ID: 1085319725

View in Genome Browser
Species Human (GRCh38)
Location 11:75566480-75566502
Sequence GGCCAGGCCGGCGCTGCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 260}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085319725_1085319730 -1 Left 1085319725 11:75566480-75566502 CCGAGCGCAGCGCCGGCCTGGCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1085319730 11:75566502-75566524 CTTCAGCTTGTACCAGGCCATGG 0: 1
1: 1
2: 0
3: 12
4: 129
1085319725_1085319731 5 Left 1085319725 11:75566480-75566502 CCGAGCGCAGCGCCGGCCTGGCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1085319731 11:75566508-75566530 CTTGTACCAGGCCATGGCCAAGG 0: 1
1: 1
2: 4
3: 67
4: 380
1085319725_1085319735 17 Left 1085319725 11:75566480-75566502 CCGAGCGCAGCGCCGGCCTGGCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1085319735 11:75566520-75566542 CATGGCCAAGGACCAGGCAGTGG 0: 1
1: 1
2: 4
3: 42
4: 382
1085319725_1085319728 -7 Left 1085319725 11:75566480-75566502 CCGAGCGCAGCGCCGGCCTGGCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1085319728 11:75566496-75566518 CCTGGCCTTCAGCTTGTACCAGG 0: 1
1: 1
2: 2
3: 24
4: 203
1085319725_1085319738 29 Left 1085319725 11:75566480-75566502 CCGAGCGCAGCGCCGGCCTGGCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1085319738 11:75566532-75566554 CCAGGCAGTGGAGAACATCCTGG 0: 1
1: 1
2: 4
3: 89
4: 1446
1085319725_1085319733 11 Left 1085319725 11:75566480-75566502 CCGAGCGCAGCGCCGGCCTGGCC 0: 1
1: 0
2: 3
3: 31
4: 260
Right 1085319733 11:75566514-75566536 CCAGGCCATGGCCAAGGACCAGG 0: 2
1: 1
2: 8
3: 46
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085319725 Original CRISPR GGCCAGGCCGGCGCTGCGCT CGG (reversed) Exonic
900561581 1:3309750-3309772 GGCCAGGGCTGCCCTGGGCTAGG + Intronic
900786551 1:4653914-4653936 GGCCAGGCAGCAGCTGCGCTGGG + Intergenic
901834307 1:11913971-11913993 GGCCAGGCCGTCTCAGAGCTGGG - Intergenic
902039577 1:13483072-13483094 GGCCAGGCTGGTGCAGCCCTAGG - Intronic
903281603 1:22253129-22253151 GGCCTGGCCGGGGGTGCCCTGGG + Intergenic
904032669 1:27543037-27543059 GACCAGGCCGCAGCTGCTCTGGG - Intronic
904595785 1:31644560-31644582 GTCCAGGCTGGCGCTGGCCTGGG - Intronic
906033301 1:42736502-42736524 GGCCAGGCCAGCCCTGCTCCTGG + Intronic
906168867 1:43707452-43707474 GGCCAGGCCCTCGCTCCGCCCGG + Intronic
906480276 1:46194882-46194904 AGCCAGGCTGGCCCTGCCCTGGG - Exonic
907241108 1:53081571-53081593 GGCAAGGCCAGCGCTGAGCCAGG - Intronic
915087258 1:153397210-153397232 GGCCAGGTCGACTCTGCTCTTGG - Intergenic
916259050 1:162822507-162822529 GGCGCGGGCGGCGCTGGGCTGGG + Intergenic
922668385 1:227491442-227491464 GTGCAGGCCTGGGCTGCGCTGGG + Intergenic
