ID: 1085307027

View in Genome Browser
Species Human (GRCh38)
Location 11:75492274-75492296
Sequence CTGTGTCAGGTCACCCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 254}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085307017_1085307027 3 Left 1085307017 11:75492248-75492270 CCTACCTCCAGCCTGTGCCCACT 0: 1
1: 0
2: 2
3: 75
4: 584
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307018_1085307027 -1 Left 1085307018 11:75492252-75492274 CCTCCAGCCTGTGCCCACTGCCC 0: 1
1: 1
2: 15
3: 126
4: 911
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307019_1085307027 -4 Left 1085307019 11:75492255-75492277 CCAGCCTGTGCCCACTGCCCTGT 0: 1
1: 1
2: 7
3: 75
4: 629
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307016_1085307027 6 Left 1085307016 11:75492245-75492267 CCTCCTACCTCCAGCCTGTGCCC 0: 1
1: 1
2: 9
3: 83
4: 761
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307014_1085307027 10 Left 1085307014 11:75492241-75492263 CCCTCCTCCTACCTCCAGCCTGT 0: 1
1: 0
2: 6
3: 100
4: 860
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307013_1085307027 11 Left 1085307013 11:75492240-75492262 CCCCTCCTCCTACCTCCAGCCTG 0: 1
1: 0
2: 11
3: 107
4: 972
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307011_1085307027 20 Left 1085307011 11:75492231-75492253 CCTGCCATTCCCCTCCTCCTACC 0: 1
1: 0
2: 3
3: 77
4: 997
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307015_1085307027 9 Left 1085307015 11:75492242-75492264 CCTCCTCCTACCTCCAGCCTGTG 0: 1
1: 1
2: 8
3: 77
4: 754
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307020_1085307027 -8 Left 1085307020 11:75492259-75492281 CCTGTGCCCACTGCCCTGTGTCA 0: 1
1: 1
2: 3
3: 45
4: 371
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307012_1085307027 16 Left 1085307012 11:75492235-75492257 CCATTCCCCTCCTCCTACCTCCA 0: 1
1: 1
2: 12
3: 279
4: 2123
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254
1085307010_1085307027 23 Left 1085307010 11:75492228-75492250 CCTCCTGCCATTCCCCTCCTCCT 0: 1
1: 1
2: 19
3: 244
4: 2002
Right 1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG 0: 1
1: 0
2: 3
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085307027 Original CRISPR CTGTGTCAGGTCACCCAGCT GGG Intronic
900366460 1:2313806-2313828 CAGGGTCATTTCACCCAGCTGGG - Intergenic
900659030 1:3773720-3773742 CTTTCCCAAGTCACCCAGCTGGG - Intronic
900860854 1:5229090-5229112 TTTTGTCATGTTACCCAGCTTGG - Intergenic
901199612 1:7459207-7459229 TTGTCTAAGGTCACCCGGCTAGG - Intronic
902426154 1:16323758-16323780 CTTTGTCACCTCACCCACCTTGG - Intronic
903262585 1:22139414-22139436 CTGTCCAAGGTCACTCAGCTGGG + Intronic
903323027 1:22553835-22553857 CTGTCCAAGGTCACCCAGCCAGG - Intergenic
903538460 1:24082650-24082672 TTGTGTCAGGTCAGTCAGCGAGG - Exonic
