ID: 1085306240

View in Genome Browser
Species Human (GRCh38)
Location 11:75487615-75487637
Sequence GTCTCTTGGGACAGAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 198}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085306240_1085306246 3 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306246 11:75487641-75487663 TGATTGCCATTCCTCTCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 75
1085306240_1085306244 -1 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306244 11:75487637-75487659 CCTCTGATTGCCATTCCTCTCGG 0: 1
1: 0
2: 2
3: 22
4: 198
1085306240_1085306253 23 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306253 11:75487661-75487683 AGGAGGCTGGCAGGGCCCAGAGG 0: 1
1: 0
2: 14
3: 143
4: 1191
1085306240_1085306252 15 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306252 11:75487653-75487675 CTCTCGGGAGGAGGCTGGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 305
1085306240_1085306254 29 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306254 11:75487667-75487689 CTGGCAGGGCCCAGAGGCGAAGG 0: 1
1: 0
2: 2
3: 41
4: 360
1085306240_1085306247 6 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306247 11:75487644-75487666 TTGCCATTCCTCTCGGGAGGAGG 0: 1
1: 0
2: 2
3: 5
4: 107
1085306240_1085306249 10 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306249 11:75487648-75487670 CATTCCTCTCGGGAGGAGGCTGG 0: 1
1: 0
2: 2
3: 6
4: 164
1085306240_1085306251 14 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306251 11:75487652-75487674 CCTCTCGGGAGGAGGCTGGCAGG 0: 1
1: 0
2: 1
3: 38
4: 263
1085306240_1085306245 0 Left 1085306240 11:75487615-75487637 CCAACACTTCTGTCCCAAGAGAC 0: 1
1: 0
2: 1
3: 10
4: 198
Right 1085306245 11:75487638-75487660 CTCTGATTGCCATTCCTCTCGGG 0: 1
1: 0
2: 2
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085306240 Original CRISPR GTCTCTTGGGACAGAAGTGT TGG (reversed) Intronic
901207166 1:7503882-7503904 GTCCCCTGGGACACAAGTGCGGG - Intronic
901859100 1:12063082-12063104 GTTTCTTGGGGCAGGAGTGGAGG + Intergenic
902211486 1:14907860-14907882 GGCTCTGGGGAGAGAAGGGTTGG - Intronic
902556084 1:17247603-17247625 GGCTCTGGGGAGAGAAGTCTTGG - Intergenic
903219618 1:21861899-21861921 GGCTTTTGGGGCAGAAGTGAAGG - Intronic
904395911 1:30222004-30222026 GTCTCTTCAGCCAGAAGGGTAGG + Intergenic
908302781 1:62778695-62778717 GTCTTTTGTTACAGGAGTGTTGG + Intergenic
909774517 1:79467186-79467208 GTCTTTTGTTACAGGAGTGTTGG - Intergenic
911637482 1:100250932-100250954 GTCTCTTGGGCCAGGCGTGGTGG + Intergenic
911645340 1:100332273-100332295 TCCTCTTGAGACAGAGGTGTAGG + Intergenic
911655548 1:100438940-100438962 GTTTCTTGGGTCAGCAGTGGAGG + Intronic
911743043 1:101408390-101408412 TTCTCTTGGGACAGATGAGGAGG + Intergenic
