ID: 1085305325

View in Genome Browser
Species Human (GRCh38)
Location 11:75482517-75482539
Sequence CTGTGGGGATGGCGAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 468}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085305325_1085305331 -5 Left 1085305325 11:75482517-75482539 CCCTTTTCTCGCCATCCCCACAG 0: 1
1: 0
2: 3
3: 36
4: 468
Right 1085305331 11:75482535-75482557 CACAGCCACTCCCCTGTTCAAGG 0: 1
1: 0
2: 2
3: 16
4: 221
1085305325_1085305338 15 Left 1085305325 11:75482517-75482539 CCCTTTTCTCGCCATCCCCACAG 0: 1
1: 0
2: 3
3: 36
4: 468
Right 1085305338 11:75482555-75482577 AGGCCTCATCTCCCCTGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 243
1085305325_1085305337 14 Left 1085305325 11:75482517-75482539 CCCTTTTCTCGCCATCCCCACAG 0: 1
1: 0
2: 3
3: 36
4: 468
Right 1085305337 11:75482554-75482576 AAGGCCTCATCTCCCCTGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 183
1085305325_1085305336 10 Left 1085305325 11:75482517-75482539 CCCTTTTCTCGCCATCCCCACAG 0: 1
1: 0
2: 3
3: 36
4: 468
Right 1085305336 11:75482550-75482572 GTTCAAGGCCTCATCTCCCCTGG 0: 1
1: 0
2: 2
3: 15
4: 140
1085305325_1085305339 16 Left 1085305325 11:75482517-75482539 CCCTTTTCTCGCCATCCCCACAG 0: 1
1: 0
2: 3
3: 36
4: 468
Right 1085305339 11:75482556-75482578 GGCCTCATCTCCCCTGGCTGGGG 0: 1
1: 0
2: 6
3: 38
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085305325 Original CRISPR CTGTGGGGATGGCGAGAAAA GGG (reversed) Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
901236545 1:7670375-7670397 CTGTGGGGATGGCAAGGTGAGGG - Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
903026061 1:20430622-20430644 CTGTGGGGAGGGCAAGGAAGGGG + Intergenic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905486869 1:38305349-38305371 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
906078837 1:43070370-43070392 CTGTGGTGATGGGGAGACAGCGG - Intergenic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
909375848 1:74941147-74941169 TGGTGGGGATGTGGAGAAAAGGG - Intergenic
909413687 1:75381370-75381392 CCTTGGGAATGGGGAGAAAAAGG + Intronic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911753309 1:101523649-101523671 CTGTGTGGGTGGCGAGAAAATGG - Intergenic
911887394 1:103321389-103321411 TGGTGAGGATGGGGAGAAAAGGG - Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914783711 1:150809175-150809197 ATGTGGGGAAGGAGAAAAAAAGG + Intergenic
915312501 1:155011549-155011571 CTGGGGGGGTGGCGGGAAAGAGG + Intronic
915401957 1:155628732-155628754 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
916010133 1:160697928-160697950 CTTTGGGAATGGGAAGAAAAAGG + Intronic
916328530 1:163591115-163591137 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
916524597 1:165597998-165598020 CTTTGGGGATGACGAATAAAAGG + Intergenic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
916858443 1:168776357-168776379 CTGTGGGGATGGAAAATAAATGG - Intergenic
917177853 1:172258397-172258419 CGGTGAGGATGTGGAGAAAAGGG - Intronic
917459086 1:175213017-175213039 CAGTGAGGATGTGGAGAAAAGGG - Intergenic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
918158948 1:181879170-181879192 CTGTGAGGTTGCAGAGAAAAAGG - Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
919272332 1:195363931-195363953 TTGTGAGGATGTAGAGAAAAGGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921457224 1:215386589-215386611 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
922639317 1:227211271-227211293 CTGGGGGGATGCAGATAAAAAGG + Intronic
923147408 1:231207860-231207882 CTGGGGGGTTGGGGAGCAAAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
