ID: 1085309637

View in Genome Browser
Species Human (GRCh38)
Location 11:75508682-75508704
Sequence CATGGGGGCCACAGTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 446}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085309637_1085309647 -6 Left 1085309637 11:75508682-75508704 CCTCCCCCACTGTGGCCCCCATG 0: 1
1: 0
2: 2
3: 45
4: 446
Right 1085309647 11:75508699-75508721 CCCATGCCAATCTAAGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1085309637_1085309649 -3 Left 1085309637 11:75508682-75508704 CCTCCCCCACTGTGGCCCCCATG 0: 1
1: 0
2: 2
3: 45
4: 446
Right 1085309649 11:75508702-75508724 ATGCCAATCTAAGCGGAGGGAGG 0: 1
1: 0
2: 1
3: 3
4: 42
1085309637_1085309652 15 Left 1085309637 11:75508682-75508704 CCTCCCCCACTGTGGCCCCCATG 0: 1
1: 0
2: 2
3: 45
4: 446
Right 1085309652 11:75508720-75508742 GGAGGATCTGTGATGCCTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 194
1085309637_1085309642 -10 Left 1085309637 11:75508682-75508704 CCTCCCCCACTGTGGCCCCCATG 0: 1
1: 0
2: 2
3: 45
4: 446
Right 1085309642 11:75508695-75508717 GGCCCCCATGCCAATCTAAGCGG 0: 1
1: 0
2: 0
3: 4
4: 92
1085309637_1085309651 14 Left 1085309637 11:75508682-75508704 CCTCCCCCACTGTGGCCCCCATG 0: 1
1: 0
2: 2
3: 45
4: 446
Right 1085309651 11:75508719-75508741 GGGAGGATCTGTGATGCCTCTGG 0: 1
1: 0
2: 0
3: 20
4: 285
1085309637_1085309645 -7 Left 1085309637 11:75508682-75508704 CCTCCCCCACTGTGGCCCCCATG 0: 1
1: 0
2: 2
3: 45
4: 446
Right 1085309645 11:75508698-75508720 CCCCATGCCAATCTAAGCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085309637 Original CRISPR CATGGGGGCCACAGTGGGGG AGG (reversed) Intronic
900192279 1:1356565-1356587 CAAGGGGGAATCAGTGGGGGAGG + Intronic
900422734 1:2562607-2562629 CTTGGGGGCCTCAGCTGGGGAGG + Intronic
900527305 1:3135559-3135581 CCTGCGGGCCACGGAGGGGGAGG - Intronic
900552200 1:3262518-3262540 GATGGGGGACACAGAGGGAGGGG - Intronic
900634915 1:3658179-3658201 CATGGGGGACACATTAGGGATGG + Intronic
901037782 1:6346765-6346787 CATTGGACCCAAAGTGGGGGTGG + Intronic
901295604 1:8158704-8158726 CACAGGGGCCACAGAGGTGGAGG + Intergenic
901630663 1:10646713-10646735 CATGGGCGCCACCGTGGATGTGG + Intronic
901884940 1:12216183-12216205 CTATGGGGCCACAGTGGTGGTGG - Intergenic
902447937 1:16478851-16478873 CATGGTGGCCACGGCAGGGGAGG + Intergenic
902467836 1:16629075-16629097 CATGGTGGCCACGGCAGGGGAGG + Intergenic
902506741 1:16943651-16943673 CATGGTGGCCACGGCAGGGGAGG - Intronic
902536397 1:17121342-17121364 GACTGGGGCCAGAGTGGGGGAGG + Intergenic
902717448 1:18282323-18282345 CACCTGGGCCAGAGTGGGGGTGG - Intronic
902772764 1:18655381-18655403 CATTGGGGACTCAGTGGGGGAGG + Intronic
903917488 1:26774897-26774919 CATGGGGGGCACAGGGGCAGAGG - Exonic
904083398 1:27886322-27886344 CTTGGGGGTGAGAGTGGGGGTGG - Exonic
905037019 1:34925142-34925164 GATGGGAGCGACAGTGGGAGGGG - Intronic
905356607 1:37389207-37389229 CCTGGTGGCAACAGTGGGGCTGG + Intergenic
905440316 1:37992428-37992450 TGTGGGGGCCACAGGGGTGGAGG - Intergenic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
905809611 1:40902509-40902531 CCGAGGGGCCACAGTGGGGCTGG + Intergenic
906033143 1:42735825-42735847 CAAGGGGGCCACTGGGTGGGGGG + Intronic
906141212 1:43534653-43534675 CATTGGAGGCTCAGTGGGGGAGG + Intronic
906523114 1:46478881-46478903 CTTGGGGCCCACAGGGGAGGAGG - Intergenic
906670335 1:47649546-47649568 CCTGGGGGCAAGAGTGAGGGGGG + Intergenic
906689046 1:47780681-47780703 AGTGGGTGGCACAGTGGGGGAGG + Intronic
909608160 1:77527403-77527425 AACGGGGACCACAGTGGGAGAGG - Intronic
910605414 1:89078261-89078283 CATTGGGGCCACATTGAGGGTGG + Intergenic
912525562 1:110280330-110280352 CTTGGTGGCCACAGGGTGGGAGG + Intronic
912995792 1:114531434-114531456 CATGTGGGCAACAGTGAGTGGGG + Intergenic
914847667 1:151291773-151291795 CAAGGGGGCCACAGGAGAGGAGG + Exonic
915030734 1:152878627-152878649 CATGGGAGCCACTGGGGGTGGGG + Intronic
915137955 1:153746882-153746904 CAAGGGGTCCACTGTGGGTGGGG + Intronic
915155045 1:153868453-153868475 CATGGGGGACGGGGTGGGGGTGG + Intronic
915278094 1:154803549-154803571 CCTGGGGACTACAGTGGGGCAGG - Intronic
915731672 1:158058505-158058527 CATGGGGGTCACTTTGAGGGAGG - Intronic
917447122 1:175115698-175115720 CATGCAGGCCACAGGGGGTGGGG + Intronic
917668394 1:177247945-177247967 CAGGGGTGCCACGGTGGAGGGGG + Intronic
