:78341717-78341739 CACTGACCTGCCACCCATGGAGG - Intronic
1140942552 16:79735572-79735594 CTCATTCCTGACTCCCACTGAGG + Intergenic
1141323694 16:83036177-83036199 CTCAGTCCTGTCTCACAGGCTGG + Intronic
1141588208 16:85049264-85049286 CCCAGTCTTTCCTCCCATAGAGG + Intronic
1141773156 16:86103448-86103470 CTCAGTGCTGACTCCATTGGTGG + Intergenic
1141994965 16:87630447-87630469 CACAGTCCTGCTCCCCAGGGAGG - Intronic
1142737014 17:1907593-1907615 TTCAGTCCTGCTTCTCAGGGTGG + Intergenic
1142901721 17:3016341-3016363 CTTAATCCTGCGTCCCATGGAGG + Intronic
1143195247 17:5071395-5071417 CTCTGTCTTCCCTCTCATGGTGG + Intergenic
1144032763 17:11336892-11336914 CTCTGTGCTGCCTGCCCTGGAGG - Intronic
1145009144 17:19357540-19357562 CACAGTCCTGCATGCCAGGGTGG + Intronic
1147425470 17:40344063-40344085 CTCCCTCCTGCCTGCCAGGGAGG + Intronic
1147877696 17:43632976-43632998 CTGAGCGATGCCTCCCATGGAGG + Intergenic
1149754009 17:59172793-59172815 CTGAGTCTTCCCTGCCATGGTGG + Intronic
1150656332 17:67042166-67042188 CACAAACCTGCCCCCCATGGAGG + Intergenic
1151146303 17:72044779-72044801 CTCACTCCTGTCTTCCAGGGAGG + Intergenic
1151975288 17:77480812-77480834 CCCCATCCTGCCTCCCAGGGAGG - Intronic
1152594478 17:81231737-81231759 CCCACTCCTGTCTCGCATGGGGG + Intronic
1152892901 17:82892515-82892537 CTCATTCCGGCCTCTCCTGGTGG + Intronic
1152937672 17:83149973-83149995 CTCAGTCCTCCCTCCCCTGGTGG + Intergenic
1155013503 18:21807400-21807422 CTCACTCCTGCCACCCAGGCTGG - Intronic
1155962575 18:32007018-32007040 CTCACTCCTGCCCCCCAGGCTGG - Intergenic
1156536341 18:37868155-37868177 CCCTGTCCTGCCTCCAATGCTGG - Intergenic
1157645633 18:49266579-49266601 CTCACTCTTGCCACCCATGCTGG - Intronic
1158545072 18:58389223-58389245 CTCAATCCTGCCTCAGGTGGAGG - Intronic
1158608826 18:58920088-58920110 CTCAGTCCTCCCGCCAATGCAGG + Exonic
1160082488 18:75742222-75742244 CTCACTGCTTCCTCACATGGTGG + Intergenic
1160117196 18:76090410-76090432 CTCAGGCCTCCTCCCCATGGAGG - Intergenic
1160225090 18:77006178-77006200 CTCAGCCTTGGCGCCCATGGAGG - Intronic
1160242610 18:77133737-77133759 CTGAGTCCCGCCTCCCAGCGCGG - Intergenic
1160866121 19:1256878-1256900 CACAGTCCTGCCCTCCCTGGAGG - Intronic
1161295682 19:3519120-3519142 CTCTGCCCAGCCTCGCATGGGGG - Intronic
1161470114 19:4453031-4453053 CCCAGTCCTGCCTGCCTTGGAGG - Intronic
1161494151 19:4578579-4578601 CTCTGGCCTGCCTCCCACGAGGG + Intergenic
1162048491 19:8017547-8017569 CACAGATCGGCCTCCCATGGAGG + Intronic
1162757485 19:12868886-12868908 GTCTGTCCTGCCTCAAATGGGGG - Intronic
1164821443 19:31254340-31254362 CTCACTCCTGCCTCCTCTGCAGG - Intergenic
1165069097 19:33245300-33245322 AACTGTCCTGCCTCCCCTGGGGG + Intergenic
1165405931 19:35631178-35631200 CACAGTAGTTCCTCCCATGGTGG + Exonic
1165907940 19:39204949-39204971 CAAGGTCCTGCCTCCCAGGGAGG - Intergenic