924143076 1:241046311-241046333 CATTGGGGATGACTAGAAAAGGG - Intronic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1063530481 10:6826244-6826266 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063797563 10:9530022-9530044 TGGTGGGGATGCGGAGAAAAGGG + Intergenic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1064731253 10:18332976-18332998 CTATGGGGTTGGGGAGTAAAGGG + Intronic
1065990072 10:31000454-31000476 TTGTGGGGGTAGAGAGAAAAAGG - Intronic
1066350634 10:34633811-34633833 TTGTGAGGATGTGGAGAAAAAGG - Intronic
1067915152 10:50389603-50389625 ATGTGGGGATGGCCAGGAAGAGG - Intronic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1071126552 10:82342402-82342424 TTGTGAGGATGTGGAGAAAAGGG - Intronic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073376174 10:103036880-103036902 TTGTGGGTATGGCTATAAAAGGG + Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078042008 11:7874765-7874787 CTGTGGGGTAGGAGAAAAAAGGG + Intergenic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080289493 11:30654946-30654968 CTGTGGAGATGTCCAGAGAATGG + Intergenic
1080753270 11:35170349-35170371 CTGTCAGGAAGGCGAGAAAAAGG - Intronic
1081657650 11:44868086-44868108 CTGTGGGGAGATGGAGAAAAAGG + Intronic
1081759266 11:45565688-45565710 CTGTTGTGAGGGGGAGAAAAGGG + Intergenic
1082269561 11:50155262-50155284 CTGAGGGGATGGGGAGGAAGGGG - Intergenic
1082775629 11:57242420-57242442 CTCTCGGGAAGGAGAGAAAAAGG - Intergenic
1082799275 11:57402409-57402431 CTGAGGGGCTGGCAGGAAAAAGG + Intronic
1083299377 11:61732315-61732337 CTGGAGGGATGGTGAGAATAAGG - Intronic
1083393182 11:62370546-62370568 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1083624219 11:64063857-64063879 CTCTGGGGCTGGGGAGAAAGCGG - Intronic
1083673623 11:64313831-64313853 CTGGGGGTATGGGGAGGAAAGGG - Intronic
1084477812 11:69398845-69398867 GTGTGGGGGTGGCCAGAGAAGGG + Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1085127619 11:74012488-74012510 CCGTGGGGAGGACAAGAAAAGGG - Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085544838 11:77308493-77308515 CAGTGGGTATGGCTATAAAAGGG + Intergenic
1085648487 11:78244793-78244815 CAGTGAGGATGTGGAGAAAAGGG + Intronic
1086097730 11:83067639-83067661 ATGGGGGGATAGGGAGAAAAGGG - Intronic
1086182282 11:83967368-83967390 CAGTGAGGATGTGGAGAAAAGGG - Intronic
1087532022 11:99395174-99395196 TTGTGAGGTTGGGGAGAAAAAGG - Intronic
1087724504 11:101702440-101702462 CCTTGGGAATGGGGAGAAAAAGG + Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089471368 11:118723078-118723100 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1093260708 12:16934085-16934107 CGGTGAGGATGTGGAGAAAATGG - Intergenic
1093765188 12:22954229-22954251 TTGTGGGGATGGTTAGGAAAAGG - Intergenic
1093831108 12:23759413-23759435 CTGTGGGGGTGACGAGGGAAGGG + Intronic
1096086818 12:48870818-48870840 CTGTGGGGTTGAGGAGGAAATGG + Intergenic
1096293770 12:50365615-50365637 CTTTGGAGATGGCGGCAAAAGGG - Intronic
1096482760 12:51952832-51952854 CTGTGGGGATTGGGAGGTAAGGG - Intronic
1097330673 12:58329525-58329547 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1099064148 12:77952459-77952481 GTGTGGGGTTGGTGAAAAAATGG - Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1100287868 12:93184507-93184529 GGGTGGGGATGGAGAGAGAAAGG + Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101463700 12:104925047-104925069 CTTTGGTGATGGGGACAAAAAGG + Intronic
1101670306 12:106865239-106865261 TTGTGAGGATGTGGAGAAAAGGG - Intronic
1101896243 12:108759127-108759149 CTATGGGAATAGCGAGGAAAGGG + Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103011857 12:117464076-117464098 CTCTGGGGATGGGGACACAAGGG + Exonic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1105306200 13:19170689-19170711 CTCTGGGGGTGGAGAGACAAAGG - Intergenic
1106842754 13:33702724-33702746 TGGTGAGGATGCCGAGAAAAGGG - Intergenic