903609273 1:24598281-24598303 TTGTGGCAATTCACCCAGCTGGG - Intronic
903683452 1:25113222-25113244 TTGTCTGAGGTCACCCAGCAAGG - Intergenic
904471594 1:30739861-30739883 CTGTGCCTGCTCACCCTGCTGGG - Exonic
904472702 1:30745923-30745945 CTGTGTCACGTGGCCCGGCTGGG + Intronic
904473327 1:30749019-30749041 CTGTGTGTGGACACCCAGCACGG + Intronic
904819735 1:33234209-33234231 TTGTGTAGGGTCACACAGCTAGG - Intergenic
904843275 1:33388236-33388258 CTGTCTCAGGTCTTCTAGCTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905687903 1:39922002-39922024 CTTTCTCAGGTCACACAGTTAGG - Intergenic
906302925 1:44696862-44696884 CTGTGGCAGTTCAGCCACCTTGG - Intronic
906621488 1:47284605-47284627 TTGTGTCACCTCACCCAGCCAGG - Intronic
906789506 1:48646225-48646247 CTGTGATAGGGCACCCAGCAGGG + Intronic
907243238 1:53092137-53092159 TTGTGACAGGGCACCCAGCCAGG + Intronic
907745884 1:57213077-57213099 CTGCTTTAGATCACCCAGCTGGG - Intronic
908025636 1:59948881-59948903 GTGAGTCACTTCACCCAGCTTGG - Intergenic
910278955 1:85477282-85477304 CTGTGTCAGGGCTCTCAGCCAGG - Intronic
910323552 1:85977089-85977111 CTGGGTCTGGCCACCCAGCAGGG - Intronic
911169475 1:94756045-94756067 CGGTGTCTGGTCCCCCAGCAAGG + Intergenic
912906018 1:113708253-113708275 CTGTTTCTGGTCACCCTGCTTGG - Intronic
917626144 1:176848416-176848438 CTGTGCCAGGTCACCTATCAAGG - Intergenic
919844546 1:201633401-201633423 CTGTCTGAGGACATCCAGCTAGG + Intronic
920230588 1:204467197-204467219 CTGAGTCAGGGCACCCTGGTAGG - Intronic
921684542 1:218074976-218074998 CTGTCCAAGGTCACACAGCTAGG - Intergenic
922465388 1:225842932-225842954 CTGAGTCAGGCCACAGAGCTGGG - Intronic
923314477 1:232766457-232766479 CTATGTCTGGGCACCCAGCTGGG + Intergenic
924588455 1:245380611-245380633 CTGTGCCAGGTCACACGGCTAGG + Intronic
924600370 1:245483359-245483381 CTGTCCGAGGTCACCCAGCTGGG + Intronic
1063623626 10:7669480-7669502 CTCTGTCAAGTCATACAGCTAGG - Intergenic
1066151772 10:32629417-32629439 CTGTGTCAGCTCCCACAGATAGG + Intronic
1066162184 10:32746057-32746079 CTGTGTCTGGTCAGCCATCTTGG - Intronic
1067229592 10:44397104-44397126 CTGTGTGTGGGCAGCCAGCTTGG + Intergenic
1067811144 10:49428491-49428513 TTGTCCCAGGTCACCCAGCAAGG + Intergenic
1069913403 10:71773163-71773185 CTGTGCCAAGTGCCCCAGCTAGG - Intronic
1071189710 10:83084815-83084837 CTGTGTCTAGTCAGCCATCTTGG - Intergenic
1071306312 10:84302303-84302325 ATGTGACAGGGCACACAGCTGGG - Intergenic
1072432656 10:95387084-95387106 CTCTGTCATGTCACCCAGGCTGG - Intronic
1072747253 10:97949428-97949450 CTGTCTCAGGGAACCAAGCTGGG + Intronic
1073332108 10:102677082-102677104 CTGTCCCTGGTCACCCAGGTGGG - Intronic
1074101353 10:110357028-110357050 CTGGCCCAGGTCACACAGCTAGG - Intergenic
1074253397 10:111776655-111776677 CTCACTCAGGGCACCCAGCTGGG - Intergenic