1064202833 10:13299489-13299511 GGCCAGGCAGGCGCTGCCCAGGG - Intronic
1065189244 10:23195235-23195257 GGCCAGGCCTGCGCCGCACGGGG - Intergenic
1070156631 10:73839546-73839568 GGCCAGGCCGGCGGCGCTCGCGG + Intronic
1070778446 10:79123836-79123858 GGCCAGGCCTGCTGTGAGCTGGG - Intronic
1070819716 10:79347750-79347772 GCCCAGGCCGGCCCTGCGAGCGG - Intronic
1072706823 10:97687078-97687100 GCCCAGCTCGGCGCTGCGGTGGG - Exonic
1072970064 10:100009804-100009826 GGCCAGGCCGGAGCCGGGCGGGG - Intronic
1073069306 10:100783117-100783139 GGCCAGCCAGGCGCAGCCCTGGG - Intronic
1073294649 10:102431806-102431828 GTCCAGGCCTGTGCTGCCCTTGG - Intronic
1074182899 10:111078805-111078827 CCCCGGGCCCGCGCTGCGCTCGG - Exonic
1074591861 10:114821691-114821713 GGCCAGGCCTGCCCTGCGGCGGG - Intergenic
1075031859 10:119029508-119029530 GGCGAGGCTGGCGCAGCGCGCGG + Intergenic
1076685421 10:132196465-132196487 GGCCAGGGCCGCGCTGTGCTGGG - Intronic
1076886618 10:133266040-133266062 GGCCAGGCCTGGGCTGTGCCTGG + Intronic
1076890485 10:133280879-133280901 GGCCAGGGCGGTGCTGGGCAGGG + Intronic
1077044076 11:536807-536829 GGCGAGGCGGGCGCTGGACTGGG - Intronic
1077297070 11:1831384-1831406 GGCCGGGCGGGGGCTGCCCTGGG - Intronic
1077322318 11:1947808-1947830 GGCCGCGCCCGCGCTGCGGTGGG - Intronic
1081938159 11:46918640-46918662 GGCCGGGCCGGCGCTGGGGGCGG - Intronic
1083298561 11:61728262-61728284 GTCCAGCACGGCGTTGCGCTTGG - Exonic
1085319725 11:75566480-75566502 GGCCAGGCCGGCGCTGCGCTCGG - Exonic
1085457881 11:76675517-76675539 GGGCAGGCAGGCTCTGCGGTGGG + Intergenic
1091283949 11:134397700-134397722 GGCCAGGCCTGGTTTGCGCTTGG - Intronic
1091328576 11:134712617-134712639 GGCCAGGGCGGGGCTGCGGAAGG - Intergenic
1202805336 11_KI270721v1_random:3121-3143 GGCCGCGCCCGCGCTGCGGTGGG - Intergenic
1091550157 12:1530605-1530627 GGCCAGGCAGCCCCGGCGCTCGG - Intronic
1092139338 12:6171981-6172003 GGCCAGGCCAGCATTGCCCTGGG + Intergenic
1096590438 12:52655438-52655460 GGCCAGGCAGCCGCTGCCCATGG - Intergenic
1096621957 12:52870718-52870740 GGCCAGGCTGGTGCCGCCCTGGG - Intergenic
1096622687 12:52874335-52874357 GGCGCGGCCGGCGCCGCCCTGGG - Intergenic
1101131811 12:101697812-101697834 CGCCAGGCGCGGGCTGCGCTCGG + Exonic
1104972066 12:132535323-132535345 GGCCCAGCCGGAGCTGTGCTCGG + Intronic
1108594880 13:51940867-51940889 GGCCAGACCAGAGCTGCTCTGGG + Intronic
1108727877 13:53201531-53201553 GGCCAGGTAGGCGCTGGGCGGGG - Intergenic
1113597076 13:111540729-111540751 GACCAGGCCGGGGCTGCCCTTGG + Intergenic
1114635329 14:24183952-24183974 GGCCAGGCCTGCCCTGCAATGGG - Intronic
1115320881 14:32077573-32077595 GGGGAGCCTGGCGCTGCGCTCGG + Intronic