1107580651 13:41780568-41780590 CTGTGGGGATGGAAAAGAAAGGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108489153 13:50962930-50962952 CTGAGGGGATAGGGAGAAAAGGG - Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110755499 13:79169076-79169098 TGGTGAGGATGGGGAGAAAAGGG + Intergenic
1111000186 13:82168264-82168286 TAGTGAGGATGCCGAGAAAAGGG - Intergenic
1111078633 13:83272757-83272779 CTGTGGGGATTGCTGAAAAAAGG - Intergenic
1112705673 13:102066866-102066888 TTGTGAGGATGGGGAGAAACTGG - Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG + Intergenic
1114355256 14:21900657-21900679 CTGTGGGTCAGGCTAGAAAAGGG - Intergenic
1114687281 14:24545434-24545456 CGGTGAGGATGTGGAGAAAAAGG - Intergenic
1114848401 14:26352179-26352201 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1114877991 14:26747178-26747200 CGGTGAGGATGTAGAGAAAAAGG + Intergenic
1115006345 14:28489873-28489895 CTTTGGTGATGGCCACAAAAGGG - Intergenic
1115390514 14:32849714-32849736 TGGTGAGGATGGGGAGAAAAGGG - Intergenic
1116088006 14:40266294-40266316 CTGAGGGGATGTGGAGAAATAGG + Intergenic
1117234578 14:53757997-53758019 CTGGGGGGGTTGTGAGAAAAGGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119023640 14:71135783-71135805 CTGTGGGGAAGGCTAAATAAAGG + Intergenic
1120064357 14:80022693-80022715 CTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1120262590 14:82205653-82205675 CGGTGAAGATGGGGAGAAAAGGG - Intergenic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1122306989 14:100772709-100772731 CTGTGGGAAGGGCCAGCAAAGGG - Intergenic
1122373779 14:101244423-101244445 CGGTGAGGATGGTGAGAAACTGG - Intergenic
1123476054 15:20593138-20593160 GTGTGGGGACAGGGAGAAAAGGG + Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123641958 15:22407226-22407248 GTGTGGGGACAGGGAGAAAAGGG - Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1126288375 15:47042867-47042889 CAGTGAGGATGTGGAGAAAAGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1128648742 15:69395454-69395476 AGGTGGGGATGGGGAGAGAATGG + Intronic
1128993999 15:72283377-72283399 CTGTGTGGAAGGGGAGAAATGGG - Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130877820 15:88029518-88029540 CTGGGGGGATGGGGAAATAAGGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131121750 15:89827437-89827459 CAGAGGGGATGGCAAGACAAAGG + Intergenic
1131205254 15:90439888-90439910 ATGAGGGGTTGGGGAGAAAAAGG + Intronic
1131460422 15:92613965-92613987 AGGTGGGGATGGCAAGAGAAGGG - Intergenic
1131571152 15:93537793-93537815 CTGAAGGGATCGGGAGAAAAAGG - Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1133410567 16:5565070-5565092 CAGTGAGGATGTCAAGAAAATGG + Intergenic
1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG + Intergenic
1133850452 16:9498679-9498701 CTTTGGGGATAGCCAAAAAATGG + Intergenic
1134772209 16:16819082-16819104 CTGTGGGGATGTTGATAATAAGG - Intergenic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1135064368 16:19296840-19296862 CTGAGTGGATGGCTACAAAAGGG + Intronic
1136930520 16:34414115-34414137 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1136974054 16:34997693-34997715 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139572761 16:67823611-67823633 CTGTAAGGCTGGCAAGAAAAGGG - Exonic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140465975 16:75183034-75183056 GTGTGAGGATGTGGAGAAAAAGG + Intergenic
1141203829 16:81917528-81917550 TGGTGGGGATGTGGAGAAAAGGG - Intronic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1141822820 16:86459353-86459375 CTGTCGGGATGAAGTGAAAATGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142073615 16:88104756-88104778 CTGTGGGGACAGGCAGAAAACGG - Intronic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1142397343 16:89839734-89839756 CTCTGGGGGTGGGGTGAAAAGGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1144328409 17:14203787-14203809 CTGTGGGAATGTTCAGAAAAAGG - Intronic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151177123 17:72297838-72297860 GTGTGGGGATGACGAGGCAAGGG + Intergenic
