ID: 1085314316

View in Genome Browser
Species Human (GRCh38)
Location 11:75535167-75535189
Sequence CCTTATCTCCAGGAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085314310_1085314316 -1 Left 1085314310 11:75535145-75535167 CCCTCTCAGAACAGAGGGGCCTC No data
Right 1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG No data
1085314305_1085314316 7 Left 1085314305 11:75535137-75535159 CCCTGACACCCTCTCAGAACAGA No data
Right 1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG No data
1085314304_1085314316 21 Left 1085314304 11:75535123-75535145 CCTTCAAAACATAGCCCTGACAC No data
Right 1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG No data
1085314311_1085314316 -2 Left 1085314311 11:75535146-75535168 CCTCTCAGAACAGAGGGGCCTCC No data
Right 1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG No data
1085314306_1085314316 6 Left 1085314306 11:75535138-75535160 CCTGACACCCTCTCAGAACAGAG No data
Right 1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085314316 Original CRISPR CCTTATCTCCAGGAGCAGCA GGG Intergenic
No off target data available for this crispr