1076193560 10:128499406-128499428 CTGGGAGGGGTCACCCAGCTAGG + Intergenic
1076369112 10:129940489-129940511 TTGTTTGAGGTCACTCAGCTGGG - Intronic
1078634340 11:13034877-13034899 TTGTCCAAGGTCACCCAGCTAGG - Intergenic
1079833156 11:25296800-25296822 CTGTGTCAGGTTATCCACTTTGG - Intergenic
1080236913 11:30080459-30080481 CAGTGTCAGGTCAGGCTGCTTGG - Intergenic
1080408799 11:32004047-32004069 TTGTGTAAGGTCACACAGCTAGG - Intronic
1080856741 11:36118264-36118286 CTGTGCAAGGTCACACAGCTAGG + Intronic
1081574674 11:44311487-44311509 CTGGTCCAGGTCACACAGCTGGG + Intergenic
1084013797 11:66367165-66367187 TTGTCTCAGGCCACACAGCTGGG + Intronic
1085118416 11:73950849-73950871 CTGTGAAAGGTCACTCAACTCGG - Exonic
1085179518 11:74521743-74521765 GTGTCCCAGGTCACCCAGCTAGG - Intronic
1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG + Intronic
1086869285 11:92017723-92017745 CTGTGTCTAGCCACCCAGCAGGG + Intergenic
1090258988 11:125305268-125305290 GTGTGTAAGGTCACACAGCCAGG + Intronic
1090425164 11:126602539-126602561 CTGCCTGAGGTCACACAGCTAGG + Intronic
1096179007 12:49540393-49540415 CTGAGCCAGGTCAGGCAGCTAGG + Intronic
1096407183 12:51352359-51352381 CTGTCCAAGGTCACCCAGCAAGG - Exonic
1097676464 12:62607652-62607674 CTGTGACATATCACACAGCTTGG - Intergenic
1098348463 12:69530939-69530961 CTGTGGCATGTCAACCAGCTTGG + Intronic
1098659421 12:73073456-73073478 CTGTGTCTAGTCAGCCATCTTGG + Intergenic
1100731717 12:97478455-97478477 TTGTTTAAGGTCACACAGCTAGG + Intergenic
1100767805 12:97887000-97887022 CTGTGCCTGGTCAGCCTGCTGGG - Intergenic
1101968608 12:109297017-109297039 CTGTCTAGGGTCACCCAGCCAGG + Intronic
1102545476 12:113651809-113651831 CTGCCTGAGGTCACCCAGCCAGG - Intergenic
1102584572 12:113914243-113914265 CTCTCTCTGGTCATCCAGCTGGG - Intronic
1103763962 12:123269159-123269181 CTGTCTGAGGTCACACAGCCAGG - Intronic
1103929946 12:124444816-124444838 TTGTCTAAGGTCACCCAGGTAGG + Intronic
1104785998 12:131448323-131448345 CTGGGTCAGGGCCCCCAGCCAGG - Intergenic
1106082878 13:26515118-26515140 GTGGGACAGGTCACCAAGCTGGG + Intergenic
1106138506 13:26991985-26992007 TTGAGTCAGGACACCCGGCTGGG + Intergenic
1106990888 13:35418653-35418675 CTGTGCCAGGTTACCAATCTAGG - Intronic
1107040814 13:35945390-35945412 CTGGGTGAGCTCACACAGCTGGG - Intronic
1107040816 13:35945395-35945417 CTGTGTGAGCTCACCCAGCCTGG + Intronic
1107112395 13:36712019-36712041 CTGTTTCAGGCCACACAGCTAGG + Intergenic
1107294965 13:38898798-38898820 CACTGGCAGGTCACACAGCTGGG + Intergenic
1108046685 13:46390032-46390054 CTGTGTCAGCTAGCCCAGCCGGG + Intronic
1110174716 13:72542296-72542318 CTGAGTTAGGGCACCAAGCTAGG + Intergenic
1114233033 14:20801096-20801118 CTCTGTCAGTTCACCCTGCATGG + Intergenic
1114622944 14:24108887-24108909 CTCTGTGTGGTCACCAAGCTGGG + Intronic