920917840 1:210272573-210272595 CATGGGGGAAAATGTGGGGGCGG + Intergenic
922180172 1:223227268-223227290 CAGGGGGACCACAGTGGGAATGG + Intronic
922341010 1:224655159-224655181 CATGGGAGCTATAGTGGGTGGGG + Intronic
922526587 1:226308977-226308999 CTAGGGGACCACAGTGGGGCTGG + Intronic
923713349 1:236404455-236404477 CATGGGCGCCACCGTGGGCCTGG + Intronic
1062896170 10:1104970-1104992 CATGTGGGTCACAGTGGGGCAGG - Intronic
1063481202 10:6378155-6378177 GATGGGGGCAGCAGTGGGAGAGG - Intergenic
1067698261 10:48550986-48551008 CGTGAGGGCCACAGTGCTGGGGG - Intronic
1067776239 10:49166862-49166884 CCTGGGGGCCTCAGTGGTGAGGG - Exonic
1067938520 10:50632224-50632246 CATGGGAAGCAAAGTGGGGGTGG - Intergenic
1069730474 10:70608541-70608563 CATGAGGGCCACTGCGTGGGTGG + Intergenic
1075156128 10:119977387-119977409 CATGGTGGCAGCAGTCGGGGAGG - Intergenic
1075654770 10:124153473-124153495 CAGGGGGGCCACAAAGGGTGTGG + Intergenic
1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG + Intronic
1076629584 10:131844196-131844218 CATGGCGGCCTCGGTGGGGGCGG - Intergenic
1076873890 10:133206593-133206615 CAAGGAGGCCCCAGTGGGGTGGG + Intronic
1077035030 11:490359-490381 CATGGGGCCTGCAGTGGGGCTGG + Intronic
1077111226 11:863106-863128 GGAAGGGGCCACAGTGGGGGTGG - Intronic
1077184115 11:1228826-1228848 CTTGGGGGCCACTGGGGGTGGGG + Intronic
1077228781 11:1449572-1449594 GATGGGGGCCCCAGTGGGGCTGG + Intronic
1077327507 11:1970073-1970095 CCTGGCGGCCTCACTGGGGGAGG - Intronic
1077329525 11:1977907-1977929 GATGGGGGCCACAGGGAGGCTGG - Intronic
1077459562 11:2702037-2702059 CCTGGGGGCCACAGTGAGGCTGG - Intronic
1078601529 11:12735689-12735711 CATGGGGAGCAGAGTGGTGGTGG - Intronic
1079881459 11:25932519-25932541 CATGTGGCTCACAGTGGTGGTGG - Intergenic
1079989064 11:27228014-27228036 CTGGGAGGCCACAGTGGGGTGGG + Intergenic
1080116802 11:28630537-28630559 TATGGGGTTCACAGTGGGGTGGG + Intergenic
1082565116 11:54667785-54667807 CATTGGGGCCACAGAAGGGAAGG - Intergenic
1083031814 11:59599431-59599453 CATGGGGCCAACTGTGGGGTTGG - Intronic
1083791338 11:64988249-64988271 CCTGGGGGCCACACAGGGGTGGG + Exonic
1083861586 11:65422959-65422981 TAGGGGGACCACAGTGGGGCAGG + Intergenic
1083893033 11:65606233-65606255 CTTGGGGCCAACAGTGGGGTGGG + Intronic
1084551583 11:69846445-69846467 CATGGGGGCCAGAGGCTGGGAGG + Intergenic
1084681932 11:70671434-70671456 CCTGGAGACCACAGTGGGGTGGG + Intronic
1084785178 11:71437974-71437996 CATGGGGGCCCCAGGAGGGCCGG - Intronic
1084956443 11:72694061-72694083 GATGGGGGCCACAGGGAGGGTGG - Intronic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1085318421 11:75560011-75560033 CCTGAGGGCCAATGTGGGGGTGG + Intergenic
1085409383 11:76282303-76282325 CATGTGGGGGACAGTGAGGGCGG + Intergenic
1085527313 11:77171970-77171992 CGTCGGAGCCACAGTGCGGGGGG + Intronic
1086293314 11:85336278-85336300 CATGGGGAGCACAGTGGTGGTGG - Intronic
1086527087 11:87740711-87740733 CATGGTGGCCACAGAAAGGGAGG + Intergenic
1087700904 11:101435277-101435299 GAAGGTGGCCACAGTGGGAGTGG + Intergenic
1089290579 11:117435701-117435723 CATCCTGGCCACACTGGGGGTGG - Exonic
1089395853 11:118136023-118136045 GATGGAGGGCACGGTGGGGGGGG + Exonic
1090265398 11:125350345-125350367 GATGGGGGCAACAGTGGAGCAGG + Intronic
1090671859 11:128953304-128953326 CATGGGTGCGACAGTGTGTGTGG + Intergenic
1091034333 11:132219630-132219652 CATGAGGAAGACAGTGGGGGGGG - Intronic
1202812504 11_KI270721v1_random:33086-33108 GATGGGGGCCACAGGGAGGCTGG - Intergenic
1091398099 12:166256-166278 GACTTGGGCCACAGTGGGGGAGG - Intronic
1091802636 12:3334210-3334232 CATGGTGACCACGGTTGGGGAGG - Intergenic
1092218929 12:6700197-6700219 GATGGGGGCCACGCTGGGGCTGG - Exonic
1093437573 12:19153537-19153559 CAAGATGTCCACAGTGGGGGAGG - Intronic
1093778759 12:23109156-23109178 CATGTGGGCCACAGAGAGAGAGG - Intergenic
1093937927 12:25020778-25020800 CCTGGTGGGCACTGTGGGGGTGG - Intergenic
1095980612 12:47972408-47972430 AATGGGGGCCACAGTGGCGGGGG + Intergenic
1096913628 12:55009336-55009358 GCTGGGGGCCAGAGTGGGGATGG + Intergenic
1097068592 12:56338618-56338640 GATGGGGGGCACAGCGGGGATGG - Intronic
1100087189 12:90925954-90925976 CATGGGGGCAACAGCTGCGGGGG - Intronic
1101053053 12:100884368-100884390 CATGGGGGGCCCTGTGGAGGAGG - Intronic
1101809697 12:108096938-108096960 CATTGGAGGCACAGTGGGAGAGG - Intergenic