1118256530 14:64210416-64210438 GTCCAGGGCGCCGCTTCGCTGGG + Intronic
1119753513 14:77098075-77098097 GACCAGGCCGGCGCGGGGCGGGG - Exonic
1122115000 14:99523189-99523211 GCCCAGGCTGGGGCTGGGCTGGG + Intronic
1122582210 14:102777796-102777818 GGCCGGGCCTGCGCCGCGCCGGG - Intronic
1122620974 14:103057514-103057536 GGCCGGGCTTGCGCAGCGCTAGG - Intergenic
1122691263 14:103533111-103533133 GGCCGGGCCTGCCCTGCACTTGG - Intronic
1122901424 14:104783843-104783865 GCCCAGGCCGGGGTTGCACTGGG - Intronic
1122953494 14:105059134-105059156 AGCCGGGCCGGCCCTGCCCTGGG - Intronic
1122969496 14:105146767-105146789 GGCCATGCCGGTCCTGCGGTGGG - Intronic
1123735579 15:23180000-23180022 CGCGGGGCCGGCGCTGCTCTGGG + Intergenic
1124286295 15:28402983-28403005 CGCGGGGCCGGCGCTGCTCTGGG + Intergenic
1128061983 15:64741053-64741075 AGCCAGGCCTGCTCTGGGCTCGG + Intronic
1130076576 15:80695234-80695256 GGCCCGGCGGGCGCGGCGCTCGG - Intronic
1130275177 15:82472663-82472685 GGTGTGGCCGGCACTGCGCTGGG + Intergenic
1130467536 15:84200058-84200080 GGTGTGGCCGGCACTGCGCTGGG + Intergenic
1130496729 15:84473484-84473506 GGTGTGGCCGGCACTGCGCTGGG - Intergenic
1130589828 15:85204656-85204678 GGTGTGGCCGGCACTGCGCTGGG + Intergenic
1131068452 15:89449030-89449052 GGCCAGGCCGGGGATGCCTTTGG - Intergenic
1132589604 16:720921-720943 GGACAGGCAGGCCCTGCCCTGGG - Intronic
1132719093 16:1307269-1307291 GGCCAGGCCCCCGCTGGTCTTGG + Intergenic
1132866861 16:2097384-2097406 GGCCAGGCGGGCCATGGGCTGGG - Exonic
1132915233 16:2340447-2340469 GGCCAGGCCGGAGCTGGGGGGGG + Intronic
1133055603 16:3144154-3144176 GGCAAGGCCAGAGCTGGGCTGGG - Intergenic
1133156718 16:3880935-3880957 GGCCAGGCCTGCGGGGCGCCTGG + Intergenic
1136267360 16:29129606-29129628 GCCCAGGACGGCCCTGTGCTGGG + Intergenic
1137721179 16:50628365-50628387 TGCCTGGCTGGGGCTGCGCTGGG + Intronic
1138561275 16:57802272-57802294 GTCCGGGCCGGCCCTGCCCTCGG - Intronic
1138688755 16:58748925-58748947 GGCGGGCCCCGCGCTGCGCTCGG + Intergenic
1139431501 16:66913315-66913337 GGCAAGGCTGGAGCTGCCCTTGG - Intronic
1140135935 16:72205523-72205545 GGCCAGGCCTGGGCTGTGTTGGG - Intergenic
1142051746 16:87963308-87963330 GGCCTGGCCTGCACTGCACTTGG - Intronic
1142124372 16:88402842-88402864 GGCCAGGCTGGGGCAGCGGTTGG + Intergenic
1142367567 16:89658000-89658022 GCCCAGGGCGGGGCTGGGCTGGG + Intronic
1142610902 17:1108878-1108900 GGCCGGGCCGGCGCTGCCGAAGG - Intronic
1142978317 17:3657942-3657964 GGCCACGCCGGGGCTGAGCAAGG - Intronic
1143479461 17:7220140-7220162 GGCCGGGCCGGGGCTGCCCCAGG - Exonic
1145265100 17:21376269-21376291 GGCCAGGCCGGAGCCGTGGTAGG + Exonic
1145265587 17:21378221-21378243 GTCCAGGGCGGAGCTGCGCGAGG - Intronic
