ID: 1085309581

View in Genome Browser
Species Human (GRCh38)
Location 11:75508332-75508354
Sequence AGATCTGCCTTGCAAATCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085309578_1085309581 4 Left 1085309578 11:75508305-75508327 CCAATTTCTTTGCTCTGGCCTAG 0: 1
1: 0
2: 1
3: 19
4: 253
Right 1085309581 11:75508332-75508354 AGATCTGCCTTGCAAATCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 67
1085309576_1085309581 29 Left 1085309576 11:75508280-75508302 CCACAGATCAAGTATCTAAAAAC 0: 1
1: 0
2: 2
3: 18
4: 233
Right 1085309581 11:75508332-75508354 AGATCTGCCTTGCAAATCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085309581 Original CRISPR AGATCTGCCTTGCAAATCGG TGG Intronic
902219814 1:14957849-14957871 AGATGTGCCTTGCACCTCAGAGG + Intronic
906763769 1:48407408-48407430 AGCTCTGCCTAGCAAAGCTGTGG + Intronic
908052807 1:60251080-60251102 AGATCTGCTTTACACATCAGTGG + Intergenic
911034821 1:93530869-93530891 AGATTTACCTTGTAAATCTGAGG - Exonic
911664019 1:100534028-100534050 ACCTCTGCCTTGCAAATTGCTGG + Intergenic
1067272571 10:44804942-44804964 GGAGCTGCCTTGCATGTCGGGGG + Intergenic
1070187117 10:74075216-74075238 AGCTCTGCCTTGTATATGGGTGG + Intronic
1075738990 10:124681930-124681952 AGGGCTGCCCTCCAAATCGGTGG + Exonic
1082989369 11:59194119-59194141 AGCTTTGCATTGCAACTCGGTGG - Intronic
1085309581 11:75508332-75508354 AGATCTGCCTTGCAAATCGGTGG + Intronic
1087411675 11:97798437-97798459 AGATCTGCCCTCCATATGGGTGG - Intergenic
1088538477 11:110887106-110887128 AGATTGGCCTAGCAAATTGGTGG - Intergenic
1090355440 11:126137478-126137500 AGCTCTGTCTTCCAGATCGGGGG + Intergenic
1091060004 11:132452383-132452405 AGGTCTGCCTTGGAGATCGTGGG - Intronic
1094501178 12:31022318-31022340 AGATCAGCCTTGGAAAACAGAGG - Intergenic
1098196535 12:68008094-68008116 AGATCCCCCTTGCAATTCTGAGG - Intergenic
1102217582 12:111172344-111172366 AGTTCTGCCTCGCTAATGGGTGG - Intronic
1104415563 12:128594446-128594468 AGAACTGCCTTGCATATTGCAGG + Intronic
1114040153 14:18670431-18670453 ATATGTGCCTTGCAAATCTAAGG - Intergenic
1116337654 14:43678207-43678229 AAATCAGCCTTACAAATCTGTGG + Intergenic
1122571062 14:102701513-102701535 AGATATGCCTTTCAAATCAAAGG - Intronic
1124159221 15:27253725-27253747 TGATCTCCCTGGCAAGTCGGGGG + Intronic
1130056489 15:80530718-80530740 AGCTTTGCCTTGCAAAGTGGGGG + Intronic
1136084385 16:27874271-27874293 AGATCAGCCTTGCAATTAGAGGG + Intronic
1146919767 17:36702817-36702839 ATATCTGCCTTGCAGAATGGTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1159274678 18:66201421-66201443 AGATTAGCCTTGCAGATCAGTGG - Intergenic
929716174 2:44312571-44312593 ATATCTGCCTTTCAGATTGGTGG + Exonic
932390510 2:71386177-71386199 AGATCAGCCTTGCAAGTAGCTGG - Intronic
932534967 2:72582849-72582871 AGATCAGCCTGGCCAATTGGGGG - Intronic
935217745 2:100988195-100988217 AGATCTGCCCTGGAAGTTGGGGG - Exonic