1115914871 14:38301328-38301350 CTGTGTCTAGTCAGCCATCTTGG - Intergenic
1118913573 14:70082101-70082123 TTGTCCAAGGTCACCCAGCTAGG + Intronic
1119891374 14:78185043-78185065 CAGTGCCAGCTCAACCAGCTTGG - Intergenic
1120100459 14:80439056-80439078 CTGTGTCTAGTCAGCCATCTTGG - Intergenic
1121185632 14:91965350-91965372 CTGTGACAGGTCACACAGAAAGG + Intergenic
1121522820 14:94598099-94598121 CTGTGTCAGGACCCCCAGAGCGG + Intronic
1122268000 14:100555600-100555622 CTGTCTGAGGTCACACAGCCCGG + Intronic
1122416467 14:101552002-101552024 CTGTGTCTGCTCACCCCGCATGG - Intergenic
1122964987 14:105119190-105119212 CTGTGTGAGCTCACCCAGAGAGG - Intergenic
1122970540 14:105150415-105150437 CTGTCACAGGTCACCAGGCTTGG - Intronic
1127960820 15:63888985-63889007 CTGCCCCAGGTCACACAGCTGGG - Intergenic
1128666894 15:69544909-69544931 CTGTGCCAGGTCACATGGCTGGG + Intergenic
1128747020 15:70121867-70121889 CTGTCTCCGGTGACCCAACTGGG - Intergenic
1128761116 15:70216590-70216612 CTGTGTCATCTCACCCTTCTGGG + Intergenic
1129151085 15:73688176-73688198 CTCTGTCAGGCCACACATCTGGG - Intronic
1129680043 15:77653603-77653625 CAGGGGCAGGTTACCCAGCTGGG + Intronic
1129693713 15:77728595-77728617 CTGCCTGAGGTCACACAGCTAGG - Intronic
1132912400 16:2321251-2321273 CCTTGACAGGTCACCCAGCCTGG - Intronic
1133224633 16:4335010-4335032 CTGGGGCAGGTCACCCCGCATGG + Intronic
1133950779 16:10390584-10390606 CTGTGTAATGTTACCCAGGTGGG - Intronic
1134326654 16:13213823-13213845 CCTGGTCTGGTCACCCAGCTGGG - Intronic
1134666106 16:16019864-16019886 CTGTGTCATCTCCCCCAGCTCGG + Intronic
1135713070 16:24734609-24734631 CTCTGTCAAGTGACCCAGCTGGG + Intronic
1135990063 16:27213043-27213065 CTTACTCAGGTCACCCAGCTGGG + Intronic
1136380775 16:29894286-29894308 TTGTCCCAGGTCACACAGCTAGG + Intronic
1139014653 16:62675667-62675689 TTGTGTGAGGTCATGCAGCTGGG - Intergenic
1140877946 16:79170321-79170343 CTATGCAAGGTCCCCCAGCTAGG + Intronic
1141206825 16:81939255-81939277 CTGGGTCAGGTCAGCCACGTAGG - Intronic
1142259558 16:89036421-89036443 CAGTGTCAGGACACCCACCCTGG + Intergenic
1142414027 16:89931713-89931735 CTGTGCAAGGTCACACAGCTGGG + Intronic
1143672502 17:8406160-8406182 CTGTGTCAGGGCACATGGCTTGG + Intergenic
1143806700 17:9434452-9434474 TTGTGGCAGGAAACCCAGCTAGG + Intronic
1144835701 17:18155610-18155632 TTGTCTCAGGTCACACAGCCAGG + Intronic
1146953003 17:36919611-36919633 TTGTCTGAGGTCACACAGCTAGG - Intergenic
1147363047 17:39943458-39943480 GGGTGTCAGGGCATCCAGCTAGG - Intronic
1148732285 17:49844770-49844792 TTGTCCAAGGTCACCCAGCTGGG + Intronic
1149666390 17:58367686-58367708 CTCTGTCCAGTCACCCAGATTGG - Intronic
1150601808 17:66657534-66657556 CTTTGTTAAGTCACTCAGCTGGG + Intronic
1150695417 17:67400954-67400976 CTCTGTCATGTCACCCAGGCTGG + Intronic
1153425074 18:4953598-4953620 CTGGGTCTAGTCACCCAGCAGGG - Intergenic