1151426961 17:74037304-74037326 GTGTGGGGATGGGTAGATAAAGG - Intergenic
1151629489 17:75300869-75300891 CAGCGGGGATGGCGAGAAACTGG - Intergenic
1152793553 17:82295050-82295072 CTGTGAGGATGTGGAGGAAATGG - Intergenic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1154209010 18:12363146-12363168 CAGGCGGGATGGCTAGAAAATGG + Intronic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155493711 18:26423101-26423123 GTGTGGGGATGGGGAGACAGAGG + Intergenic
1155500553 18:26482885-26482907 GGATGAGGATGGCGAGAAAAGGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156357406 18:36354092-36354114 CTGTGTGCCTGGGGAGAAAAGGG + Intronic
1160192073 18:76722733-76722755 CTGTGGGGTTGGGGAGACAGCGG + Intergenic
1160675009 19:385560-385582 CCTTGGGTATGGGGAGAAAAAGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162374516 19:10296737-10296759 TTGAGGGGATGGGTAGAAAATGG - Exonic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1162753684 19:12844300-12844322 CTATGGGCATGGATAGAAAAGGG - Intronic
1162837892 19:13333325-13333347 CTGTGGGGATGTCAAGGGAAGGG - Intronic
1163207955 19:15817711-15817733 CTGGGAGGATGCTGAGAAAAGGG - Intergenic
1163654199 19:18536267-18536289 CTGTGAGGATGAACAGAAAAGGG + Intronic
1164370510 19:27639683-27639705 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165606402 19:37108695-37108717 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1165856258 19:38880737-38880759 CTGTGGGGAGGGGGAGCTAAGGG + Intronic
1165871551 19:38976326-38976348 CTGGGGGGATGGGGAGGACAGGG - Intergenic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166906952 19:46118036-46118058 CTGTGGGGATGGCAAAACACAGG - Intergenic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1167812850 19:51850040-51850062 TTCTGGGGATGGGGAGAGAAGGG + Intergenic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925464685 2:4096313-4096335 CTCTGGGGAAGGCGAGGATATGG + Intergenic
925568409 2:5282398-5282420 GTGTGAGGAGGGGGAGAAAATGG + Intergenic
925993471 2:9272192-9272214 TTGTGGGGATGTGGAGAAAAGGG - Intronic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927967782 2:27282373-27282395 CTGTGGGGGTTGGGAGACAAGGG - Intronic
928314955 2:30237838-30237860 CTGTGGGGTGGGTGAGTAAATGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
930253266 2:49060195-49060217 CGGTGAGGATGCAGAGAAAAAGG + Intronic
930363805 2:50413539-50413561 CTGTGAGGATGTGGAGAAAAGGG + Intronic
931121309 2:59223286-59223308 CTGTGGGGATGGGAAGCAACAGG + Intergenic
931143851 2:59494390-59494412 TGGTGGGGATGTGGAGAAAAGGG - Intergenic
931534156 2:63253744-63253766 CTGTGAGGTTGTGGAGAAAAGGG + Intronic
932771808 2:74504637-74504659 CTTGGGGGATGGGGACAAAAAGG - Intergenic
934728216 2:96638587-96638609 CGGTGGGGGTGGCGAGAACTGGG - Intronic
936919805 2:117676278-117676300 CAGTGGGGAGGGTGAGAACAGGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
939290787 2:140192331-140192353 CTTTGGGGGTGTGGAGAAAAAGG + Intergenic
940412602 2:153383288-153383310 CTATGTGGATGCCGAGAAACTGG - Intergenic
940730292 2:157381563-157381585 CTGCAAGGATGGGGAGAAAAGGG + Intergenic
941176309 2:162201467-162201489 ATGTGGGGAGGGCAAGGAAAAGG - Intronic
941188026 2:162341740-162341762 GGTTGGGGATGGAGAGAAAAGGG + Intronic
941870039 2:170374371-170374393 GTGAGGGGATGATGAGAAAAGGG + Intronic
942135383 2:172919870-172919892 CAGGGGTGATGGCGAGAGAAAGG - Intronic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