1101986550 12:109451702-109451724 CCTGGAGGCCACAGGCGGGGCGG - Exonic
1102050084 12:109855869-109855891 CATGGGCGCCCCAGAGGGAGTGG + Intronic
1103436873 12:120933512-120933534 CTTAGGGGACACAGTGGGGCAGG - Intergenic
1103888794 12:124223057-124223079 CATGGGAGCCGCCGTGGGCGAGG - Intronic
1104387625 12:128364746-128364768 CCTGAGGGACACAGTGGTGGTGG + Intronic
1104560576 12:129840312-129840334 CCTCGGGGCCATAGTGGGGGAGG - Intronic
1107786355 13:43961957-43961979 AAAGGGGGCCATGGTGGGGGTGG - Intergenic
1112006594 13:95258960-95258982 CCTGGGGGCTACATTGGGGCAGG + Intronic
1112245335 13:97728341-97728363 CATGGGAGCCACCGAGGGGAAGG - Intergenic
1113286796 13:108858584-108858606 CCTGGAGGCAGCAGTGGGGGTGG - Intronic
1117183160 14:53213124-53213146 CATGGGGGGGAGGGTGGGGGGGG + Intergenic
1117292837 14:54350170-54350192 CATGGGGGCCTCAGTCCTGGTGG + Intergenic
1118895594 14:69943009-69943031 GGTGGGGGGCACAGTGGAGGAGG + Intronic
1119649286 14:76372254-76372276 CATGGGGGACAGAGTGGGCTAGG + Intronic
1119796961 14:77407375-77407397 GATAGGGGCTACAGTGGAGGTGG + Intronic
1121011556 14:90523006-90523028 CATGGGCACCACAGCGTGGGAGG + Intergenic
1121411960 14:93754422-93754444 TAGGGGGGCCATGGTGGGGGGGG + Intronic
1121708097 14:96015887-96015909 CATGGGGTACACTCTGGGGGTGG + Intergenic
1122325634 14:100879473-100879495 CCTGGTGGCCTCAGTGGGGGTGG + Intergenic
1122695009 14:103548238-103548260 CCTGGGGGCAGCAGTGGGGTTGG - Intergenic
1122969668 14:105147466-105147488 CCTGGGGGCCACAGCAGGGGTGG - Intronic
1122981390 14:105193779-105193801 CATGGAGCCCACAGTGGCTGGGG + Intergenic
1123888169 15:24748648-24748670 CATGCTGGCCACTGTGGGGAGGG + Intergenic
1124631287 15:31338997-31339019 CCTGGGAGACACTGTGGGGGAGG + Intronic
1127874883 15:63103522-63103544 CATGGGGTCCACCCTGGGGTCGG + Intergenic
1128146926 15:65337082-65337104 GATGGGGGCCACGGGGAGGGTGG - Intronic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1129098326 15:73233233-73233255 CACTGGGGCCACAGTGGGCATGG + Intronic
1129379158 15:75154591-75154613 CATGGGGATGACGGTGGGGGTGG - Intergenic
1129875540 15:78973216-78973238 CTTGGGGGGCAGAGTGTGGGTGG + Intronic
1129889308 15:79060546-79060568 CATGGGTGCCTGAGCGGGGGTGG - Intronic
1130030425 15:80308617-80308639 CACTGGGGCCACAGTGATGGTGG + Intergenic
1131064761 15:89427177-89427199 CATGGGGCTCAAAGTGGGTGGGG - Intergenic
1131872066 15:96773523-96773545 AATGGGGTCCACAGTTGGAGAGG - Intergenic
1132169171 15:99629983-99630005 GACGGGGGCAAGAGTGGGGGAGG - Intronic
1132467694 16:85099-85121 GGGGGCGGCCACAGTGGGGGAGG + Intronic
1132578788 16:675861-675883 CAGGAGGGCCGCATTGGGGGCGG - Intronic
1132598009 16:762008-762030 CCTGTGGGCCACTGTGGGGTGGG - Intronic
1132663934 16:1073188-1073210 GACGGGGGCCACAGCGGGGCTGG + Intergenic
1132797900 16:1734272-1734294 CATGGGGGCGACAGAGGGGCAGG + Intronic
1133042538 16:3068112-3068134 AGTGGGGGCCACAGTGGGAAGGG + Intronic
1133180427 16:4050065-4050087 GTTGGGGGCCGAAGTGGGGGTGG + Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134552415 16:15144223-15144245 GGAAGGGGCCACAGTGGGGGTGG - Intergenic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134826985 16:17292903-17292925 TAAGGGGGCCACAGTGGGCAGGG + Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135328499 16:21542882-21542904 CACCGGGGCCACACTGGGGCTGG + Intergenic
1136338845 16:29628855-29628877 CACCGGGGCCACACTGGGGCTGG + Intergenic
1136686069 16:31995670-31995692 CTTAGGGGCCAGAGTGAGGGAGG + Intergenic
1136786682 16:32939199-32939221 CTTAGGGGCCAGAGTGAGGGAGG + Intergenic
1136883088 16:33914591-33914613 CTTAGGGGCCAGAGTGAGGGAGG - Intergenic
1137458137 16:48633917-48633939 CATGGGGGCCATAGAGAGGCTGG + Intergenic
1137508356 16:49076351-49076373 GATCGGGACCACAGTGGGGCAGG + Intergenic
1137558409 16:49487982-49488004 CATGGAGGCCACAGTGGCACAGG - Exonic
1138124372 16:54426754-54426776 CATGGGGGCTGCAGTGTTGGTGG + Intergenic
1138393142 16:56684492-56684514 CATGGGGTCCTCAGTGGTGAGGG + Intronic
1138451160 16:57093966-57093988 CCAGAGGGCCACAGGGGGGGAGG - Intronic
1138469095 16:57217831-57217853 TATTGGGGTAACAGTGGGGGTGG - Intronic
1139514180 16:67443644-67443666 CCAGGGGGCCACTGTGGGGTTGG + Intronic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1140025744 16:71289142-71289164 CACTGGGGCCCCAGTGGGCGTGG - Intronic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1140718564 16:77749517-77749539 CATGGGGGCAACTGTGGTGGGGG - Intergenic