913191182 1:116414494-116414516 TTCTCCTGGGACAGAACTGTGGG + Intergenic
913548732 1:119896093-119896115 GTCTCTTGGGCCACAAATGGAGG + Exonic
914940107 1:152014928-152014950 GACATTTGGGACAGAAATGTAGG + Intergenic
915115771 1:153598618-153598640 CCCTCTTGGGACTGAAGTGGTGG - Intergenic
915507479 1:156366919-156366941 GTGTCTTGGGGCAGAAGGCTGGG + Intronic
915911797 1:159920063-159920085 GTCTCTAAGGAAAGAACTGTGGG - Intronic
915954889 1:160213381-160213403 GTGTCCAGGGACAGCAGTGTGGG - Intronic
916657419 1:166888448-166888470 TTCTCTTGGGCTATAAGTGTTGG + Intergenic
919270815 1:195341912-195341934 CTCTCTTAGGGCAGAAATGTGGG + Intergenic
920234830 1:204495736-204495758 GTCTTTTGTTATAGAAGTGTCGG + Intergenic
920329334 1:205194229-205194251 GTCTTTTGTTAGAGAAGTGTTGG + Intronic
921857613 1:220003943-220003965 GTCTCTTGAGCCATAGGTGTTGG - Intronic
923005592 1:230046953-230046975 GTCTTTAAGGACAGAAGAGTGGG + Intergenic
923544528 1:234914469-234914491 TTGTTTTGGGACAGAATTGTTGG - Intergenic
924406458 1:243752848-243752870 GGCTCTTGGGATGAAAGTGTGGG + Intronic
1063099203 10:2934943-2934965 GGCTCTGGGGATAGATGTGTCGG - Intergenic
1065513405 10:26502352-26502374 GTCTCTTGGGCCAGGCGTGGTGG + Intronic
1070025098 10:72624942-72624964 GTATCTTGAGACAAAGGTGTTGG - Intronic
1071981989 10:91012760-91012782 GTCTCTGGTGACAGAAAGGTTGG - Intergenic
1072286748 10:93923276-93923298 GTCTAGTGGGACAGAAGTTTCGG - Intronic
1073299149 10:102460340-102460362 GTCCCTTAGCAAAGAAGTGTTGG + Intergenic
1073833149 10:107410291-107410313 GTCTCTAGGGAGAGAGCTGTGGG - Intergenic
1074781570 10:116806095-116806117 GTGTCATGGGCCAGAAGTGGTGG + Intergenic
1075473050 10:122707904-122707926 TTCTCTTGGGCCAGCAGCGTTGG + Intergenic
1076020565 10:127069301-127069323 GTTTCTTGGTACAGGATTGTTGG + Intronic
1077306357 11:1870355-1870377 GTCTCCTGGGAAAGAAGTGCCGG + Intronic
1078519092 11:12049177-12049199 GTCTGATGGGAAAGTAGTGTGGG + Intergenic
1081153575 11:39662166-39662188 GTCTCAGGGGACAGCAGAGTTGG - Intergenic
1082781689 11:57293096-57293118 GCCTCTTGAGCCAGCAGTGTGGG - Intergenic
1083221294 11:61254532-61254554 GGCTCTTGGGGCAGAGGTGCAGG - Intergenic
1085306240 11:75487615-75487637 GTCTCTTGGGACAGAAGTGTTGG - Intronic
1086478872 11:87211701-87211723 TTCTCTTGGGACAGAATAGCAGG + Intronic
1086954230 11:92919339-92919361 GTCTCCTGGGAGGGAAGTGATGG + Intergenic
1087648297 11:100833668-100833690 TTCACTTGGGACAGAAGTTTTGG - Intronic
1089805283 11:121082176-121082198 GTCCTGTGGGACAGAAGTCTGGG + Intronic
1089961226 11:122618739-122618761 GTCACTCTGGACAGAATTGTTGG - Intergenic
1090669570 11:128936994-128937016 GCTTCTGGGGAGAGAAGTGTGGG + Intronic
1091992358 12:4965783-4965805 ATCTATTGGGAAAGAAGTATGGG + Intergenic
1093416151 12:18923434-18923456 GTCCATTGGAACTGAAGTGTTGG - Intergenic