942667769 2:178338922-178338944 CGGTGGGGATGGTAATAAAAGGG - Intronic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
944043438 2:195381516-195381538 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
946458025 2:219844872-219844894 CTGTGAGGATGAGGAAAAAAAGG + Intergenic
947968271 2:234300659-234300681 ATGTGGAGATGCGGAGAAAAGGG + Intergenic
948285070 2:236777793-236777815 CTTTGGGGATGGCCAGATGACGG - Intergenic
1169448067 20:5688764-5688786 CCGTGGGGAGGACGGGAAAAGGG - Intergenic
1169534289 20:6520952-6520974 GACTGGGGATGGGGAGAAAAGGG - Intergenic
1169761640 20:9101322-9101344 CTGAGGGGATGGTGAGAGACAGG + Intronic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1170143052 20:13144151-13144173 GTTTGGGGATGGGGAGGAAAGGG - Intronic
1170700580 20:18699585-18699607 GTGTGGGGATGGCTATAAAGTGG + Intronic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171813606 20:29764011-29764033 GTGTGGGCATTGTGAGAAAAAGG - Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1173651494 20:44668349-44668371 CTTTGGCGATGGCCACAAAAGGG + Intergenic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174437830 20:50523759-50523781 CTGTGGGGATGCTCAGGAAAAGG + Intronic
1175890293 20:62312935-62312957 CTTTGGGGCTGGCCTGAAAAAGG - Exonic
1176074802 20:63243578-63243600 CTGACGGGCTGGCGAGCAAAGGG + Intronic
1177198956 21:17932313-17932335 TTGTGAGGATGAAGAGAAAAGGG + Intronic
1178326567 21:31651123-31651145 TGGTGAGGATGGGGAGAAAATGG + Intergenic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1180141994 21:45898557-45898579 CTGTGAGGATGGCGTGTAGAGGG - Intronic
1180317049 22:11284633-11284655 GTGTGGGTATTGTGAGAAAAAGG - Intergenic
1180838489 22:18945764-18945786 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1182359538 22:29738442-29738464 CTGTGGGGACAGGGAGACAAAGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183818960 22:40328801-40328823 CTCTGAGGATGGGGAAAAAATGG - Exonic
1183952290 22:41358519-41358541 CTGGGGGAATGCGGAGAAAAGGG + Exonic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
949765740 3:7523814-7523836 ATGCGGGGATGGGGAGAAGAAGG + Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950030544 3:9849741-9849763 CCCTGGGAATGGGGAGAAAAAGG - Intronic
950194278 3:10998300-10998322 CTGTGAGGCTGGGGAGAAAAGGG + Intronic
952498205 3:33934771-33934793 CAGTGGGGATGGCAAGTACAAGG - Intergenic
952503125 3:33982934-33982956 GTCTGGGGATGGGGAGCAAAGGG - Intergenic
952712136 3:36442470-36442492 CTGTGGGGATGGACAGAGCAAGG + Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
957442610 3:80269728-80269750 CAGTGGGGAGGGCAAGAAAGAGG + Intergenic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
957791790 3:84951128-84951150 TGGTGAGGATGGGGAGAAAAGGG + Intergenic
959070626 3:101698930-101698952 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960027586 3:113026336-113026358 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961012402 3:123445225-123445247 CAGTGGGGGTGGGGAGAGAAGGG + Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963297476 3:143561583-143561605 CTGTAGCCATGGCGAGAGAATGG - Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
965053915 3:163689552-163689574 ATGTGGGGATTGAGAGAAAGTGG - Intergenic
965318494 3:167221922-167221944 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
967026016 3:185564614-185564636 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
968035455 3:195544136-195544158 CTGTGGTGAGGACGATAAAAAGG - Intergenic
968315506 3:197720941-197720963 CGGTGAGGATGGGGAGAAAAGGG - Intronic
970083406 4:12316368-12316390 CTGTGGGGATAGAAAAAAAATGG - Intergenic
970230402 4:13904151-13904173 GTGTGGGGGTGGGGAGGAAAAGG + Intergenic
972026444 4:34384183-34384205 GGGTGGGGATGGCTAGGAAATGG - Intergenic
972669927 4:41205389-41205411 TTTTGGGAATGGTGAGAAAATGG - Intronic