1153639581 18:7145170-7145192 CTGTGTCAGATAACACAGCGTGG - Intergenic
1156219847 18:35040462-35040484 CTGCTTAAGGTCACACAGCTAGG - Intronic
1158968666 18:62645516-62645538 CTGTATCTTGTCACCCAGGTTGG - Intergenic
1159561233 18:69997284-69997306 CTGTGTCAGATTCCCCACCTGGG - Intergenic
1159561243 18:69997349-69997371 CTGTGTCAGATTCCCCACCTGGG - Intergenic
1161165122 19:2782806-2782828 CTGGGCAAGGTCACCCAGGTAGG + Intronic
1163220403 19:15914413-15914435 CTGGGTGGGGTCACCCAGTTGGG + Intronic
1163442928 19:17330614-17330636 CCCTCTCAGGTCACCCACCTAGG + Intronic
1164495144 19:28753936-28753958 CCGTGTCAGGTCATCCCTCTTGG - Intergenic
1164550166 19:29204114-29204136 TTATGTCAGGTCACACATCTAGG + Intergenic
1164705617 19:30317280-30317302 TTGTCTGAGGTTACCCAGCTGGG + Intronic
1165736667 19:38181348-38181370 ATGTGCCAGCACACCCAGCTAGG - Intronic
1167502671 19:49856591-49856613 TGGTGTTAGGTCACACAGCTAGG + Intronic
1168540927 19:57209619-57209641 CTGTGCCACTGCACCCAGCTTGG - Intronic
926148861 2:10413468-10413490 CTCTCCCAGGTGACCCAGCTGGG - Intronic
928805445 2:35145368-35145390 TTGTGCCAGGTCACAAAGCTAGG + Intergenic
929307675 2:40382196-40382218 CTGTGGCAGGTCATTAAGCTTGG - Intronic
930650684 2:53961528-53961550 ATGTATCAGCACACCCAGCTAGG - Intronic
932554636 2:72810856-72810878 CTTTGCCATGTCACCCAGCCTGG - Intronic
936462667 2:112724056-112724078 CAGCGTCAGGGCACCAAGCTTGG - Intronic
938080149 2:128365616-128365638 CTCTGTCAGGTCACTCATCCTGG + Intergenic
940464877 2:154014543-154014565 CTGTGTCAGGTCAGCCATCTTGG + Intronic
940792630 2:158044479-158044501 GAGAGTCAGGTCAGCCAGCTAGG + Intronic
942815507 2:180048809-180048831 TTGTTTAAGGTCACACAGCTAGG + Intergenic
943715877 2:191151487-191151509 CTGGGTCAGGTCACCCTCGTCGG - Intronic
944768626 2:202890029-202890051 TTTTGTCATGTCACCCAGGTTGG - Intronic
944924644 2:204452030-204452052 CTGTCTGAGATCACCCAGTTGGG - Intergenic
945230516 2:207584431-207584453 CTCTGTCATGTCACCCAGGCTGG + Intronic
1169927903 20:10802182-10802204 CTGTCTCAAGTCCCACAGCTTGG + Intergenic
1170588674 20:17754705-17754727 CTGTGTCCCCTCACCCATCTCGG + Intergenic
1171316531 20:24200420-24200442 TTGGGCCAGGTCACCCACCTCGG + Intergenic
1172657323 20:36545060-36545082 CTGTCCCAGCTCACCCAGCGAGG - Exonic
1173840074 20:46151397-46151419 TTGTCTGAGGTCACACAGCTAGG - Intergenic
1174819567 20:53714724-53714746 TTGTCCCAGGTCACACAGCTAGG - Intergenic
1175151995 20:56942138-56942160 GTGTGCAAGGTCACACAGCTAGG - Intergenic
1175871212 20:62210328-62210350 CTGTCTGAGGTCACACCGCTGGG + Intergenic
1176222576 20:63977077-63977099 CCGGGTCAGGCCACCCAGCGAGG + Exonic
1177010749 21:15728643-15728665 CTTTGACAGGTCACCCTCCTTGG + Intergenic
1179381365 21:40902450-40902472 CAGTGTTTGGTCTCCCAGCTTGG + Intergenic
1179552099 21:42150101-42150123 CTGCCTCAGATCACACAGCTGGG + Intergenic