1142109827 16:88325370-88325392 CATCAGGGTCACAGTGGGAGAGG + Intergenic
1203088918 16_KI270728v1_random:1200869-1200891 CTTAGGGGCCAGAGTGAGGGAGG + Intergenic
1143088670 17:4435499-4435521 AAGGGAGGGCACAGTGGGGGTGG + Intronic
1143571310 17:7760377-7760399 CAGGGGGGCCAGACTGGGGAAGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143781395 17:9231399-9231421 CCTGGGGGCCACAGCAGGGTGGG - Intronic
1144645705 17:16972167-16972189 CATGGGGGCGGGAGTGGGTGTGG - Intergenic
1144781316 17:17809888-17809910 CGGGGGGCCCACACTGGGGGCGG + Intronic
1144836893 17:18161283-18161305 CATGGGGGCTACAGCAGAGGTGG - Intronic
1145203750 17:20969414-20969436 CATGGGGGCGGGAGTGGGTGTGG + Intergenic
1145869694 17:28263592-28263614 TAGGGGGTTCACAGTGGGGGGGG - Intergenic
1147214713 17:38892476-38892498 CATGGGGGCCAGAGGTGGAGGGG + Intronic
1147685412 17:42284046-42284068 CATGGGAGCCAGAGGGGAGGTGG - Intergenic
1147818104 17:43224710-43224732 CTTGGGTGTCACAGTGGGTGAGG - Intergenic
1149302731 17:55319544-55319566 CAGGGAGGCAGCAGTGGGGGTGG + Intronic
1149983668 17:61331205-61331227 GATGGGGGCTAGAGTGGGAGGGG + Intronic
1151627057 17:75283465-75283487 CACGGGGTGCACAGTGAGGGTGG + Exonic
1151842649 17:76628809-76628831 AATGATGGCCACAATGGGGGAGG - Intronic
1151876464 17:76870151-76870173 CAGGGGGACCACAGTGGGGCTGG - Intronic
1152088151 17:78232460-78232482 CTGTGGGGCGACAGTGGGGGAGG + Intronic
1152330737 17:79671140-79671162 CATGGGGGCTGCAGGGGGGTTGG + Intergenic
1152376773 17:79922616-79922638 CGTGGCGGGCAGAGTGGGGGGGG - Intergenic
1152641889 17:81452701-81452723 CCTGGGGGCCGCAGGGGGGATGG - Exonic
1152717720 17:81907857-81907879 TCTGGGGGACACAGTGGGAGTGG + Exonic
1152809288 17:82374007-82374029 CATGGGACCTACAGTGAGGGGGG + Intergenic
1153949923 18:10049733-10049755 GATGGGGCCCTCGGTGGGGGAGG - Intergenic
1155979487 18:32165708-32165730 CACGGGAGCCACAGTGGGGATGG - Intronic
1157930132 18:51812497-51812519 CATGAGGGCCACAGATGGAGTGG + Intergenic
1158669742 18:59464088-59464110 CATGGTGGAGACAGTGGGGGAGG - Intronic
1159953978 18:74506697-74506719 CCTGGCTGCCCCAGTGGGGGTGG + Intronic
1160270955 18:77382932-77382954 CTTGGGGGCCAGGGTGTGGGAGG + Intergenic
1160841289 19:1148016-1148038 CAAGGGGGCCGGAGTGGGGAAGG - Intronic
1160860116 19:1234146-1234168 CATGGTGTCCACAGCCGGGGAGG - Intronic
1160923798 19:1533418-1533440 CATGGGGGCCAGTGGGGAGGTGG + Intronic
1161431185 19:4233311-4233333 AGTGGGGGCGGCAGTGGGGGCGG + Intronic
1161526960 19:4762086-4762108 CCTGGCAGCCACAGTGGTGGAGG - Intergenic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161849470 19:6731150-6731172 GAGGGCGGCCACGGTGGGGGTGG - Intronic
1163115068 19:15184391-15184413 CATGAGGGCCACAGGGTGCGGGG + Exonic
1163739101 19:18999796-18999818 CCTGGGGGACACAGTGCTGGGGG - Intronic
1164189579 19:22901838-22901860 CGTGGGCGGCGCAGTGGGGGCGG - Intergenic
1165444299 19:35848504-35848526 CATGGGTCCAACAGAGGGGGAGG - Intronic
1165828561 19:38719345-38719367 CATGCGGGCCAGGGTGGGGAGGG - Intronic
1165845882 19:38817315-38817337 CATGGGGGCTGCATTGGCGGAGG - Exonic
1165883241 19:39058227-39058249 CCTGGGGGTGACGGTGGGGGAGG + Intergenic
1166104386 19:40590222-40590244 CCTGGGGGGTGCAGTGGGGGAGG - Exonic
1166385511 19:42378392-42378414 CATGGGGGCCACTGAGGTTGGGG + Intronic
1166686542 19:44800084-44800106 CAGGGGTGACACAGTGGTGGCGG - Intronic
1166700607 19:44879506-44879528 GAGGGGAGCCACAGTCGGGGTGG - Intronic
1166796421 19:45428845-45428867 CAGGGGGGCCCGAGTGGAGGGGG + Intronic
1166858549 19:45795913-45795935 CCTGGGAGCCACAGAGGAGGAGG - Exonic
1168707258 19:58477222-58477244 CATGGGGGACCCAGAGGGGATGG - Exonic
926304598 2:11628854-11628876 TCTGGGGGCCACAGTGGAAGAGG + Intronic
926957447 2:18317068-18317090 CAAGGGGCTGACAGTGGGGGTGG - Intronic
927103848 2:19807782-19807804 CATGGGAGCCAGTGTGGGGAGGG + Intergenic
927702500 2:25277064-25277086 CAGGAGGGCCACCGTGGGTGCGG + Intronic
927978230 2:27356546-27356568 CACGGTGGCCACAGTAGGGAAGG + Intronic
928042316 2:27890691-27890713 CTTCGGGGCCGCAGAGGGGGCGG + Exonic
928669349 2:33585083-33585105 CATGGTGGCCACAGCAGTGGTGG - Exonic
930033630 2:47072639-47072661 GGCGGGGGCCGCAGTGGGGGTGG - Intronic