973144990 4:46814040-46814062 TGGTGGGGATGTGGAGAAAAGGG + Intronic
973830100 4:54750569-54750591 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
977341980 4:95770715-95770737 CACTGGGGATGTGGAGAAAAGGG + Intergenic
977551665 4:98449444-98449466 CTGTGGGGTTGGCTATAAAGAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982695727 4:158597799-158597821 CTGTGGGGATGGGATGGAAAAGG - Intronic
982722045 4:158869249-158869271 CTGTGGGGATGACAACAAGAAGG + Exonic
983078600 4:163356786-163356808 TTGTGAGGATGGTGATAAAAAGG + Intergenic
983123366 4:163916745-163916767 CTGTGGGGGTAGGGAGAATATGG - Intronic
984030167 4:174594405-174594427 AAGTGGGGATGGGCAGAAAAGGG - Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987847018 5:23300474-23300496 CTTTGGGGAAGCCAAGAAAATGG - Intergenic
987952828 5:24698013-24698035 TGGTGAGGATGGGGAGAAAAGGG - Intergenic
987968218 5:24905134-24905156 CTGAGGGGAAGGCCAAAAAATGG - Intergenic
988134633 5:27154991-27155013 CTTTGGGGATTTGGAGAAAAGGG - Intergenic
988380140 5:30488711-30488733 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
988605871 5:32678006-32678028 ATGTGGGGAGGGCCAGATAAGGG - Intergenic
989148971 5:38279226-38279248 TTGTGAGGATGTGGAGAAAAGGG + Intronic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990149724 5:52802288-52802310 GTGTGGAGGTGGGGAGAAAAGGG - Exonic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990742093 5:58922673-58922695 CGGTGGGGCTGGGGAGGAAATGG - Intergenic
991154881 5:63421295-63421317 CTGTTGGGATGGGGAAAAACAGG + Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992257887 5:74940091-74940113 TGGTGAGGATGGGGAGAAAAGGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
993971526 5:94425748-94425770 CTGTGAGGATCTGGAGAAAAGGG - Intronic
994430276 5:99650060-99650082 CAGTGGGGATGTGGTGAAAAGGG + Intergenic
994476009 5:100270882-100270904 CTGTGGCTATAGCGAAAAAATGG - Intergenic
994961705 5:106613713-106613735 CGGTAGGGATGGAGAGAGAATGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
997188795 5:131909926-131909948 CGGTGAGGATGTGGAGAAAAGGG + Intronic
998080986 5:139274593-139274615 ATTTGGGGATGGCTGGAAAAAGG + Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999421004 5:151443301-151443323 TGGTGAGGATGTCGAGAAAAGGG - Intronic
999523451 5:152376934-152376956 CTGTATGGATGGGGACAAAATGG + Intergenic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
999951862 5:156659772-156659794 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1000322363 5:160144732-160144754 CGGTGAGGATGCAGAGAAAAGGG - Intergenic
1000366808 5:160499505-160499527 CAGTGGGGATGGCAAGTAACTGG + Intergenic
1001054902 5:168441258-168441280 CTGTGGGGAAGGGGAAAAAGAGG + Intronic
1001165269 5:169359788-169359810 TTGTGAGGATGCAGAGAAAAGGG + Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1003528251 6:6916494-6916516 CTGTGCTCATGGAGAGAAAATGG + Intergenic
1003558846 6:7164486-7164508 CTGATGGGATGCCAAGAAAATGG + Intronic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004404444 6:15318827-15318849 GTGTGGGGTAGGCGAGAAAGGGG + Intronic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005058016 6:21748347-21748369 ATGTGTGGGTGGGGAGAAAAGGG - Intergenic
1005920750 6:30398353-30398375 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1006247615 6:32753307-32753329 GTGTGGGGAGAGGGAGAAAAAGG + Intergenic
1006254644 6:32820602-32820624 ATGTGGGGATGGGGAGGAAGTGG + Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1007457743 6:41993287-41993309 CTGTGAGGATGAGGAGAAAAGGG - Intronic
1008795392 6:55296526-55296548 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1009955699 6:70449895-70449917 CGGTGAGGATGTGGAGAAAAAGG - Intronic