1180243622 21:46530236-46530258 CTGTGTCAGATCACCCAACAAGG + Intronic
1182022863 22:27095789-27095811 CTGTATAAGGCCACACAGCTAGG + Intergenic
1182063862 22:27416831-27416853 CTTTGGCTGGGCACCCAGCTGGG - Intergenic
1182120435 22:27782939-27782961 TTGTCTGAGATCACCCAGCTCGG + Intronic
1182643295 22:31786637-31786659 CTCTGTCCTGTCACCCAGGTTGG + Intronic
1183628452 22:39018784-39018806 CTTTGTCATGTGACCCAGCCTGG - Exonic
1183747443 22:39699720-39699742 GGGTGTCAGGACTCCCAGCTGGG - Intergenic
1183830361 22:40415657-40415679 CTGTGTGAGGGGACCCAGCTGGG - Intronic
1185143961 22:49119334-49119356 CTGTCTCAGGTAACCAGGCTGGG - Intergenic
1185271611 22:49932085-49932107 CTGTGTCTGGTTACCGAGGTCGG + Intergenic
949127490 3:463943-463965 CTGAGTCAGGTCACACAGCTTGG + Intergenic
950231181 3:11277195-11277217 CTGAGGCAGGGCAACCAGCTGGG - Intronic
950435169 3:12974995-12975017 CTGTGTGAGGTCACATAGCGGGG - Intronic
955829404 3:62985191-62985213 CAGACTCAGGTAACCCAGCTGGG - Intergenic
956004724 3:64766215-64766237 CAGTTTCTGGTGACCCAGCTTGG - Intergenic
956322932 3:68018801-68018823 TTGTTTAAGGTCACCTAGCTTGG + Intronic
957034317 3:75279668-75279690 TTGAGTAAGGTCACACAGCTAGG + Intergenic
958259467 3:91363931-91363953 CTGTGTCTAGTCAGCCATCTTGG - Intergenic
960004187 3:112765188-112765210 TTGTCTAAGGTCACACAGCTTGG - Intronic
960578034 3:119246268-119246290 CTGGGTCTAGCCACCCAGCTAGG - Intergenic
960755033 3:121001862-121001884 CTGTGTCTAGTCAGCCATCTTGG + Intronic
961459518 3:127041484-127041506 ATGTGGCAGGTCACCCAGGCGGG - Intergenic
962506164 3:136048362-136048384 CTATGTCAGGTCAAGAAGCTAGG + Intronic
962919247 3:139935902-139935924 CTGTGACTTGTCTCCCAGCTCGG + Intronic
963097768 3:141563710-141563732 TTGTCTAAGGTCACACAGCTGGG + Intronic
964391553 3:156202518-156202540 CTGTGTCTAGTCAGCCATCTTGG + Intronic
965822269 3:172696608-172696630 CTGTTCAAGGTCACACAGCTAGG + Intronic
966947777 3:184789473-184789495 CTGTGCCAGGGCACACAGCTCGG + Intergenic
968050561 3:195652014-195652036 TTGTGTCCGTTCACCCAGCCTGG + Intergenic
968096761 3:195936845-195936867 TTGTGTCCGTTCACCCAGCCTGG - Intergenic
968105264 3:195996339-195996361 TTGTGTCCGTTCACCCAGCCTGG - Intergenic
968303553 3:197633916-197633938 TTGTGTCCGTTCACCCAGCCTGG - Intergenic
968404339 4:327083-327105 CTGTGTGAGTTCTCCCAGCAGGG + Intergenic
968573032 4:1352364-1352386 CTGTGGCAGGTCCCACACCTGGG - Intronic
968944565 4:3656823-3656845 CTGTGGCAGGACACCCTGCAGGG + Intergenic
969222522 4:5770489-5770511 CTGTTCAAGGTCACTCAGCTGGG + Intronic
969340562 4:6538228-6538250 TTGTCTCAGGTCCCACAGCTGGG + Intronic
969568794 4:7995937-7995959 CTGCCTGAGGTCACCCAGCCAGG + Intronic
970887799 4:21006766-21006788 CTGTGTCATGTAACACAGCATGG + Intronic
973192785 4:47405538-47405560 TTGTTTTAGGCCACCCAGCTAGG - Intronic