1093901118 12:24634438-24634460 GTGATTTGGGACAGAAGTGATGG + Intergenic
1095506649 12:42905684-42905706 GTCTCTAGGGACAAAAATCTGGG - Intergenic
1096223576 12:49848768-49848790 GTATCTTGGGAGAGAAATGGAGG - Intergenic
1096862649 12:54541018-54541040 GACTCTGGGGACAGAAGTGCTGG - Intronic
1097237512 12:57550144-57550166 GTCTCTGGGGACAGAGTTGAGGG - Exonic
1099477575 12:83125936-83125958 GTTTCTAGGAACAGAATTGTGGG - Intronic
1101726098 12:107389556-107389578 GTCACTCTGGACAGGAGTGTTGG - Intronic
1103866403 12:124055395-124055417 GTCTCTTAGGACAGATGAATAGG + Intronic
1104124903 12:125837220-125837242 GTCATTTGGGACAGATGAGTGGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1112021447 13:95374620-95374642 GTCTCTTGGGGCTGAGGTGGAGG - Intergenic
1113812034 13:113148898-113148920 GTCCCCTGGGACAGACGAGTGGG - Exonic
1114722825 14:24900542-24900564 CTCTGTTGGGAGAGAAATGTTGG + Intronic
1116182208 14:41549523-41549545 GTCTTTTGTTACAGGAGTGTTGG - Intergenic
1118522327 14:66598514-66598536 GTTTTTAGGGACAGAAGTGGAGG - Intronic
1119145970 14:72314458-72314480 GTCTCATTGGCCAGAACTGTGGG + Intronic
1119219864 14:72897952-72897974 GTCACCAGGGAAAGAAGTGTGGG + Intergenic
1120125842 14:80742179-80742201 ATCTCTTGTGACAAAAGTTTGGG + Intronic
1120625940 14:86826724-86826746 GTCTCTAGAAACAGAAGTTTTGG + Intergenic
1120902899 14:89591113-89591135 GTCTTTTGGTATAGGAGTGTCGG + Intronic
1121594427 14:95148831-95148853 GTCTCTTGAAACAAAACTGTAGG - Intronic
1125433298 15:39619893-39619915 GTCTCTAGGGAAAAAAGGGTAGG + Intronic
1127682149 15:61308293-61308315 GGCTCTTGGGACTGAAGTAGAGG - Intergenic
1128348749 15:66874790-66874812 GTGGCCTGGGACACAAGTGTAGG - Intergenic
1129484002 15:75851218-75851240 GTCTCCTGGGACTCAGGTGTAGG + Intronic
1130548377 15:84872915-84872937 GGCACTTGAGACAGAACTGTTGG + Exonic
1131550066 15:93349654-93349676 TTCTCTTGGGGCAGAATGGTGGG + Intergenic
1137543317 16:49379349-49379371 GCCCCTTGGGACAAAGGTGTAGG + Intronic
1138573274 16:57889786-57889808 GGCACTGGGGTCAGAAGTGTGGG - Intronic
1139711677 16:68781048-68781070 GTCTGTGGGGAAAAAAGTGTCGG + Intronic
1140065589 16:71608695-71608717 GTGTCTTGGGTGAGAAGAGTAGG + Intergenic
1140951963 16:79826831-79826853 AACTCTTGGGAGAGAAGTGGAGG + Intergenic
1143804881 17:9418060-9418082 GCCACGTTGGACAGAAGTGTGGG + Intronic
1144727733 17:17510371-17510393 GTTTCTGGGGACAGAAGGCTGGG - Intronic
1147617956 17:41841598-41841620 GTCTCTTGGGCCAGGCGTGGTGG - Intronic
1148348429 17:46920472-46920494 GTCTCTTGGGACACAAAACTGGG + Intergenic
1150813493 17:68375131-68375153 CCCTCTTGGGTCAGAACTGTAGG - Intronic
1153850261 18:9087630-9087652 GTCTCTAGGGAGAAAAGTGGAGG + Intergenic
1158755849 18:60324194-60324216 GTCTCTTCGGTAAGAAGTATTGG - Intergenic
1160435404 18:78848409-78848431 GCCTCTTTGGACAGAAATGGAGG + Intergenic