1010591615 6:77719003-77719025 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1010930584 6:81797775-81797797 TGGTGGGGATGTGGAGAAAAGGG - Intergenic
1011164236 6:84428105-84428127 CTGTGGGGAGGGGAAGGAAATGG - Intergenic
1011388296 6:86821576-86821598 ATGTGCTGATGGTGAGAAAATGG - Intergenic
1011520938 6:88205281-88205303 TTGTGAGGATGTGGAGAAAAGGG + Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1012938043 6:105388487-105388509 GGGTGGGGGTGGGGAGAAAAGGG + Intronic
1013573881 6:111459775-111459797 CAGTGGGGCTGTGGAGAAAAGGG + Intronic
1014148063 6:118021167-118021189 CTCTGGGGATTGAGATAAAAGGG + Intronic
1015084094 6:129266253-129266275 CTGTGGGGATTACTACAAAATGG - Intronic
1016244878 6:141969474-141969496 GGGTGGGGATGGCTAGACAATGG - Intergenic
1016424763 6:143922990-143923012 TTGTGAGGATGCGGAGAAAAGGG - Intronic
1019705406 7:2495018-2495040 TGGAGGGGATGGCGAGAACAAGG - Intergenic
1019856306 7:3611834-3611856 TTGTGGTGATGGGGTGAAAAGGG + Intronic
1019976289 7:4584492-4584514 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1019977225 7:4592996-4593018 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022064716 7:26840095-26840117 CTGTGGGCATTGCGAGACACAGG - Intronic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023257249 7:38324083-38324105 TTGTGGGCATGGCAAGAAAAGGG + Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023513419 7:40977210-40977232 CTGCTGGGAGGGAGAGAAAAGGG + Intergenic
1024080906 7:45854085-45854107 CTGTCGGGAAGGGGAGAAGAGGG + Intergenic
1025123599 7:56327754-56327776 CTGTCGGGAAGGGGAGAAGAGGG - Intergenic
1026787632 7:73311865-73311887 CTGTGGGTATGGTGAGTCAAAGG + Intergenic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027432200 7:78125838-78125860 CTTTGGGGTTGGGGAGAAAATGG + Intronic
1027562754 7:79752657-79752679 TTGTGGGGATGCGGTGAAAAGGG - Intergenic
1030407795 7:109136635-109136657 TGGTGGGGATGAGGAGAAAAGGG - Intergenic
1030413320 7:109210133-109210155 TGGTGGGGATGCGGAGAAAAGGG - Intergenic
1031026191 7:116682775-116682797 CAGTGGGCATGGCGAAAAATTGG - Intronic
1031168331 7:118258834-118258856 ATGTAGGGATGGCTACAAAAAGG + Intergenic
1031282043 7:119817215-119817237 TGGTGAGGATGGGGAGAAAAAGG - Intergenic
1031352171 7:120747108-120747130 ATGTGGGGAAGGGGATAAAAGGG - Intronic
1032941227 7:136794917-136794939 CTGTGAGGATGTGGAGAAAAGGG + Intergenic
1033123215 7:138684619-138684641 TTGTGGGAATGTGGAGAAAAAGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033412989 7:141137069-141137091 TTGGGGGGATGTGGAGAAAAGGG + Intronic
1033675103 7:143533183-143533205 CTTTGGTGATGGCCACAAAAGGG + Intergenic
1033696733 7:143796258-143796280 CTTTGGTGATGGCCACAAAAGGG - Intergenic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037663690 8:20949166-20949188 CTGTGGGGAGGGCCACAGAAGGG - Intergenic
1037872864 8:22515602-22515624 TGGTGAGGATGTCGAGAAAAGGG - Intronic
1038202528 8:25427518-25427540 CTGTTGGGATGACAGGAAAAAGG - Intergenic
1039371501 8:36988431-36988453 CTTTGGTGATGGCCACAAAAGGG + Intergenic
1039916172 8:41861951-41861973 CTCTGGGGAAGGGAAGAAAATGG - Intronic
1041168327 8:55114209-55114231 CTGTGAGGTTGCAGAGAAAAGGG - Intronic
1041992033 8:64005000-64005022 CTGAGGGGTGGGAGAGAAAATGG - Intergenic
1042425849 8:68647308-68647330 CCGTGAGGATGTAGAGAAAAGGG + Intronic
1043387899 8:79766534-79766556 CTTTGGGGGTGGGGAGAGAACGG - Intronic
1044394691 8:91697003-91697025 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045652279 8:104352418-104352440 CTTTGGGGGTGGCCAGGAAAAGG + Intronic
1046440702 8:114249841-114249863 CTTTGGGGACAGCGAAAAAAAGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047342998 8:124000857-124000879 CTGTCTGCATGACGAGAAAATGG + Intronic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048330591 8:133467980-133468002 CGGTGAGGATGTGGAGAAAATGG + Intronic