1166143357 19:40817997-40818019 CTCACTCCTGTCTCCCAGGCGGG + Intronic
1166690875 19:44820706-44820728 CTCAGCCCTGGCTCCCCTGGCGG - Exonic
1166930959 19:46301074-46301096 CTCAGTCCTGCCTGCCTGAGAGG - Intronic
1168013647 19:53554510-53554532 GTCGGTCCCGCCACCCATGGAGG - Intronic
1168447700 19:56435652-56435674 CTCACTCCTGTCTCCCAGGCTGG - Intronic
1168703952 19:58457560-58457582 CTCTGTCCAGCCTCCAATTGAGG - Exonic
1168706487 19:58473193-58473215 CTCTGTCCAGCCTCCAATTGAGG - Exonic
925089494 2:1142286-1142308 ATCAGCCCTGCCACCCATGAAGG + Intronic
925392380 2:3505331-3505353 CCCAGCCCTGCTTCCCATAGGGG - Intronic
925989308 2:9240978-9241000 CACCGTCCTGCCTCCCACGCGGG - Intronic
926106564 2:10155801-10155823 CTCAGCGCTGCTTCCCAGGGAGG - Intronic
928116816 2:28551023-28551045 CTCTGTCAAGCCTCCCATGCTGG - Intronic
932173360 2:69577519-69577541 CTCAGCTCTGCCTGTCATGGAGG - Intronic
932462375 2:71891288-71891310 CTCAGGGCTGCCTGCCTTGGGGG + Intergenic
932780635 2:74556461-74556483 CTCAGAGCTGACTCCCATGAAGG + Exonic
934111456 2:88747304-88747326 CTCAGCCCTGCTCACCATGGTGG - Intronic
934307784 2:91840894-91840916 CTGAGGCCTGCCTACCAGGGAGG + Intergenic
934531078 2:95089524-95089546 CACAGCCCTGCCCTCCATGGTGG + Intronic
935155354 2:100479542-100479564 CTCAGTGCTCCCTGCCAAGGTGG - Intronic
935917593 2:107972472-107972494 CTGAGTAATTCCTCCCATGGTGG + Intergenic
936568782 2:113598817-113598839 CTCAGACCTGCTTCCCTGGGAGG + Intergenic
936663237 2:114565568-114565590 CTCAGCCATGCTTCCCTTGGAGG + Intronic
937264644 2:120608110-120608132 CTCAGTCATGCCTCCCCTGGAGG + Intergenic
938074150 2:128322914-128322936 CCCTGTCCTGCCTCCCAAGCTGG - Intergenic
943126399 2:183797796-183797818 CTCATTCCATCCTCACATGGTGG - Intergenic
945696975 2:213119133-213119155 CTCAGTCCTGCCTGCCTTTCAGG - Intronic
946022441 2:216650377-216650399 CTCAGTCCTTCCTCCCACACTGG + Intronic
1168850402 20:972742-972764 CTCTGTGCTGCCTTGCATGGCGG - Intronic
1168859581 20:1036569-1036591 CTAAGAGCTGCCTACCATGGCGG + Intergenic
1172949490 20:38713650-38713672 ATCAGTCCTCCCTCTCAAGGTGG - Intergenic
1173498523 20:43535848-43535870 CCCAGCTCTGCCTCCCCTGGGGG + Exonic
1173887831 20:46477410-46477432 CTCACTGCTGCCTCAAATGGTGG + Intergenic
1174043717 20:47718134-47718156 CTCAGACCTGCCTGCCTCGGAGG - Intronic
1175458283 20:59131547-59131569 CTCTGCCCTGCACCCCATGGTGG + Intergenic
1175608011 20:60327498-60327520 CTCAGTCTTGCCTCCCCTCAAGG - Intergenic
1176001175 20:62831941-62831963 CTCTGTCCAGCCTCCCCTTGTGG - Intronic
1176691878 21:9921998-9922020 CTCAGTCTAACCTCACATGGTGG - Intergenic
1177926812 21:27227222-27227244 GTAAGTCCTGCCTTGCATGGTGG + Intergenic
1178842850 21:36151785-36151807 CTGAGACCTGCCTCCGATGTTGG + Intergenic
1179895286 21:44358381-44358403 CTCCTTCCTGCCACCCAAGGGGG - Intronic
