ID: 1085314672

View in Genome Browser
Species Human (GRCh38)
Location 11:75537287-75537309
Sequence CAGTGGGGCTAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085314664_1085314672 19 Left 1085314664 11:75537245-75537267 CCCAAGTCTGCGCTCTTCTGAAT No data
Right 1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG No data
1085314665_1085314672 18 Left 1085314665 11:75537246-75537268 CCAAGTCTGCGCTCTTCTGAATC No data
Right 1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085314672 Original CRISPR CAGTGGGGCTAGAGGGCAGT GGG Intergenic
No off target data available for this crispr