1160609535 18:80074523-80074545 GTCTGTTGTCACAGAAGTGTGGG + Intronic
1161678475 19:5666928-5666950 GTCACTCGGGACAGAAGTGCTGG - Intronic
1161796038 19:6387350-6387372 GTGGCTGGGGACAGAAGTGAGGG - Intronic
1163369547 19:16894232-16894254 GACTCTTGGGACCCAGGTGTGGG - Intronic
1164864109 19:31589733-31589755 GTCTGTGGGGACAGATGGGTGGG - Intergenic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1166072951 19:40397411-40397433 GTCTCTAGGCAGGGAAGTGTGGG + Exonic
1166458261 19:42963214-42963236 GGCTCTAGGGACAGAAGATTTGG - Intronic
1167620336 19:50556803-50556825 GTCTCTAGGGAGGCAAGTGTGGG + Intronic
1168100536 19:54138660-54138682 GCCTCTTGGGAGAGGAGTGGAGG + Intronic
1168570149 19:57460093-57460115 GTCTCTTGCTACAAATGTGTTGG - Intronic
925503082 2:4528789-4528811 GGCTTTTGAGACAGATGTGTAGG + Intergenic
927259343 2:21071011-21071033 GGCTCTGGGGACAGAAGAGAAGG + Intergenic
928373279 2:30756582-30756604 GCCTCTTGGGATAGAAGTAGAGG - Intronic
930978748 2:57496448-57496470 GTGTCCTGGGACAGATGTTTGGG - Intergenic
931244467 2:60480862-60480884 TTCTCTTGGGACAGAGATGGGGG - Intronic
931682627 2:64764567-64764589 GTCTCTTGGGTCACAAGTTGTGG - Intergenic
931797112 2:65721913-65721935 GTCTGTTAAGACAGAAGTATAGG - Intergenic
934529378 2:95075522-95075544 GTCGCTTGGGGCAGATGTGAGGG - Intergenic
935658174 2:105442778-105442800 GTCTTTTGTTAGAGAAGTGTTGG + Intergenic
936728075 2:115347043-115347065 GTCTTTTGTTACAGCAGTGTTGG - Intronic
937244564 2:120484243-120484265 TTTTCTTGGGAAACAAGTGTGGG + Intergenic
937284359 2:120740951-120740973 TTCACTTGGGACAGGAGTGCAGG - Intronic
945039285 2:205730640-205730662 GACATTTGGGACAGAAATGTGGG + Intronic
946164831 2:217857650-217857672 GTCTCTCGGGACTGAAGTCAAGG - Intronic
946327329 2:218991522-218991544 GCCTCTTGGAACAGAAGAATTGG + Intronic
1169125306 20:3122987-3123009 GTATCTGGGGAGAGAAGTGCAGG + Intronic
1169256750 20:4105589-4105611 GTGTTTAGGGACAGAAGTATGGG - Intergenic
1169426240 20:5499627-5499649 GTCTTTTTGGACTGAAGTGCAGG - Intergenic
1170417940 20:16164356-16164378 GTCCCTGGGGCCAAAAGTGTTGG - Intergenic
1170514068 20:17109591-17109613 GTGTGTTTGGACAGAAATGTGGG + Intergenic
1173288735 20:41695752-41695774 GTCTCTTGGGAAAGACTGGTAGG - Intergenic
1178145149 21:29730798-29730820 GTCCCATAGGACAAAAGTGTAGG - Intronic
1180835206 22:18926263-18926285 GTTGCTTGGAAAAGAAGTGTCGG - Intronic
1183317048 22:37142553-37142575 GTCCCTTGGGCCAGCTGTGTGGG - Intronic
1183483899 22:38079130-38079152 GCCTCCTGGGACAGAGGGGTGGG - Intronic
1203285294 22_KI270734v1_random:151562-151584 GTTGCTTGGAAAAGAAGTGTCGG - Intergenic
949416909 3:3825062-3825084 GTGTCTTGGGACAGACGGGAAGG - Intronic
951846486 3:27090011-27090033 GTCTCATGGGAAAGAAGAATAGG - Intergenic
953007813 3:38994503-38994525 ATCTCTTTGGAGAGAACTGTTGG + Intergenic