1181029516 22:20143077-20143099 CTCAATCCTGGCTCGCCTGGTGG + Exonic
1181987275 22:26808903-26808925 CTCAGCCCTGCACCCCAAGGTGG - Intergenic
1182723782 22:32426350-32426372 CCTAGCCCTGCCTCCCATGCAGG - Intronic
1183079344 22:35446658-35446680 CTCACTCCTTCCTCCCACTGCGG - Intergenic
1183508457 22:38221907-38221929 CACAGTCCAGCCTCCCCTTGGGG - Intronic
1183606392 22:38868940-38868962 CACAGTCCCTTCTCCCATGGGGG - Intronic
1184254376 22:43278764-43278786 CTCAGTTTTCCCTCCCATGATGG + Intronic
1184853055 22:47131818-47131840 CTCACTTCTGGCTCCCATGTGGG - Intronic
1185287362 22:50008542-50008564 GACAGACCTGCCTCCCACGGTGG + Intronic
949198640 3:1344203-1344225 CTCAGTTCTGCTTCTCAGGGAGG + Intronic
950733803 3:14988296-14988318 TGCAGTCCTGCTTCCCTTGGAGG - Intronic
952349659 3:32522061-32522083 CCCAGTACTGGTTCCCATGGAGG - Intergenic
954007794 3:47606303-47606325 CACAGTGCTGCCTCCCGTGACGG - Intronic
954927066 3:54245430-54245452 AACAGTCCTGGCTCTCATGGTGG + Intronic
955527875 3:59839444-59839466 CTCAGTCCTTTCTCCCAAGGAGG - Intronic
957672587 3:83324489-83324511 CTCAGTGCTGCCTGTCATAGGGG - Intergenic
959913838 3:111794260-111794282 CTCAGTGCTGCCTTTCACGGTGG - Intronic
959942019 3:112090322-112090344 CTCACTCCTGCCACCCAGGCTGG + Intronic
961209409 3:125114192-125114214 CACAGTCCTGCCTCTCAGGAAGG - Intronic
962167747 3:133067966-133067988 CTCATTTCTGCCTTCCACGGTGG - Intronic
962744646 3:138388355-138388377 ATCATTCCTGCCTCCCATGACGG + Intronic
966694695 3:182777847-182777869 CTCAGTCCACATTCCCATGGTGG - Intergenic
967990692 3:195128204-195128226 CTCAGTACAGCCCCCCAGGGAGG + Intronic
968229927 3:196999550-196999572 CTAGATCCTGCCTCCCAAGGTGG - Intronic
969105561 4:4804787-4804809 CCCTGCCCTGCCTCCAATGGAGG - Intergenic
970639853 4:18051853-18051875 CACACTTCTGGCTCCCATGGTGG - Intergenic
973199929 4:47488881-47488903 CTCACTGCATCCTCCCATGGTGG - Intronic
975708564 4:77135912-77135934 CTGAGTGCTGCCTCCCCAGGAGG + Intergenic
976827524 4:89277389-89277411 TTCAGTCCTGCTTTCCTTGGGGG - Intronic
978285549 4:107073324-107073346 CTGAGTCCTGCCCCCCACAGAGG - Intronic
978782913 4:112575840-112575862 CTAAGTCCTGCCCCCCAGAGGGG - Intronic
980364464 4:131782201-131782223 CTCAGTCTAACCTCACATGGTGG - Intergenic
980517814 4:133887685-133887707 CAAAGTCCTGCCTGCCATGCAGG + Intergenic
980598805 4:134991928-134991950 CCAAGTCCTGCCTCCAGTGGTGG + Intergenic
984499716 4:180544441-180544463 CTCTGTCCTGCCTCACATTTGGG + Intergenic
984976253 4:185232925-185232947 CTAAGCCCAGCCTTCCATGGTGG + Intronic
988337705 5:29927813-29927835 CTCACTGCGTCCTCCCATGGTGG + Intergenic
990320708 5:54627619-54627641 CCCAGGGCTGCCTCACATGGTGG + Intergenic
991150128 5:63358067-63358089 CTCAGCACTGTTTCCCATGGAGG + Intergenic
991487566 5:67153476-67153498 TTCAGTCCTGCCTGGCATGCCGG - Exonic
993607919 5:90016974-90016996 CTCATTCCTCCCTCCCATGGTGG - Intergenic