930717430 2:54605991-54606013 CATGGGGTCCAGGGTGTGGGAGG - Intronic
932460605 2:71879626-71879648 GATGGAGGGCACAGTGGGGTAGG - Intergenic
934969464 2:98751206-98751228 CATGGGAGAGACAGTGGGGGTGG - Intergenic
937468950 2:122158736-122158758 CCTGGCTGCCACAGAGGGGGTGG + Intergenic
939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG + Intronic
942512191 2:176714609-176714631 CCAGGGGGCCACAGTGTGGAAGG + Intergenic
944216678 2:197263340-197263362 CTGGGGCGCCACAGTTGGGGTGG + Intronic
946026182 2:216673244-216673266 CATGGAGGCCACAGAGGTGGTGG + Exonic
946153978 2:217794833-217794855 CATGGGGTCATCAGTGGGGCAGG - Intergenic
946563231 2:220936503-220936525 TATGGTGGCCATAGTGGAGGTGG - Intergenic
946717359 2:222566652-222566674 GATGGGTGCCACTGTGAGGGGGG - Intergenic
946817090 2:223590298-223590320 CATGTTGGCAACAGTGGGGGTGG + Intergenic
948388915 2:237598267-237598289 CAAGGGGGGGACAATGGGGGAGG - Intronic
1171406002 20:24912924-24912946 CATGCTGGCCACAGGAGGGGAGG - Intergenic
1172062532 20:32196376-32196398 CATGGGGGACACAGACGGGGTGG + Exonic
1172274483 20:33672360-33672382 CCTGGGTCCCACAGTGGGGCAGG - Intronic
1172316028 20:33955069-33955091 CATGCGGGCCACCGAGAGGGAGG - Intergenic
1172446706 20:34997061-34997083 CCTGGGAGCCACAGAGTGGGTGG - Exonic
1172519513 20:35557815-35557837 CCTGAGGACCACAGTGGAGGAGG - Intergenic
1174178242 20:48658281-48658303 TGTGGGGGCCACGGTGGGGCTGG - Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1175340977 20:58228727-58228749 CCTGGGCGTCACAGTGGGGCGGG - Intergenic
1175374316 20:58514300-58514322 CATGGGGGTCTCAGTGGGCCTGG + Intronic
1175701488 20:61140832-61140854 CAGGGGGGCCAGCTTGGGGGTGG + Intergenic
1175716074 20:61254440-61254462 CAGGGAGGCCAAAGTGTGGGCGG - Intronic
1175748044 20:61475420-61475442 CATGGGGGAGAAAGTGGTGGAGG - Intronic
1176092436 20:63325202-63325224 CAGAGGGGCCACAGGAGGGGTGG + Intronic
1176108389 20:63400017-63400039 GCTGGGGGCCACAGTGAGTGAGG - Intergenic
1176137343 20:63530028-63530050 CATGAGAGGCAGAGTGGGGGAGG - Intronic
1176245694 20:64095389-64095411 CATGGGGGGCAGCGTGGGGGTGG + Intronic
1176414936 21:6468556-6468578 CGTGGGGCTCACAGTAGGGGAGG + Intergenic
1176428734 21:6563708-6563730 CAGGGGGGCCACTGTGCAGGCGG - Intergenic
1178089230 21:29143785-29143807 GATGGGGAGCACAGTGGGAGGGG + Intronic
1178589761 21:33899310-33899332 CAAGCGGGCCACAGTGCTGGTGG + Exonic
1179228287 21:39476101-39476123 GATGGAGACCAGAGTGGGGGTGG + Intronic
1179576809 21:42313026-42313048 TGTGGGGGGCAGAGTGGGGGAGG + Intronic
1179690436 21:43076878-43076900 CGTGGGGCTCACAGTAGGGGAGG + Intronic
1179704224 21:43172024-43172046 CAGGGGGGCCACTGTGCAGGCGG - Intronic
1179927032 21:44540428-44540450 CCTGGGGGCAAGAGTGGAGGTGG + Intronic
1180082965 21:45494923-45494945 CCTGGGGTCTCCAGTGGGGGCGG + Intronic
1180832432 22:18912900-18912922 CATGGGGGTCACAGAGGTGGGGG + Exonic
1180833323 22:18917387-18917409 CCTGTAGGGCACAGTGGGGGTGG + Intronic
1181066504 22:20308870-20308892 CCTGTAGGGCACAGTGGGGGTGG - Intergenic
1181067412 22:20313442-20313464 CATGGGGGTCACAGAGGTGGGGG - Intergenic
1182114976 22:27751156-27751178 AATGGGGGCCAAAGTGGCAGAGG + Intronic
1182964172 22:34505858-34505880 CATGGGGGGAAGAGTGGGAGGGG + Intergenic
1182967116 22:34532722-34532744 CAGGGGGACTACAGTGAGGGAGG - Intergenic
1183261418 22:36798196-36798218 AATGGCGGCCACTTTGGGGGTGG - Intergenic
1183299697 22:37052736-37052758 CCTGGGGGCGACAGTGGGGCTGG + Intronic
1183429188 22:37755478-37755500 CCTGGGGTCCATAGTGGGGAGGG + Intronic
1183631823 22:39038000-39038022 ACTGGGGGCCAAAGTTGGGGGGG - Intergenic
1183637707 22:39074830-39074852 ACTGGGGGCCAAAGTTGGGGGGG - Intronic
1184228613 22:43145390-43145412 GATGGGTCCCAAAGTGGGGGAGG - Intergenic
1184684072 22:46088102-46088124 CATGGAAACCACGGTGGGGGGGG + Intronic
1185315910 22:50179030-50179052 CAGAGGGGCCACAGCAGGGGCGG - Exonic
1185316344 22:50180848-50180870 CATGGGGGCTGGAGTGGGGTTGG + Intergenic
1185343871 22:50303041-50303063 CATGGGAGCCACAGCTTGGGGGG - Intronic
1203282518 22_KI270734v1_random:138205-138227 CATGGGGGTCACAGAGGTGGGGG + Intergenic
1203283409 22_KI270734v1_random:142691-142713 CCTGTAGGGCACAGTGGGGGTGG + Intergenic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
950665891 3:14494808-14494830 CAGGGGCTCCATAGTGGGGGTGG - Intronic