1146373586 17:32280254-32280276 GGCCTGACCGGGGCTGCTCTGGG - Intronic
1146580857 17:34037419-34037441 GGCCTGGCCGGAGCTGCCCAAGG + Intronic
1147044467 17:37743076-37743098 GGCCAGCCCGGCGCGGGGCTGGG + Intronic
1147700148 17:42388522-42388544 GGCCAGGCTGGGGCTGGGCGAGG - Exonic
1150122126 17:62612745-62612767 GGCCTGGCCGGAGCTGCCCAAGG - Exonic
1150840265 17:68600648-68600670 CGCCATGCCGGGGCTGCGCCGGG - Exonic
1151725117 17:75878899-75878921 GGCCAGGCCAGCGCTCCGCAGGG + Intergenic
1152554399 17:81045826-81045848 GGCCACGCCGAAGCTGCCCTTGG + Intronic
1152574068 17:81132552-81132574 GGCCAGGCCGGGGCTGGGATTGG - Intronic
1152589575 17:81204789-81204811 GGCCAGGCTGGTGCTGGGCGTGG - Intronic
1152686296 17:81695343-81695365 GGGCAGGCCAGGGCTGGGCTGGG - Intronic
1152820716 17:82436338-82436360 TGCCAGGCCGGCACGGCCCTAGG - Intronic
1152870926 17:82752547-82752569 GGCCACCCCGGCGCGGCGTTAGG + Intronic
1155347311 18:24871097-24871119 GGCCAGGCAGGCACTGTGCTAGG + Intergenic
1156467313 18:37356013-37356035 GGCCAGGGCTGGGCTGGGCTGGG - Intronic
1156467316 18:37356018-37356040 GGCCAGGCCAGGGCTGGGCTGGG - Intronic
1157591925 18:48841395-48841417 GGCCACGAGGGCGCTGCCCTAGG - Intronic
1157616981 18:48992764-48992786 GGCCAGGCTGGGGCTGTGCCTGG - Intergenic
1160413151 18:78688415-78688437 GGCCAGGCCGAGTCTGCCCTGGG - Intergenic
1160910750 19:1472757-1472779 GGCCAGGCAGGGGCCGCGGTGGG - Exonic
1160967957 19:1754829-1754851 GCGCATGTCGGCGCTGCGCTTGG + Exonic
1161068859 19:2250713-2250735 GGCCAGCCCGGAGCCGCGCCAGG - Exonic
1162302924 19:9854432-9854454 GGCCTCGCCAGCGCTGCGCTTGG + Exonic
1162758474 19:12874378-12874400 GGCCAAGGCGGCGCTGAGCCCGG + Exonic
1165740671 19:38203476-38203498 GGCCAGGCAGGCCCAGGGCTGGG + Intronic
1165841816 19:38792663-38792685 AGCCAGGCCAGGGCTGCGATCGG + Intergenic
1166197865 19:41218852-41218874 GGCCTGGCTGGGGCTGGGCTGGG + Intergenic
1166336984 19:42114239-42114261 GGCCTGGCTGGGTCTGCGCTAGG + Intronic
1166694488 19:44844900-44844922 GGCCGGGCCAGCGCAGCGCGGGG + Intergenic
1167146033 19:47681161-47681183 CGCCAGGCCAGGGCTGGGCTGGG - Exonic
1167620411 19:50557057-50557079 GGCCAGGGAGGAGCTGCGCCAGG + Intronic
1167797605 19:51719848-51719870 GGCCAGGCCGGAGCAGCGGCAGG + Exonic
925040066 2:725708-725730 GGCCAGGGCGGGGCTGAGATAGG + Intergenic
925912223 2:8581428-8581450 AGCAAGGCCGGCACTGTGCTAGG + Intergenic
926425130 2:12732989-12733011 GGCCAGGGTGGGGCTGAGCTGGG - Intronic
929936581 2:46297976-46297998 GGCCAGGGCCGGGCTGCGCGGGG + Intronic
931614577 2:64143794-64143816 GGCCAGCCAGGCGCGGGGCTCGG + Intronic
931708670 2:64969074-64969096 GGCTTGGCCGGCCCTGCACTCGG + Intergenic
933666719 2:84970853-84970875 GGCCAGGCCGAGGCTGGGCACGG + Intergenic