995347055 5:111133277-111133299 CTAGGTCCTGACTCCCCTGGAGG + Intergenic
995624797 5:114064475-114064497 CTCAATGCTGTCTCACATGGTGG - Intergenic
996090328 5:119344533-119344555 CTCAGTCCTTGCACCCATGAAGG - Intronic
1000099124 5:157997990-157998012 CTCTGTCCTGCCGCCCAGTGAGG + Intergenic
1007399188 6:41594066-41594088 CCTAGTCCGGGCTCCCATGGTGG + Intronic
1007446866 6:41913332-41913354 CTCTTTCCTGCCTGCCATGAAGG + Intronic
1007492690 6:42236273-42236295 CCCCGTCCTGGCTCCCACGGAGG - Exonic
1009978783 6:70701627-70701649 CTCTGTCCTGCCAATCATGGTGG - Intronic
1010445365 6:75943360-75943382 CTCACCCCTCCCTCCCAGGGAGG - Intronic
1012966847 6:105684464-105684486 CACAGTCCTTGCTCTCATGGAGG + Intergenic
1013356551 6:109350412-109350434 AGCATTCCTGCCTCCCATGTTGG + Intergenic
1014997651 6:128170591-128170613 CTCAGTGCTAGCTCCCAAGGTGG - Intronic
1016508641 6:144814244-144814266 CTCACTGCGTCCTCCCATGGTGG - Intronic
1017774939 6:157673158-157673180 CTCACTCCTGCTGCCCATGGAGG - Exonic
1018797055 6:167194332-167194354 CTCATTGCAGCCTCACATGGTGG + Intronic
1018819284 6:167360756-167360778 CTCATTGCAGCCTCACATGGTGG - Intronic
1018847296 6:167564622-167564644 CTCAGTCCTCCCTGCAAGGGTGG - Intergenic
1018990697 6:168671451-168671473 CTCCGTCCTGCATCCCTGGGGGG + Intronic
1018990716 6:168671504-168671526 CTCCGTCCTGCATCCCTGGGGGG + Intronic
1019494179 7:1329903-1329925 CGAAGTCCTGCCCCCCAGGGTGG + Intergenic
1019537700 7:1537746-1537768 TCCAGCCCTGCCTCCGATGGGGG - Intronic
1019683587 7:2367251-2367273 CTCGGTCCAGCCTTCCCTGGAGG + Intronic
1020785872 7:12571366-12571388 CTCAGTCCTGCTTTCCCTGTCGG + Intronic
1022487758 7:30793652-30793674 CTCAAGCCAGCCTCCCATCGTGG + Intronic
1023775504 7:43602214-43602236 TTCAGTCCCTCCTCCCGTGGTGG + Intronic
1025611349 7:63077855-63077877 CTCAGGCCTGCTTCTCAGGGTGG - Intergenic
1025664829 7:63576612-63576634 CTCAGCCCTGCCTCCAGAGGTGG - Intergenic
1026515878 7:71071424-71071446 CTCACTCCAGCCTCCCAAGCTGG + Intergenic
1029311998 7:99676019-99676041 CTCAGAACTCCCTCCCAAGGAGG + Intronic
1029551307 7:101238445-101238467 CTCAGCCCAGCCTCCCAAAGTGG - Exonic
1029672883 7:102046178-102046200 CTCTGTCCCGACTCCCATAGGGG - Intronic
1031968585 7:128046652-128046674 CTGTGCCCTGCCTCCCATGCTGG + Intronic
1032626789 7:133599928-133599950 CTCACTCCTGTCTCCCAGGCTGG + Intronic
1032736164 7:134694481-134694503 CTCGGTGCTGCCTCTCCTGGGGG - Intergenic
1033600596 7:142885858-142885880 CACAGACCTGCCTACCAAGGGGG + Intergenic
1033659954 7:143396331-143396353 CTCTGTGCTGCCCCACATGGCGG + Intronic
1034467253 7:151237404-151237426 CTCAGCCCTGCCTCCCCTTCGGG - Exonic
1034974202 7:155438469-155438491 CTCTTTTCTGCCTCCCATGGGGG + Intergenic
1035560821 8:602401-602423 CTCAGCCCTCCCTCCCATCCAGG - Intergenic