1051765252 9:20515578-20515600 CGGTGAGTATGGGGAGAAAAAGG - Intronic
1052692031 9:31827177-31827199 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054931386 9:70639080-70639102 GTCTGGAGATGGTGAGAAAACGG + Exonic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1057144731 9:92750113-92750135 CTCTGGGGATTGCGAGGAGATGG - Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057644073 9:96856460-96856482 CTCTGGGGAGGGCGGGAGAAAGG - Intronic
1057667403 9:97056581-97056603 CTGAGGTGATGTGGAGAAAAAGG - Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058313036 9:103529910-103529932 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1058957196 9:109960131-109960153 GTGTGGGGAAGGGGTGAAAATGG - Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1061352292 9:130074958-130074980 ATGTGGGGATGACGATAACATGG + Intronic
1061735693 9:132656154-132656176 CTTTGGTGATGGCGTGAGAACGG - Intronic
1062289825 9:135789503-135789525 CTGTGAGGAAGGCGTGAAGAGGG - Intronic
1062518925 9:136949687-136949709 CTGTGGGGAGGCCGAGATGAAGG + Intronic
1186108686 X:6232471-6232493 CTATTGGGATGCTGAGAAAATGG + Intergenic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1188565747 X:31524116-31524138 CTCTGAGGTTGGGGAGAAAAAGG + Intronic
1189390213 X:40570284-40570306 CACTGGGGATGGGGAGAGAAGGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190409193 X:50117749-50117771 CTGTAGGGTTGGGGAGATAAAGG + Intergenic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191218694 X:57961843-57961865 TTGTGAGGATGGGGAGAAATTGG - Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192000946 X:67150699-67150721 ATGTGAGGATGTCAAGAAAAGGG - Intergenic
1192411087 X:70932952-70932974 GTGAGGGGATTGGGAGAAAATGG - Intergenic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1192760055 X:74087125-74087147 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
1192769893 X:74177883-74177905 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
1193408434 X:81133212-81133234 CTGTGAGGTTGTGGAGAAAAAGG + Intronic
1193907716 X:87263073-87263095 TGGTGGGGATGTGGAGAAAAGGG + Intergenic
1193933732 X:87589163-87589185 TGGTGGGGATGTGGAGAAAAGGG + Intronic
1195501517 X:105606410-105606432 TTGTGAGGATGTGGAGAAAAAGG + Intronic
1195585049 X:106555504-106555526 TTGTGGGGATGTGGAGAAAAAGG + Intergenic
1196574060 X:117298000-117298022 TGGTGAGGATGTCGAGAAAAAGG - Intergenic
1196585965 X:117428384-117428406 ATGTGGGGATGAAGAGAGAAAGG - Intergenic
1197066644 X:122240780-122240802 TGGTGGGGCTGGGGAGAAAAGGG - Intergenic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1197373097 X:125648206-125648228 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
1197707604 X:129646027-129646049 CCGTGGGGAAGGGGAGAAAGTGG - Exonic
1197739472 X:129878508-129878530 TAGTGAGGATGGGGAGAAAAGGG - Intergenic
1197958168 X:131975299-131975321 CGGTGGGGATGCGGTGAAAAGGG - Intergenic
1197971618 X:132120592-132120614 CTGTGGGGATGGGAAGCCAAGGG + Intronic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198270332 X:135051184-135051206 CTCTGGGGATGGGGAGGAAATGG + Exonic
1198729228 X:139709904-139709926 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1198943944 X:141988518-141988540 TTGTGAGGATGTGGAGAAAAGGG - Intergenic
1199041998 X:143125377-143125399 TTGTGGGGAAGTTGAGAAAAAGG - Intergenic
1199140943 X:144311580-144311602 TGGTGAGGATGGGGAGAAAAGGG + Intergenic
1199601205 X:149542178-149542200 TTGTGGTGATGACGAGAAAAGGG + Intronic
1199649172 X:149937306-149937328 TTGTGGTGATGACGAGAAAAGGG - Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200272921 X:154703750-154703772 TTGTGAGGATGTGGAGAAAAGGG + Intronic
1201488711 Y:14518756-14518778 CTATTGGGATGATGAGAAAAAGG - Intergenic