973734335 4:53855506-53855528 CTGTGTTGAGTCAACCAGCTAGG + Intronic
976164813 4:82243059-82243081 CTGTCCCAGGTCACACAACTAGG - Intergenic
977913158 4:102560975-102560997 CTGTGTAAGGCCACAGAGCTAGG + Intronic
979050166 4:115920757-115920779 CTCTGTCCAGGCACCCAGCTAGG + Intergenic
981733793 4:147927610-147927632 CTGTCACAGGTCACACAACTAGG + Intronic
984609979 4:181827021-181827043 CTGTCTGGTGTCACCCAGCTAGG - Intergenic
984757436 4:183337519-183337541 CTGTCTGGGGGCACCCAGCTGGG + Intergenic
986070196 5:4275438-4275460 CTGTGTGCGGGCACCCTGCTGGG - Intergenic
986380253 5:7177287-7177309 CTGTGTCAGTTTACTCACCTAGG + Intergenic
986610515 5:9562285-9562307 GTGAGTCAGGCCACCCTGCTGGG - Intergenic
987396899 5:17432505-17432527 CTGTCTAAGATCACCCAGGTGGG - Intergenic
989053691 5:37345872-37345894 CTCTGTCACGTCACCCAGGCTGG - Intronic
994260394 5:97651757-97651779 CTGTGCCAGGTGACCCTGCTAGG + Intergenic
996141264 5:119912807-119912829 CTGGGTCTAGCCACCCAGCTGGG + Intergenic
997480129 5:134178376-134178398 CAGTGTCAGGTCACACAGCCCGG + Intronic
998261021 5:140632006-140632028 CAGTGTCAGGTTATCCACCTCGG + Exonic
998348950 5:141488437-141488459 CTGAATCAGGTCACCCAGGAGGG - Intronic
999387817 5:151167547-151167569 CTGTGCAAGGTCACACAGCAAGG + Intergenic
999420810 5:151440794-151440816 CTTGCCCAGGTCACCCAGCTGGG + Intronic
999828740 5:155299112-155299134 GTGTGTCAGGCCCCCTAGCTGGG - Intergenic
1001050221 5:168408214-168408236 CTAGGTCAAGTCACACAGCTGGG + Intronic
1001434935 5:171692890-171692912 CTGGTTAAGGTCACTCAGCTGGG + Intergenic
1003513914 6:6803053-6803075 CTGGGTCAGAGAACCCAGCTTGG - Intergenic
1005039623 6:21589124-21589146 CTGGATCAGGTAACCCAACTCGG - Intergenic
1007236651 6:40395241-40395263 CTGCCTGAGGTCACACAGCTGGG + Intronic
1010031882 6:71279789-71279811 CAGTGTCTGCCCACCCAGCTTGG - Intergenic
1011422921 6:87193249-87193271 ATGTAACAGGTCACACAGCTGGG + Intronic
1012477100 6:99625747-99625769 CTCTCTAAGGTCAGCCAGCTAGG + Intergenic
1015309924 6:131755532-131755554 CTGTTCCAGATCACACAGCTAGG - Intergenic
1016404222 6:143713583-143713605 CTGTGTGAGGACACCCGGCTGGG + Intronic
1016656812 6:146528144-146528166 CTGTGTTATGTCACCCACCGTGG - Intergenic
1017743788 6:157429048-157429070 CTGAGTCAGCTCACCCTGCATGG + Intronic
1018839151 6:167506456-167506478 CTGTGCCTGGTGACCCAGCCTGG + Intergenic
1019371681 7:665323-665345 CTGCGTCGGGCCACCCAGCTTGG - Intronic
1021958075 7:25846266-25846288 ATGTGTCAGGTCACCAAATTGGG - Intergenic
1022049424 7:26651278-26651300 CTCCCTGAGGTCACCCAGCTGGG + Intergenic
1022423290 7:30244682-30244704 TTGTCTGAGGTCACCCAGCTAGG + Intergenic
1024314992 7:48007602-48007624 CTGTGTGACGTTACCCAGCTGGG - Intronic
1024588121 7:50858551-50858573 CTGTCTCAGGTCACCCTGGGTGG - Intergenic
1030858831 7:114597581-114597603 CTCTGTCTAGTCACCCAGCCTGG - Intronic
