ID: 1085318267

View in Genome Browser
Species Human (GRCh38)
Location 11:75559120-75559142
Sequence CCTGGCACGTGGAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085318267_1085318278 14 Left 1085318267 11:75559120-75559142 CCAGCCAGCCTCCACGTGCCAGG No data
Right 1085318278 11:75559157-75559179 CCTTCAGTGAAGCGAGGCACTGG No data
1085318267_1085318279 17 Left 1085318267 11:75559120-75559142 CCAGCCAGCCTCCACGTGCCAGG No data
Right 1085318279 11:75559160-75559182 TCAGTGAAGCGAGGCACTGGAGG No data
1085318267_1085318276 8 Left 1085318267 11:75559120-75559142 CCAGCCAGCCTCCACGTGCCAGG No data
Right 1085318276 11:75559151-75559173 CCACTTCCTTCAGTGAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085318267 Original CRISPR CCTGGCACGTGGAGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr