ID: 1085309108

View in Genome Browser
Species Human (GRCh38)
Location 11:75505762-75505784
Sequence GGCCCTATCACAAATATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085309108 Original CRISPR GGCCCTATCACAAATATAGT AGG (reversed) Intronic
913558427 1:119993110-119993132 GGCCCTAACCCAAAAATAGTGGG + Intronic
913639414 1:120797341-120797363 GGCCCTAACCCAAAAATAGTGGG - Intergenic
914279033 1:146152595-146152617 GGCCCTAACCCAAAAATAGTGGG + Intronic
914540081 1:148603537-148603559 GGCCCTAACCCAAAAATAGTGGG + Intronic
914626565 1:149467680-149467702 GGCCCTAACCCAAAAATAGTGGG - Intergenic
916525230 1:165603204-165603226 GACCCTGTCTCAAAAATAGTAGG + Intergenic
919667658 1:200307740-200307762 GGCCCTAACATAAATACAATAGG - Intergenic
920445669 1:206014266-206014288 GGCACTGTCACAACCATAGTGGG - Intronic
922993285 1:229934282-229934304 GGCCCTACACCTAATATAGTTGG - Intergenic
1069767626 10:70874953-70874975 GGCCCTATCAGAGCTATAGGAGG - Intronic
1070208876 10:74294207-74294229 GGCCATATTACAAATAATGTTGG + Intronic
1078373717 11:10774767-10774789 GGTTCTTTCCCAAATATAGTCGG - Intronic
1085309108 11:75505762-75505784 GGCCCTATCACAAATATAGTAGG - Intronic
1085334913 11:75685745-75685767 GGCCCTGACACAATAATAGTGGG - Intergenic
1088601414 11:111480349-111480371 GGACAAATCACAATTATAGTTGG + Intronic
1098189916 12:67937159-67937181 GGTCTTATCACAAATGTAGGTGG - Intergenic
1099093997 12:78350181-78350203 GGCCATATGGCAGATATAGTGGG - Intergenic
1100067648 12:90669523-90669545 GGCCCTATCTCCAATATTGGGGG - Intergenic
1101042637 12:100772113-100772135 GGGCCTGTCATAGATATAGTAGG + Intronic
1101926719 12:108977748-108977770 GGGCATATCACAAACAAAGTGGG + Intronic
1102855258 12:116288136-116288158 GGCCTTATCTCCAAGATAGTTGG - Intergenic
1104072392 12:125356915-125356937 GTCGTTAACACAAATATAGTAGG - Intronic
1111196492 13:84881510-84881532 GGATCTATCACAAATATATTGGG - Intergenic
1112225074 13:97531791-97531813 GGCCCTACTACAATTATAGAGGG + Intergenic
1115287953 14:31738198-31738220 GGTCATATCAAAAATATAGTGGG + Intronic
1120729252 14:87983665-87983687 GGCCTTAACACACACATAGTGGG - Intronic
1129610366 15:77049761-77049783 GGCCATATCATAAATATTTTAGG + Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1148285771 17:46390256-46390278 GTCCCTATCTCCAAAATAGTTGG + Intergenic
1148307934 17:46607877-46607899 GTCCCTATCTCCAAAATAGTTGG + Intronic
1154226734 18:12511925-12511947 GACCCTATCACTAAAATAGGAGG - Intronic
926990408 2:18673899-18673921 GGCAGTAACACAAAAATAGTGGG - Intergenic
927435573 2:23063485-23063507 GTCCCTATCAAGAATACAGTAGG + Intergenic
931197298 2:60064554-60064576 GGCCCTATTAGAAATAAATTTGG + Intergenic
939824820 2:147001200-147001222 GGCCTTTTCACAAATATACTGGG + Intergenic
942869289 2:180715606-180715628 GCCACTATCTCAAATATTGTTGG + Intergenic
1170211878 20:13854010-13854032 GGCCCTCTCAGAAATATGGCAGG - Intronic
1171315427 20:24188096-24188118 GGACAAATCACTAATATAGTGGG - Intergenic
1177849131 21:26325588-26325610 GGCCCTCTCACAAATCTAGGTGG + Intergenic
952744754 3:36765942-36765964 GGCCCTATCACCTATATTTTAGG + Intergenic
957465516 3:80585069-80585091 GGGAAGATCACAAATATAGTTGG - Intergenic
966838562 3:184068977-184068999 GTCTCTATCAGAAATATAGATGG - Intergenic
973025264 4:45260973-45260995 GGCACTATGACATATATAGATGG - Intergenic
973174297 4:47185355-47185377 GGTCCTATCAGAAATTTACTTGG - Intronic
973854461 4:54996848-54996870 GGCCCTACCTCCAATATAGGGGG + Intergenic
975090932 4:70403261-70403283 GGCCAGATAACAAATATTGTAGG + Intronic
981297797 4:143153079-143153101 GGCCCCAACACAAAAATAGCTGG - Intergenic
985425136 4:189822620-189822642 GTCCCTACCACAAAAATAGTTGG + Intergenic
986700400 5:10402080-10402102 GGCCTAATCACAACCATAGTTGG + Exonic
987100340 5:14585614-14585636 GTCCCTGTCACAAAAACAGTTGG + Intronic
991105141 5:62834626-62834648 AAACCTACCACAAATATAGTAGG + Intergenic
996931034 5:128887609-128887631 AGGTCTAACACAAATATAGTTGG + Intronic
1000411687 5:160940215-160940237 GCACCTATCACCAATATATTTGG + Intergenic
1000801634 5:165734778-165734800 GGCCCCAACACAATAATAGTTGG - Intergenic
1004920570 6:20371699-20371721 GGCCCTATTTCAAAAACAGTGGG + Intergenic
1005502557 6:26442909-26442931 GTCCTTAACACTAATATAGTAGG + Intronic
1006652306 6:35561691-35561713 GGCCCTTTCACAAATTTAATGGG - Intergenic
1010082171 6:71876635-71876657 GACTTTATCAAAAATATAGTAGG - Intergenic
1017977608 6:159371993-159372015 GGCCCTATCAATAATATATCTGG + Intergenic
1032939432 7:136771769-136771791 GGCCCTATCACCATAATAGCGGG + Intergenic
1033628726 7:143136212-143136234 GGCCCTAGAACAAAGGTAGTGGG - Intronic
1035177584 7:157062931-157062953 GGAGCTATTACAAATATAGCTGG - Intergenic
1042255233 8:66795947-66795969 AGCCCTAGAACAAAGATAGTAGG + Intronic
1042486276 8:69349621-69349643 GGCCCTTTCACAGACAAAGTTGG + Intergenic
1045668106 8:104513415-104513437 TGAGCTATCAGAAATATAGTGGG - Intronic
1060228510 9:121810625-121810647 GGCCCTCTCACACATCTGGTGGG + Intergenic
1191054324 X:56226882-56226904 GTCAATACCACAAATATAGTTGG - Intergenic
1194859586 X:98980170-98980192 TGCCTTATCACAAAGATAGAGGG - Intergenic
1197010326 X:121553491-121553513 GGCCCTAATACAATAATAGTAGG + Intergenic
1197272115 X:124436259-124436281 GGACCTATCAGAAATCTAGCTGG - Intronic
1202133879 Y:21640017-21640039 GTCTCTATGAAAAATATAGTAGG + Intergenic