1032267436 7:130379431-130379453 CTGTGTCAGGACCCCGACCTTGG - Intergenic
1035072935 7:156158039-156158061 CTAGGTCAGGTCACCAAGCATGG + Intergenic
1036767429 8:11557681-11557703 CTGTCTGAAGTCACCCAGCCGGG - Intronic
1038541744 8:28395634-28395656 CTGTGCCACCACACCCAGCTAGG - Intronic
1039935705 8:42042643-42042665 CTGCTCCAGGTTACCCAGCTGGG + Intronic
1043381252 8:79704531-79704553 TTGTCTGAGGTCACACAGCTGGG - Intergenic
1043954106 8:86342236-86342258 GTGTTCGAGGTCACCCAGCTAGG + Intergenic
1046731754 8:117733599-117733621 CTGTCTAAAGTCACACAGCTTGG - Intergenic
1047017748 8:120741577-120741599 CTCTGTCACATCACCCAGGTGGG - Intronic
1047982977 8:130202735-130202757 CTGCCTCAGGTGACCTAGCTTGG + Intronic
1048190545 8:132284412-132284434 CTGTCTCAGGTAACACAGCTAGG + Intronic
1048264209 8:132971225-132971247 CTGGGTCAGCCCACCCAGCCAGG - Intronic
1048866459 8:138765164-138765186 CAGTGCCAGCACACCCAGCTGGG - Intronic
1049444540 8:142623992-142624014 CTGGGTCAGGGCACCGAGCCGGG + Intergenic
1049726665 8:144149645-144149667 CTGTGCCGGTCCACCCAGCTTGG + Intronic
1050082124 9:1926733-1926755 CGGTAACAGGTCACCAAGCTTGG - Intergenic
1050293779 9:4183556-4183578 CTTTATAAGGTCACACAGCTTGG - Intronic
1051097071 9:13477990-13478012 CTGCGTCTGGTCAACCATCTTGG + Intergenic
1052330054 9:27258690-27258712 CGGTGTCAGGTCGCCAAGGTAGG - Intergenic
1052359889 9:27542265-27542287 TTGTCTAAGGTCACACAGCTAGG + Intergenic
1056038755 9:82637661-82637683 CTGTCTCAGGGCACAAAGCTGGG - Intergenic
1056403250 9:86248686-86248708 CAGGTTCAGGTCACCCAACTGGG - Intronic
1056794765 9:89650364-89650386 CTGTGTCAGGAGCCCCTGCTGGG + Intergenic
1057206023 9:93173184-93173206 CTGAGTCAGGTCGCCCAGCTGGG + Intergenic
1057799553 9:98181893-98181915 TTGTCTGAGGTCACACAGCTTGG - Intronic
1058280070 9:103103295-103103317 ATGTGTCAGCACACCCAGCTGGG - Intergenic
1060193874 9:121610469-121610491 TTGCCTAAGGTCACCCAGCTGGG + Intronic
1060725519 9:126003335-126003357 CTTTATGAGGTCACACAGCTGGG - Intergenic
1061257194 9:129459915-129459937 CAGTGTCAGGGCCCCGAGCTTGG - Intergenic
1061388611 9:130304880-130304902 CAGGGACAGGTCAGCCAGCTGGG - Intronic
1061647585 9:132018066-132018088 ATGTGTAAGGTCACCCAGTTTGG - Intronic
1062647819 9:137558365-137558387 TTGTGTCCTGTCACCCAGGTGGG - Intronic
1185735611 X:2493278-2493300 CTGTGTCCTGTCACTCAGGTCGG - Intronic
1187790131 X:22941697-22941719 CTGGGTCTGGTCACCCAGCAGGG - Intergenic
1193291533 X:79778287-79778309 CTGTGTCTAGTCAGCCATCTTGG + Intergenic
1195823034 X:108968189-108968211 CTGTGTCAGGTCACTGTACTGGG - Intergenic
1196926930 X:120642583-120642605 TTGTCCCAGGTCACACAGCTAGG - Intergenic
1197729554 X:129797993-129798015 TTGTCTAAGGTGACCCAGCTAGG - Intergenic
1200790209 Y:7292824-7292846 GTGAGCCAGGGCACCCAGCTGGG + Intergenic