933876133 2:86623398-86623420 GGTCAGGAGGGCGCGGCGCTCGG + Exonic
934933126 2:98444834-98444856 GGCCAGGGCGGGGCTGCGCCCGG + Intronic
934993264 2:98936145-98936167 GGCCGGCCCGGCCCTGCGCCCGG + Exonic
935830182 2:106994125-106994147 GTCCAGGCTGGCGGTGGGCTGGG + Intergenic
937121596 2:119443106-119443128 TGCCTGGCCTCCGCTGCGCTAGG + Intronic
937326046 2:120990015-120990037 GGGGAGGCCGGGGCTGCACTAGG - Exonic
942043299 2:172084953-172084975 GGCCGGATAGGCGCTGCGCTAGG + Intronic
945080770 2:206085253-206085275 GGCCAGGCCGGGGCGGGGCGGGG - Intronic
946326022 2:218985123-218985145 GGCGAGGCAGGCTTTGCGCTCGG + Exonic
946865592 2:224039048-224039070 GGCGCGGCCGGCGCTGCCCTCGG - Intronic
946923555 2:224603877-224603899 CGGCCGACCGGCGCTGCGCTCGG - Intergenic
947552586 2:231057129-231057151 GCCCAGGCCGGCGTTCCGCCGGG - Intronic
947625141 2:231614266-231614288 GGCCCGGGCGGGGCTGCTCTCGG - Intergenic
947632326 2:231662221-231662243 GGGCTCGCCGGCACTGCGCTCGG - Intergenic
947743895 2:232497754-232497776 GGCCAGGCCCGGGCAGGGCTGGG - Intergenic
947749260 2:232524222-232524244 GGCCGGGCCAGGGCTGGGCTGGG - Intronic
947867043 2:233405556-233405578 GGCCAGGAGGGCTCTGCTCTGGG + Intronic
947944976 2:234093554-234093576 GGCCAGGAGAGGGCTGCGCTAGG - Intergenic
948672032 2:239574940-239574962 TGCCAGGCCTGGGCTGTGCTTGG + Intergenic
948696955 2:239737475-239737497 GGCTAGGCCGGGGCTGGGCTGGG - Intergenic
948697346 2:239738269-239738291 GGCTGGGCCGGGGCTGGGCTGGG - Intergenic
948907753 2:240987857-240987879 GGCCAGGCAGGCGCTGAGGCAGG - Intronic
1168806626 20:675602-675624 GGCGCGGCCGGCGCGGGGCTCGG + Exonic
1172125472 20:32622875-32622897 GGCCAGGCGTGCCCTGCTCTAGG + Intergenic
1172933500 20:38602052-38602074 GCCCAGGTCGGCCCAGCGCTGGG - Exonic
1173254804 20:41386840-41386862 GGCCAGGCCAGAGGTGGGCTGGG - Intergenic
1173964331 20:47100398-47100420 GGCCAGGTGGGGGCTGCGATGGG - Intronic
1176064818 20:63188903-63188925 GACCAGGCCGGGGGTGTGCTTGG - Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1176223039 20:63979112-63979134 GTCCAGGCTGGCACTACGCTCGG - Intronic
1178259796 21:31088494-31088516 GGCTCGGCGGGCTCTGCGCTTGG - Intergenic
1178263866 21:31124525-31124547 GGCCAGGCCGGCCATGAGCAGGG - Exonic
1178487457 21:33027892-33027914 GGACTGGCCTGCGCTGGGCTCGG + Exonic
1179295490 21:40058308-40058330 AGCCAGGCTGGCCCTGCGATGGG + Intronic
1179600803 21:42476193-42476215 GGCCAGGCCTAGGCTGGGCTGGG - Intronic
1180046253 21:45307125-45307147 GCCCAGGCAGGGGCTGGGCTCGG + Intergenic
1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG + Intronic
1181085491 22:20437709-20437731 GGCCGGGCCGGCGCGGCGCCGGG - Exonic