937444228 2:121943308-121943330 AGATTTACCTTGCAAATCTAAGG - Intergenic
942009952 2:171751419-171751441 AGATCTGGCTTACAAATCTAGGG + Intergenic
1177194331 21:17886787-17886809 AGAGCTTCCTTGCAGATAGGTGG + Intergenic
949144226 3:676323-676345 AGATCTACCATGCACATGGGAGG - Intergenic
953877757 3:46676158-46676180 AGTTCTGCCTTGCATTTGGGAGG - Intronic
955688098 3:61564302-61564324 AGGGCTGCCTTGCAAATTAGAGG + Intronic
960462139 3:117949202-117949224 AGATCTACCATGCAAATGGGGGG - Intergenic
963285628 3:143431865-143431887 AGATGTACCTGGCAAATTGGAGG - Intronic
964384620 3:156134217-156134239 CTATCTGCCTTGAAAATTGGAGG + Intronic
980125735 4:128772075-128772097 AGATCTGCCTTTCCAAACTGTGG - Intergenic
990738187 5:58886952-58886974 AGATCTGATCTGCAAATCCGTGG - Intergenic
999733854 5:154497960-154497982 AGTTCTGCCTTGGTTATCGGAGG + Intergenic
1000999211 5:167989618-167989640 TGCTCTGGCTTGCAAATCCGTGG - Intronic
1001757487 5:174181646-174181668 AGAGCTGGGTTGCAAATCTGAGG - Intronic
1003812622 6:9801787-9801809 TGGTCAGCCTTGCAAATAGGTGG - Intronic
1003967183 6:11264084-11264106 AGACCTGCCTTCCACATCCGGGG - Intronic
1005519516 6:26586935-26586957 ACATCTGCCTCGCAAAGTGGTGG + Intergenic
1010639264 6:78303067-78303089 ATATCTGCATTGCAAATATGGGG + Intergenic
1012680866 6:102177277-102177299 AGATCTGCCTTCAATATGGGTGG - Intergenic
1013822944 6:114177078-114177100 AGAACTGCATTGCAATTCTGAGG - Intronic
1014056407 6:117020591-117020613 AAATATGCCTTGCAAATAGAAGG + Intergenic
1014170316 6:118271499-118271521 ACATCTGCCTCTCAAATAGGGGG - Intronic
1018828892 6:167426971-167426993 AGCTATGCCCTGCAAATCTGTGG + Intergenic
1019083792 6:169455527-169455549 AGATCTGCCTTTCTAATGGTGGG - Intergenic
1019960033 7:4451395-4451417 AGAAATGCCTTGCAAATGGGTGG + Intergenic
1024761579 7:52603169-52603191 AGATCAGACATGCAAATCGATGG - Intergenic
1026399108 7:69991147-69991169 AGATCTGCCTTGAAATTCCGGGG + Intronic
1029152130 7:98488184-98488206 AGATCAGCTTTGCAAATCACAGG + Intergenic
1035402309 7:158574908-158574930 AGTTCTGCCGTGTAAATCAGTGG - Intronic
1036053935 8:5229478-5229500 AGATCTACCTTACATAACGGTGG - Intergenic
1038459438 8:27703463-27703485 AGATCTGATTTGCAAAATGGTGG + Intergenic
1038676985 8:29631923-29631945 ATATCTGCCTTGCAAGACTGTGG - Intergenic
1042831860 8:73038930-73038952 AGATCAGCCTTTGAAATCAGAGG - Intronic
1045363596 8:101455043-101455065 ATATCTGCCTTACAAATGGTTGG + Intergenic
1055204081 9:73706536-73706558 AAAACTGCCTTTCAAATCAGTGG + Intergenic
1057052265 9:91934840-91934862 AGCTCTGCCTTGCAAAACAATGG + Intronic
1058069937 9:100591571-100591593 AGAACTGCCTTGCAGATCTAAGG + Intergenic
1059366578 9:113791075-113791097 AGATCTGCCTTGTAGGTCTGAGG + Intergenic
1192177240 X:68893714-68893736 ATATCTGCTTTGCAAATCACTGG - Intergenic
1201506598 Y:14708658-14708680 AAATGTGCCTTGCAAGTAGGGGG + Intronic