950692574 3:14671924-14671946 CATGGGGGCGACAGGGAGGTGGG - Exonic
950999157 3:17538142-17538164 CCTGGGGGCAACAGGGGGTGGGG - Intronic
951811129 3:26701383-26701405 CAGGGGAGCCACATGGGGGGAGG - Intronic
953956612 3:47236425-47236447 CATGGGTGCGACAGTTGGGAAGG - Exonic
953970596 3:47344088-47344110 CAAGGGTGGCACAGTGGGGGAGG - Exonic
954116535 3:48469691-48469713 CCAGGGGGTCACAGTGGGGCAGG + Intronic
954412163 3:50375550-50375572 GATGGTGGTCACAGTGGGAGAGG + Intronic
954414369 3:50385753-50385775 CATGGAGGCCAGAGTGGAAGCGG + Intronic
954746616 3:52791028-52791050 CTTGGAGGCCACACTGGAGGTGG - Intronic
954798832 3:53175336-53175358 GATGGGTGCCGCAGTGAGGGGGG + Intronic
955229921 3:57089582-57089604 CATGGGGGTCACAGGAGGGGAGG + Intergenic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
955993494 3:64653950-64653972 CTTGGGGGCCACAGTAATGGTGG + Intronic
956435147 3:69227894-69227916 AATAGGGGAAACAGTGGGGGTGG + Intronic
958567769 3:95836624-95836646 CATGGGGAGCACAGCTGGGGAGG + Intergenic
959585320 3:108020257-108020279 CATGGGGGCAGGAGTGGGAGGGG + Intergenic
959779215 3:110207977-110207999 CACTGGGGCCAGAGTGTGGGGGG + Intergenic
959891964 3:111567039-111567061 CAGGATGTCCACAGTGGGGGAGG + Intronic
961119504 3:124361794-124361816 GATGGTGGCAGCAGTGGGGGTGG + Intronic
961119513 3:124361825-124361847 GATGGTGGCAGCAGTGGGGGTGG + Intronic
961354508 3:126327492-126327514 GCTGTGGGCCACAGTGGGTGAGG + Intergenic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961574533 3:127823454-127823476 CATGGGAGCCTCAGCGCGGGAGG + Intergenic
961749893 3:129088675-129088697 GACGGGGGGCACAGTGGCGGCGG + Exonic
961831010 3:129623076-129623098 GATGGGGGCCACCGTGGGAATGG - Intergenic
962786914 3:138777159-138777181 CATGAGGGACACATTGGTGGTGG - Intronic
963042501 3:141079918-141079940 CATGGAGGGCAGAGTGGGGGTGG + Intronic
963292266 3:143503884-143503906 CATGGGGGCATCAGAGGAGGGGG + Intronic
964302712 3:155307048-155307070 CTTGGGGGAAAAAGTGGGGGTGG - Intergenic
966871450 3:184292580-184292602 CCTGTGGGTCACAGTGGGGCAGG - Exonic
966917955 3:184595007-184595029 CTTGGGGGCCAATGTGGGGGTGG + Intronic
966969808 3:185033054-185033076 AATAGGGGCAACTGTGGGGGTGG - Intronic
967084153 3:186078971-186078993 TGTGGGGGCCACAATGGGGCGGG - Intronic
967471801 3:189870523-189870545 CATGGGGGCCAGATGGGGGTGGG + Intronic
968222153 3:196947444-196947466 CCTGGGGGCACCAGTGGAGGTGG - Exonic
968485550 4:859312-859334 CATGGGGGCCATCGGGGAGGCGG - Intronic
968500929 4:949739-949761 CCTGGGGGCCGCGGTGGGCGTGG - Intronic
968645488 4:1738454-1738476 CCTGGGGACCACAGTGTGGCTGG + Intronic
968733907 4:2285408-2285430 CCTGGCAGCCACAGTGGGGCCGG - Intronic
968760623 4:2441423-2441445 CCTGGGTCCCACAGTGGTGGAGG + Intronic
968917085 4:3501291-3501313 CATGGTGCCGACAGTGGGAGCGG - Intronic
968983313 4:3862675-3862697 AATGGGAGCAACACTGGGGGAGG - Intergenic
969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG + Intergenic
969263199 4:6046573-6046595 CAGGCGGGCGGCAGTGGGGGTGG + Intronic
969793365 4:9507468-9507490 CATGTGGGCCCAACTGGGGGTGG - Intergenic
970803331 4:20002731-20002753 CATGGAGGTTACAGTGGGGATGG - Intergenic
972273252 4:37532956-37532978 CTTGGGGGGAACAGTGGGAGGGG + Intronic
972459657 4:39289282-39289304 CATGGGAGCCACAGTGAAGAAGG + Intronic
973787537 4:54347450-54347472 CTTGGGGGGAACAGTGGGAGGGG + Intergenic
976367288 4:84245545-84245567 CATGGGGGACACGGACGGGGTGG - Intergenic
977781078 4:100981537-100981559 CATGTGAGCCACAGCAGGGGTGG - Intergenic
979268690 4:118733870-118733892 CATGTGAGCCAAAGTGAGGGTGG - Intronic
979435269 4:120680783-120680805 CTTTGGGGACACAGTGGGGAAGG + Intergenic
979605607 4:122635469-122635491 GGTGTGGGCCACAGTGGGGAAGG + Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
985217511 4:187669969-187669991 CTTGGGGGGCAGAGTGGGAGGGG - Intergenic
985576476 5:675594-675616 CATGGGGGGTACAGTGTGGCCGG + Intronic
985680350 5:1252799-1252821 GATGGGGGCCCCAGCTGGGGTGG - Intergenic
985789007 5:1915471-1915493 CTTGGGGGCAGCAGTGGGAGTGG - Intergenic
985963259 5:3319849-3319871 CTGGAGGCCCACAGTGGGGGCGG - Intergenic
987048577 5:14130072-14130094 AATAGGGGCAACACTGGGGGAGG - Intergenic
989360223 5:40593493-40593515 CATGGGGGCCAAAGAGGTGCTGG + Intergenic
992449173 5:76860207-76860229 CTTGGTGGCCACAATGGGAGCGG - Intronic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