1182099248 22:27646204-27646226 GGCCAGGGAGGTGCTACGCTGGG + Intergenic
1182555109 22:31125038-31125060 GGCCAGGCTGGAGCTGCGGTGGG - Exonic
1182623392 22:31630019-31630041 GGCCAGGCCTCAGCTGAGCTGGG - Intronic
1184090149 22:42288867-42288889 GCCCAGGCCTGCACTGCCCTTGG - Intronic
1184853690 22:47135206-47135228 TGGCAGGCCGGCGCAGGGCTCGG + Intronic
1185038044 22:48489842-48489864 GGCCGGTCCAACGCTGCGCTGGG + Intronic
1185388880 22:50548487-50548509 GGCCAGGCGGCCTCTGCGCGGGG - Exonic
952418957 3:33114358-33114380 GGCGAGGCCGGCGGCGGGCTCGG - Exonic
954744160 3:52777684-52777706 GGCCATGCCTGCCCTGGGCTCGG + Exonic
955772111 3:62395415-62395437 GGTCAGGCAGGCACTGTGCTAGG - Intergenic
956179070 3:66500866-66500888 GGCGCGGCCGGCCCCGCGCTGGG + Exonic
963236613 3:142963195-142963217 TGCCAAGCCGCTGCTGCGCTGGG - Exonic
968081572 3:195849917-195849939 GCTGAGGCCGGGGCTGCGCTGGG - Intergenic
968319249 3:197750523-197750545 AGCCCGGCCGGGGCTGCGGTCGG + Intronic
968479098 4:826012-826034 GGCCGGGCGCGCGCTGCGCTCGG + Intronic
968576747 4:1369891-1369913 GGCAAGGCGGGCGCCGCGTTCGG + Intronic
968647654 4:1748496-1748518 GGGCAGTCCGGCGCGGCGCCGGG - Intergenic
968735002 4:2290703-2290725 GGCCAGGCCAGGGCTGGGCCAGG + Intronic
968762151 4:2448285-2448307 GCCCAGGCAGGGGCTGTGCTTGG - Intronic
969354766 4:6618943-6618965 GGGCAGGCTGGCCCTGTGCTGGG - Intronic
969379090 4:6782744-6782766 GGCCAGGGCCGCCCGGCGCTCGG + Exonic
969543837 4:7811112-7811134 GGGGAGGCCGGCGAGGCGCTCGG + Intronic
969633379 4:8351340-8351362 GCCCAGGCCGGCTCTGCTCTCGG - Intergenic
973854097 4:54993585-54993607 GGCTAGGCAGGCCCTGCACTCGG + Intergenic
975498182 4:75057443-75057465 GGCATGGCCGGGGCTGCGCTAGG + Intergenic
978617388 4:110611169-110611191 GGCAAGGCTGGGGCTGCTCTAGG + Intergenic
984734572 4:183098330-183098352 GGCCACGGCGGGGCTGCGGTGGG + Intergenic
984883349 4:184429280-184429302 GTCCAGGCCTGCCCTCCGCTGGG + Intronic
984972604 4:185204115-185204137 GGCCAGGCCGGGGCTCCACGCGG + Intronic
985481073 5:111289-111311 GGCCAGGCCAGAGCTGCCCCAGG - Intergenic
985629494 5:1007337-1007359 GGCCAGGCCGTGCCTGCGATGGG - Intergenic
987767886 5:22258410-22258432 GGCCAGGCTAGCCCTGTGCTTGG - Intronic
988547709 5:32173999-32174021 CACCAGGCCGGAGCTGCGCTGGG + Exonic
989584809 5:43066503-43066525 GGCGACGCCGGCGCTGGGCGGGG - Intronic
990910066 5:60843963-60843985 GGCCAGGCCCTCCCTGGGCTCGG - Intronic
993901713 5:93588495-93588517 GGCCAGGCCCGGGCGGCGCGGGG - Intronic
997663084 5:135604292-135604314 GCCCAGGCTGGCCCTGGGCTGGG - Intergenic
997718783 5:136061916-136061938 GGCCAGGCCTGCCCTGAGCCGGG + Intronic
998156541 5:139789991-139790013 GGCCGGGCGGGCGCTGAGGTGGG + Intergenic