954847039 3:53568500-53568522 GTATCTGTGGACAGAAGAGTAGG - Intronic
956361234 3:68450017-68450039 GTTTTTTGGGACAGAACTGGAGG + Intronic
957591375 3:82203863-82203885 GACTCTTGGGACACAACAGTTGG - Intergenic
957847482 3:85756128-85756150 ATCTCTTGTGACAGGAGTCTAGG + Intronic
959225932 3:103584692-103584714 GTATCTTGCAACAGAAGTGAGGG + Intergenic
962443547 3:135445061-135445083 GTCTCTAGGGACAGAGGCGAGGG - Intergenic
964672931 3:159247021-159247043 GTCTTTTGTTACAGGAGTGTTGG - Intronic
967315299 3:188146933-188146955 GTCTCTTGTGGCAGAGATGTTGG - Intergenic
969105001 4:4800476-4800498 GTCTCTTTGGAAAGCAGTTTGGG + Intergenic
973746316 4:53966703-53966725 GTCTGTGGGGTCAGAAGTGGCGG + Intronic
977525779 4:98143551-98143573 GTCTCTAGGGAGCGAAGTGGAGG + Intergenic
977866990 4:102040781-102040803 GTGTCTTGGGAAAGAAGAATTGG + Intronic
978835090 4:113139662-113139684 GACTATGAGGACAGAAGTGTAGG - Intronic
979015922 4:115433696-115433718 GGCTCTTGGCACTGAAGTGGTGG - Intergenic
980974453 4:139597638-139597660 GAAGCTTGGGACAGAAGTATGGG - Intronic
981325258 4:143438888-143438910 CTCTGTTGGGACAGAAGGGCAGG + Intronic
983630051 4:169840918-169840940 TTCTCTAGGGGCAGAAGTGCAGG + Intergenic
985912502 5:2895411-2895433 GTCTGTTGGGTGATAAGTGTTGG - Intergenic
986059148 5:4171533-4171555 GGGTCTTGGGACAGGAGTGAGGG + Intergenic
986212844 5:5690285-5690307 GTCTTTTGTTACAGGAGTGTCGG - Intergenic
990352782 5:54935399-54935421 TTTTCTTGGGAAAGAAGTCTGGG + Intergenic
991034695 5:62117036-62117058 CTCTCTGGTGACAGAATTGTGGG + Intergenic
992033155 5:72744189-72744211 GTCTCTTGGGCCAGAGCTCTGGG - Intergenic
993355731 5:86904981-86905003 GTATCTTGGAAAAGAAATGTGGG - Intergenic
993982679 5:94561430-94561452 TTGTCTTGTGGCAGAAGTGTGGG + Intronic
997113329 5:131099209-131099231 GTCTTTTATGACAGCAGTGTGGG - Intergenic
997900348 5:137757705-137757727 GTCTCTTGTGCCAGAAAAGTTGG - Intergenic
1001812418 5:174639102-174639124 TGCTCTTGGGAAAGAAGTGTTGG - Intergenic
1001967249 5:175919803-175919825 GTTTCTTAGGGCAGAAGTGGAGG + Intronic
1002471668 5:179439300-179439322 GGCTCTTGGGAGGGAAGGGTTGG - Intergenic
1004111016 6:12719120-12719142 TTCTTTTTGGACATAAGTGTTGG - Intronic
1006720326 6:36145805-36145827 GTCTTCTGAGACAGACGTGTTGG + Intergenic
1010811623 6:80307114-80307136 GCCTCTTGGGAAAGAAAAGTTGG - Intronic
1011311114 6:85980879-85980901 CTCTCTTGGGTTAGGAGTGTAGG - Intergenic
1011769871 6:90663614-90663636 GTCTCCTTAGACTGAAGTGTAGG + Intergenic
1011837405 6:91450437-91450459 GTCTTTTGTAACAGGAGTGTTGG + Intergenic
1011941989 6:92853995-92854017 GTCTCTTGGGAGTGGAGTGGGGG - Intergenic
1012797885 6:103786532-103786554 GTCACTGGGGACAGAAGCATGGG + Intergenic
1017944194 6:159080298-159080320 CTCTCTAGAGACAGAGGTGTGGG + Intergenic
1017963696 6:159245600-159245622 GTCTTTTGGGAAAGATGTGATGG - Intronic