1035589221 8:800442-800464 CCCAGCCCTGGCTCTCATGGCGG + Intergenic
1037204881 8:16304843-16304865 CACAGTACCGCCTCCCCTGGGGG + Intronic
1038419358 8:27422456-27422478 CTCATTCCTGCTTCCCATCTTGG - Intronic
1038478602 8:27886225-27886247 CTCAGGGCTTCCCCCCATGGTGG + Intronic
1040499932 8:47997180-47997202 GTCAATCCTGCCTCCCAGGAAGG - Intergenic
1040804362 8:51377746-51377768 CTCAGCCCTGCCCCGCAGGGAGG - Intronic
1040840225 8:51777163-51777185 ATCACTGCTTCCTCCCATGGTGG + Intronic
1041671095 8:60492670-60492692 CTCAGTCCCCTCTCCCATGCTGG + Intergenic
1042964418 8:74335268-74335290 TTCAGACCTTTCTCCCATGGTGG + Intronic
1043398061 8:79857833-79857855 CTCAGTCCTGCCCCGAAGGGTGG + Intergenic
1047344363 8:124012500-124012522 TTCAGTCATGTCTCTCATGGTGG - Intronic
1048210835 8:132453106-132453128 CAAGGTCCTGCCTCCCCTGGGGG - Intronic
1049883747 9:14708-14730 CTCAGACCTGCTTCCCTGGGAGG - Intergenic
1052091568 9:24334962-24334984 CTCTGTCCTGTCTGCCCTGGTGG + Intergenic
1053628815 9:39908091-39908113 CTCAGTCTAACCTCACATGGTGG - Intergenic
1053777253 9:41558253-41558275 CTCAGTCTAACCTCACATGGTGG + Intergenic
1054215072 9:62342611-62342633 CTCAGTCTAACCTCACATGGTGG + Intergenic
1054364479 9:64320233-64320255 CTCAGTCTAACCTCACATGGTGG - Intergenic
1054672409 9:67812738-67812760 CTCAGTCTAACCTCACATGGTGG - Intergenic
1054835937 9:69674290-69674312 CTCAATGCTGCCTCTCCTGGGGG - Intergenic
1055574309 9:77647025-77647047 CCTATGCCTGCCTCCCATGGGGG - Intronic
1056465359 9:86848465-86848487 CTTAATCATGCCTCTCATGGTGG + Intergenic
1058457533 9:105151541-105151563 ATTAGTCATGCCTTCCATGGGGG - Intergenic
1058781090 9:108336213-108336235 TTTAGTCCTGCTTCCCCTGGTGG + Intergenic
1059005768 9:110400394-110400416 CTCACTCTTGCCTCCCAGGCTGG + Intronic
1059537105 9:115091001-115091023 CTGAGTCATGGCCCCCATGGTGG + Exonic
1060656770 9:125377271-125377293 ATCAGTCCTGCCTCCCAGGTGGG - Intergenic
1060776509 9:126378564-126378586 CCCAGTACTGCCTTCCTTGGAGG + Intronic
1060855492 9:126911913-126911935 CTCACGCCTGTCTCCCAAGGTGG - Intergenic
1185541100 X:903674-903696 CTCAGTCTTGTCGCCCAGGGTGG + Intergenic
1189017944 X:37303594-37303616 ATCACTGCTGCCTCCCAAGGGGG - Intergenic
1189863772 X:45301419-45301441 CTCAGACTTGCCTTCCATGTTGG - Intergenic
1192227673 X:69240698-69240720 CTCATGCCTGCCTGCCACGGTGG - Intergenic
1195244138 X:102980633-102980655 CTCAGAACTTCCTCCCTTGGGGG + Intergenic
1196794731 X:119493034-119493056 CTCACTCCTGTCTCCCAGGCTGG + Intergenic
1197439550 X:126472596-126472618 ATCACTGCTGTCTCCCATGGGGG + Intergenic
1199604671 X:149567814-149567836 TTCACTGCTGCCTCCCCTGGAGG - Intergenic
1200402067 X:156025451-156025473 CTCAGACCTGCTTCCCTGGGAGG + Intergenic
1201640556 Y:16172149-16172171 CCCAGTTTTGCTTCCCATGGTGG - Intergenic
1201662259 Y:16413177-16413199 CCCAGTTTTGCTTCCCATGGTGG + Intergenic