998166790 5:139848727-139848749 GGCCAGGCCGGGCCGGCGCGGGG + Intronic
998463271 5:142324648-142324670 GGCCCGGCCGGCACGGCGCCGGG - Intronic
1000942218 5:167375384-167375406 GGACAGGCCGGAACTGCGCCTGG - Exonic
1001617751 5:173056589-173056611 GGCCGGGCCGGCGCGGGGCGGGG + Intronic
1002131045 5:177081969-177081991 GGCCAGGCCCGGGCTGCAGTGGG + Intergenic
1002190177 5:177473729-177473751 GGCCGGGCCGGGGCGGCGCTAGG - Intronic
1004217595 6:13716937-13716959 CGGCCTGCCGGCGCTGCGCTGGG + Intergenic
1005453067 6:25992608-25992630 GGCAGGGCCGGCGCTGCGGGCGG - Intergenic
1005822900 6:29612494-29612516 GGCTAGGCTGGGGCTGGGCTGGG - Intronic
1005935532 6:30518038-30518060 GGCTAGGCAGGCCCTGCACTGGG + Intergenic
1006034034 6:31198068-31198090 ACCCAGGGCGGGGCTGCGCTCGG - Intronic
1006802248 6:36766630-36766652 GACCAGGACGGCCCTACGCTTGG + Intronic
1006912985 6:37576090-37576112 GGCCAGGCTGGGGCTGGGCCAGG + Intergenic
1009192875 6:60650702-60650724 AGCCAGGCCAGGGCTGGGCTGGG - Intergenic
1012548817 6:100449378-100449400 GGTGAGGCCGGCGTTACGCTTGG + Exonic
1013276417 6:108589334-108589356 GGCCAGGCCTTGGCTGCCCTGGG + Intronic
1013512546 6:110858173-110858195 GGCCTGGCAGGCGCGGGGCTGGG - Intronic
1015369991 6:132439748-132439770 GGCCTGGCCTGTGCTGCCCTAGG + Intergenic
1016479739 6:144469494-144469516 GGCTAGGCAGGTGCTGAGCTTGG + Intronic
1017497559 6:154995283-154995305 GGCCTGGCAGGCGCTGCGCGCGG + Intronic
1017889386 6:158626228-158626250 GGCCAGGCCGAGCCTGCCCTGGG - Intronic
1017971512 6:159315865-159315887 GGGGAGGCCGGGGCTGCGCGTGG + Intergenic
1017978008 6:159375106-159375128 GGCCAGGCTGGGGCTGCGTGTGG - Intergenic
1018598685 6:165514618-165514640 AGCCTGGCCGGCCCTCCGCTAGG + Intronic
1018686475 6:166307948-166307970 GTCCAGGCCGGGGCCGCGCCGGG + Exonic
1019279403 7:192580-192602 GGCCAGGCGGGAGCTGCGCTCGG + Intergenic
1019532544 7:1511000-1511022 GGCCAGGCCTGGTCTGCGCTGGG - Intergenic
1019624467 7:2009010-2009032 GGCCGGGGCGTGGCTGCGCTGGG - Intronic
1019647974 7:2141184-2141206 GGCAAGGCTGGCCCTGCTCTAGG - Intronic
1019730471 7:2626977-2626999 GGCCAGGCCTGAGCTGAGCATGG - Intergenic
1021313235 7:19117399-19117421 GCCCGGGCCGGCGCCGCGCGCGG - Exonic
1022528339 7:31052400-31052422 GGCAAAGGGGGCGCTGCGCTCGG + Intergenic
1023684655 7:42721885-42721907 TGCCTGGCCGGGGCTGGGCTGGG - Intergenic
1024579967 7:50793402-50793424 GGCCGGGCGGGCTCGGCGCTCGG - Intronic
1025208516 7:57007725-57007747 CGCCTGGCAGGCTCTGCGCTTGG - Intergenic
1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG + Intergenic
1029560544 7:101300057-101300079 GGCAAGGCAGGAGCTGCCCTCGG - Intergenic
1029561955 7:101308753-101308775 GGCAAGGCAGGAGCTGCCCTCGG - Intergenic