994995580 5:107058258-107058280 CAAGGTGGGCACAGTGGGTGTGG + Intergenic
995518802 5:112980942-112980964 GATGGGGGCAATAGTGGGTGTGG - Intronic
995554032 5:113309348-113309370 CATGGGAGACTCAGTGGGGGAGG - Intronic
995742530 5:115369570-115369592 CATGTGGGCGGCAGTGGGGCGGG - Intergenic
996735957 5:126758634-126758656 CATGGAGGCGAGAGTGGGGGTGG + Intergenic
997352958 5:133244086-133244108 AATGGGGGCCAGAGTAGGGAGGG + Intronic
997450697 5:133980697-133980719 CATGGGGGCAGCAGGGTGGGAGG - Intronic
997621861 5:135304400-135304422 CATGGGCTCCCCAGTGGGGCAGG + Intronic
998690860 5:144585950-144585972 CATGCTTTCCACAGTGGGGGCGG - Intergenic
999126147 5:149247630-149247652 CATGGGTGCCACAAGGTGGGAGG + Intronic
1000037564 5:157460446-157460468 CAGGGGGGCCAAAGCTGGGGAGG + Intronic
1000821503 5:165990283-165990305 CATGTAGACCAAAGTGGGGGGGG - Intergenic
1001633169 5:173191767-173191789 CATGGGGGCCGCAGCGTGGCAGG - Intergenic
1002278211 5:178116400-178116422 CAGGAGGGGCACAGTGGGGACGG + Intronic
1002345445 5:178545137-178545159 TATGAGGGCCATAGAGGGGGTGG + Intronic
1002346940 5:178554682-178554704 CAGGGGAGACAAAGTGGGGGAGG - Intronic
1002432950 5:179213588-179213610 CGGAGGGGCCACACTGGGGGTGG + Intronic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1002866450 6:1126200-1126222 CGTAGGAGCTACAGTGGGGGCGG + Intergenic
1003053967 6:2802814-2802836 CATGGGTGCCACAGAGGTAGTGG - Intergenic
1005281982 6:24284186-24284208 CTAGGTGGCCGCAGTGGGGGCGG - Intronic
1005495998 6:26388368-26388390 AATGGGGGCAGCAGTGTGGGTGG + Intronic
1005500693 6:26426597-26426619 GATGGGGGCAGCAGTGTGGGTGG + Intergenic
1005886009 6:30098292-30098314 CAAGGGGGCCACTCTGGTGGGGG + Intergenic
1006214588 6:32429437-32429459 GATGGTGGTCACAGTGGTGGTGG + Intergenic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1006907587 6:37543458-37543480 GAAGGGGGCCACAGTGCGTGTGG - Intergenic
1010272449 6:73929524-73929546 CATGTGGGCCACAGAGGGTAGGG + Intergenic
1010802627 6:80194947-80194969 CCTGGGAGCAACAGTGGGTGAGG - Intronic
1011645634 6:89455386-89455408 AATGGGAGCCAGAGTGGAGGAGG + Intronic
1012791533 6:103704091-103704113 AATGGGGGCCAAGGTGGGGGGGG + Intergenic
1012953023 6:105539122-105539144 CATGGGGGCCTGTCTGGGGGTGG + Intergenic
1013281837 6:108645057-108645079 CATCAGGGCCAGAGTGGTGGTGG - Intronic
1014886730 6:126791078-126791100 AATGGGGGTTACAGTGGGGCTGG + Intergenic
1015136946 6:129882914-129882936 CCTGAGAGCCACAGTGGGGCAGG - Intergenic
1016472007 6:144384475-144384497 CATGGGCGGGGCAGTGGGGGAGG - Intronic
1017426729 6:154329929-154329951 CACGGAGGCCAGAGTGGGGCTGG - Intronic
1019089278 6:169513207-169513229 CATGGTGGCCTCAGTGAGGTGGG + Intronic
1019643557 7:2117197-2117219 CCTGGGGGCCACCGTCAGGGAGG + Intronic
1019723389 7:2587034-2587056 GATGGGGGCAGCAGTGGGTGTGG + Intronic
1021962587 7:25887431-25887453 CATGGAGGACACAGTGGAGCTGG - Intergenic
1022388848 7:29926420-29926442 CATGAGGGCCACAGAGGCGGAGG - Intronic
1024812066 7:53223612-53223634 CAGGAGGGACACTGTGGGGGTGG - Intergenic
1024946680 7:54814927-54814949 CATGGGGGAAAGGGTGGGGGTGG - Intergenic
1026111336 7:67461007-67461029 CCTCGGGGCAACAGTGGGGCTGG + Intergenic
1026195947 7:68173920-68173942 GATGGGGGGCAGACTGGGGGAGG - Intergenic
1028900715 7:96097604-96097626 GGTGGGGGCTGCAGTGGGGGTGG - Exonic
1029110154 7:98210008-98210030 CAGAGGGGCCATAGTGGGGCGGG - Intergenic
1029125692 7:98293861-98293883 CATGGGGGTCACTCTGGGGTGGG + Intronic
1030115380 7:106058792-106058814 CAATGGAGCCACAGTGGGGCAGG - Intergenic
1030401650 7:109059174-109059196 CATGGGGGCCACTGTGGTTGGGG + Intergenic
1032066956 7:128778972-128778994 CATGGGGGGAACAGGGTGGGAGG + Intergenic
1034455407 7:151167499-151167521 CCTGGGGGCAACGGCGGGGGCGG - Exonic
1034725386 7:153330928-153330950 CAAGGGAGCCACTGTGTGGGAGG - Intergenic
1034880249 7:154757412-154757434 CAGGAGGGCTGCAGTGGGGGAGG - Intronic
1035433559 7:158840706-158840728 GATATGGGCCCCAGTGGGGGAGG + Intergenic
1035468803 7:159096873-159096895 CAAGGCGGCCACAGAGAGGGTGG - Intronic
1035636694 8:1152592-1152614 CATGGGGGGCCCAGCAGGGGAGG + Intergenic
1036191019 8:6670805-6670827 CATAGGGGCCATAGTGGGCCAGG + Intergenic
1038407148 8:27330623-27330645 CAAGGGGGCGGCAGAGGGGGAGG + Intronic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1039075803 8:33689602-33689624 GATGGGGGCTTCAGTGGGCGGGG - Intergenic