1019189413 6:170242683-170242705 GTGTCTTGGGGCAGACCTGTGGG - Intergenic
1022983487 7:35626602-35626624 GTCTCTGGTGCCAGAAATGTTGG + Intergenic
1023957828 7:44901892-44901914 GTCTCCTGCGGCAGATGTGTGGG + Intergenic
1026490195 7:70856565-70856587 GCTTCTAGGGACAGAAGTCTAGG + Intergenic
1027487902 7:78784843-78784865 GTCTTTTGTTACAGGAGTGTTGG + Intronic
1029410974 7:100410404-100410426 GTCTCTTGGGACAGAAAGTCAGG + Intronic
1029595236 7:101534117-101534139 GCCTCTTGGGACAGCAGGGTTGG + Intronic
1030188057 7:106782535-106782557 GGCTCTTGTGACAGAAAAGTAGG - Intergenic
1030606710 7:111645480-111645502 GTATTTTGTGACAGAGGTGTAGG + Intergenic
1034969363 7:155409490-155409512 GTCTCATGGCACAGAAGCGGCGG - Intergenic
1036121454 8:6021680-6021702 GACTCTTGGGACATCAGGGTGGG - Intergenic
1040530301 8:48261260-48261282 GGCTCTGGGGACAGCAGTGAGGG + Intergenic
1040943432 8:52855717-52855739 GACTCTTGGGACAGAGGTAAAGG + Intergenic
1043919392 8:85963803-85963825 GTAGCTTGGGACGGAAGGGTGGG - Intergenic
1044444385 8:92257416-92257438 GAACCTTGGGACAGAAGTGGAGG + Intergenic
1047428775 8:124772290-124772312 GGCTCTTGGGACAGATGAGCTGG - Intergenic
1047822051 8:128531605-128531627 GTCTCCTGGGACAAATGTTTCGG + Intergenic
1049272234 8:141702177-141702199 GCGTGTTGGGAGAGAAGTGTGGG + Intergenic
1050843652 9:10186752-10186774 GTATCTTGTGACAGTAGTCTAGG - Intronic
1053196776 9:36125891-36125913 GTCTCGTGGCACTGAAGTTTGGG - Intergenic
1056306741 9:85298193-85298215 GTCTCTGGTGCCAAAAGTGTTGG - Intergenic
1057283437 9:93728646-93728668 GTCTCTGGGTACATATGTGTGGG - Intergenic
1057294809 9:93828649-93828671 GTATCTTTGGAGAGAAGTGGAGG - Intergenic
1057930084 9:99185500-99185522 GTTTATTGGGACAGAAGTGAAGG - Intergenic
1057992046 9:99780898-99780920 GTGTCTGGGGAAAGAAGTGAAGG + Intergenic
1061009417 9:127946301-127946323 GTGACTTGGGACAGGACTGTGGG - Intronic
1061508985 9:131049028-131049050 GGCTGGTGGGCCAGAAGTGTGGG + Exonic
1062411541 9:136427904-136427926 GTCTCTTGGGCCAGGCGTGGTGG - Intergenic
1186184793 X:7010260-7010282 GGCTCTAGGGACAGAAGATTTGG - Intergenic
1188132035 X:26447882-26447904 TTCCCTTGGGACACAAGTCTCGG - Intergenic
1188368236 X:29336539-29336561 GTCTTTTGGCATAGGAGTGTTGG - Intronic
1189036236 X:37496070-37496092 CTGTCTTGGGACTGAGGTGTGGG - Intronic
1189037740 X:37509612-37509634 CTGTCTTGGGACTGAGGTGTGGG - Intronic
1189263875 X:39698960-39698982 GTCTTTTGTTACAGGAGTGTGGG - Intergenic
1193661275 X:84261730-84261752 AGCTCTTGGGACAGAGGTGGAGG + Intergenic
1195557242 X:106241049-106241071 GTCTCTTTGTTCAGAAGTCTGGG + Intergenic
1198072894 X:133166984-133167006 GTCTTTTAGGATAGAAGTTTAGG + Intergenic
1198128009 X:133666395-133666417 GTTTCTGGTTACAGAAGTGTTGG + Intronic
1200171987 X:154083727-154083749 GTCTCCTGGGACAGAAGTGAAGG + Intronic