1039135979 8:34323195-34323217 CATGGTGGCCAAAGTGGACGAGG - Intergenic
1039390827 8:37179744-37179766 TATGGGGACAACAGTGGGTGGGG + Intergenic
1039474670 8:37833386-37833408 CACTGAGGCCACAGTGGGGAAGG + Intronic
1040518444 8:48153739-48153761 CATGGACACCACAGTGTGGGAGG - Intergenic
1042871672 8:73405480-73405502 AGTGGGGGCCACAGTGGGGAAGG - Intergenic
1043685015 8:83073570-83073592 CATTGGTGACACAGTGGAGGGGG - Intergenic
1043885235 8:85591656-85591678 CTTGGGAGCCAGGGTGGGGGAGG - Intergenic
1045322197 8:101090790-101090812 CATGGTGGGGACAGTGGGGATGG + Intergenic
1046870954 8:119205523-119205545 CATGGGGGTGGCAGTGGGGGAGG + Intronic
1048154433 8:131931059-131931081 CATGAGGGCCATGGTGGGAGGGG + Intronic
1048461234 8:134623383-134623405 CATGAGGTCCTCAGTGGAGGAGG - Intronic
1049695290 8:143981281-143981303 GATGGTGGCCACGGTGGTGGTGG + Intronic
1049695759 8:143983645-143983667 CCTGGGTGCCACAGTGCTGGGGG + Exonic
1049807491 8:144547544-144547566 CCCGGGGCCCTCAGTGGGGGTGG + Exonic
1050191223 9:3028685-3028707 CAAGGGGGCCAGAGTGCTGGCGG + Intergenic
1050373378 9:4945703-4945725 CATGTGTGCCACTGTGGAGGAGG - Intergenic
1051349989 9:16190152-16190174 CATGGGGGCCAGTTGGGGGGTGG + Intergenic
1052862808 9:33447297-33447319 CGTGGGGGTCACAGCTGGGGAGG + Intronic
1053050698 9:34958501-34958523 CAGGGGGGCCACCTTGGAGGCGG - Intronic
1053412032 9:37922128-37922150 CCTGGGGGACAGAGTGGAGGAGG + Intronic
1056756169 9:89383274-89383296 CATGTAGTCCACACTGGGGGTGG - Intronic
1056851168 9:90085793-90085815 GATGTGGGCCACTGTGGGGCAGG - Intergenic
1056985655 9:91361868-91361890 CATGGCGGCCGCGGTGGCGGCGG - Exonic
1057316804 9:93974454-93974476 CAATGGGGCCACGGGGGGGGGGG + Intergenic
1057337277 9:94166065-94166087 CGGGGTGGCCACCGTGGGGGAGG - Intergenic
1058414802 9:104776351-104776373 GATAGGGGCCACTGTGGGAGGGG - Intronic
1058931884 9:109728764-109728786 TATGGGAGCCACAATGGGGGTGG - Intronic
1059418796 9:114178446-114178468 TATGGGTGCCAGAGAGGGGGAGG - Intronic
1059684865 9:116625448-116625470 CAATGGGGCCAGAGTGGGGAGGG - Intronic
1060909052 9:127334175-127334197 GATGGGGGCCTGAGTGGGGAAGG + Intronic
1061043700 9:128153362-128153384 CATGGGTGGCACTGTGGGGAGGG - Intronic
1061059359 9:128242985-128243007 TGTGGGGGCCACAGAGGAGGCGG - Intronic
1061539149 9:131268318-131268340 CAGGGGGGCGGCAGTGCGGGGGG - Intronic
1061670800 9:132187140-132187162 CAGGGGGGCCACAGTGGGCATGG - Intronic
1062232597 9:135490429-135490451 CATGGGGGCAGGAGTGGGAGAGG - Intergenic
1062307805 9:135919619-135919641 AATGGGGAACAGAGTGGGGGAGG - Intergenic
1062578844 9:137221024-137221046 CTTGGGTGCCAGAGTTGGGGTGG + Exonic
1062665115 9:137666446-137666468 CATGGCAGCCTCAGTGGTGGAGG + Intronic
1062677211 9:137753588-137753610 CGTGCAGGCCACAGTGGGCGGGG - Intronic
1062700739 9:137900367-137900389 CTTGGGTGCCAGAGTGAGGGCGG + Intronic
1062718442 9:138022791-138022813 CCTGTGGGACACCGTGGGGGGGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1186611977 X:11146320-11146342 CAGGGAGGAAACAGTGGGGGTGG + Intronic
1187900978 X:24026017-24026039 CATCTTGGCCACGGTGGGGGTGG + Intronic
1188926848 X:36054209-36054231 CTGGGTAGCCACAGTGGGGGTGG - Intronic
1189375792 X:40465455-40465477 GATGGAAGCCACAGTGCGGGAGG + Intergenic
1190076800 X:47322775-47322797 CACTGGGGGCACGGTGGGGGAGG + Intergenic
1190248873 X:48707622-48707644 CAGGAGGGCAGCAGTGGGGGAGG - Exonic
1190732018 X:53232823-53232845 CATGGGCTCCACAGTGGGGAAGG + Intergenic
1191717559 X:64204168-64204190 GAGGGGAGCCACACTGGGGGAGG + Intronic
1192568652 X:72184215-72184237 CATGGGGTCCAGAGTGGGAAGGG + Intronic
1194080406 X:89455850-89455872 GATGGAGACCACAGTGGTGGAGG + Intergenic
1197342081 X:125287003-125287025 GATGCTGGCTACAGTGGGGGAGG + Intergenic
1199745926 X:150771968-150771990 CCTGAGGGCCACAGTGGTGGGGG + Intronic
1199746333 X:150774080-150774102 AATGGAGGCCACAGTGGCAGGGG - Intronic
1199850680 X:151723227-151723249 ACTGGGGGCAACAGTGGAGGTGG + Intergenic
1200413781 Y:2887396-2887418 GGTGGGGGCCAGTGTGGGGGTGG + Intronic
1200433084 Y:3111916-3111938 GATGGAGACCACAGTGGTGGAGG + Intergenic
1201291247 Y:12421788-12421810 CAAGGGGGCCGCGGTGGGCGAGG - Intergenic
1201896133 Y:18994378-18994400 CCTGTGGGCCACTGTGGAGGTGG + Intergenic