1029650102 7:101885680-101885702 GGCCATGCCTGCTCTGTGCTCGG - Intronic
1030388206 7:108891910-108891932 GGGCAGGACGTCTCTGCGCTAGG + Intergenic
1034174610 7:149090772-149090794 CGCCCGGCCGGCGCTGCGTTTGG - Intronic
1034939387 7:155220558-155220580 GGCCAGGCTGGGGCAGGGCTGGG - Intergenic
1035004508 7:155644945-155644967 GGCCAGGACCGCGCCGCGGTGGG + Intronic
1036432157 8:8701849-8701871 GGCCAGGCGGGCGGTGGGCGGGG - Intergenic
1037517340 8:19645832-19645854 GCCCAGGCCAGCACTGCCCTGGG - Intronic
1038893561 8:31755105-31755127 GGACAGGCCTGCACTGCTCTGGG + Intronic
1039493567 8:37965278-37965300 GGCAAAGCCTGGGCTGCGCTGGG + Exonic
1039825830 8:41173439-41173461 TTCCAGGCAGGCGCTGTGCTAGG - Intergenic
1039921248 8:41896038-41896060 CGGCAGGCCCGCGCTGCTCTAGG - Intronic
1040567547 8:48581529-48581551 GGCCACGCCGGCCCTGCGCTGGG - Intergenic
1041673796 8:60517537-60517559 GGCCCCGGCGGCCCTGCGCTAGG - Intronic
1043428496 8:80171677-80171699 GGCGCGGGCGGCGCAGCGCTAGG + Intronic
1043472850 8:80578795-80578817 GGCCAGGCGGGAGCTGCCCTGGG + Intergenic
1045099012 8:98826076-98826098 GGCGAGGCCGGAGCCGCTCTAGG + Intronic
1049762215 8:144336718-144336740 GCCCAGGCCGGCGCTGGCCGCGG - Intergenic
1049778469 8:144416881-144416903 GGCCAGACTGGGGCTGGGCTAGG + Exonic
1052963213 9:34318534-34318556 GGCCAGGCCGGCGCTGTGTTCGG - Intronic
1052987981 9:34501935-34501957 GTCCAGGCCAGCACAGCGCTAGG - Intronic
1053240115 9:36487952-36487974 ACCCAGGCTGGGGCTGCGCTTGG + Intergenic
1053906878 9:42851860-42851882 GGCCAGGTGGGCTGTGCGCTCGG + Intergenic
1057300687 9:93880012-93880034 GGCTTGGCTGGCCCTGCGCTCGG + Intergenic
1057546259 9:96021885-96021907 GGCCCCGCAGCCGCTGCGCTCGG - Intergenic
1060213594 9:121725097-121725119 GGCCAGGCCTGAGCTCCTCTGGG - Intronic
1061014755 9:127975199-127975221 GGCCAGGTCAGTGCCGCGCTGGG - Intronic
1061055105 9:128218362-128218384 GGCCAGGCTGGCCCTCAGCTTGG - Intronic
1061092760 9:128435829-128435851 GTCCAGGCGGGGGCTGCGCAGGG - Exonic
1061293618 9:129665897-129665919 GGACAAGCCGGCGCTGGGCCCGG + Exonic
1061547867 9:131315191-131315213 GGCCAGGCTGGAGCTGGGCTGGG + Intergenic
1061562557 9:131415411-131415433 GGCCAGGCCCCCGCTCCCCTGGG + Intronic
1061789374 9:133050978-133051000 GGCAAGTCCTGCGCTGCGCCTGG + Exonic
1061853319 9:133428708-133428730 GGCGAGGCCGGCGCGGGGCGCGG - Exonic
1061920399 9:133779395-133779417 GGCCAGGCGGGAGCTGGGCTGGG - Intronic
1062031888 9:134365534-134365556 GACCAGGCTGGGGCTGCACTGGG + Intronic
1062032955 9:134370292-134370314 GGGCAGGGCTGCGCTGAGCTTGG + Intronic
1062168296 9:135119913-135119935 GGCCTCCCCGGCGCTGCGCTTGG - Exonic
1062340204 9:136090780-136090802 GGGCAGCCCGGCCCTGGGCTGGG - Intronic
1062433979 9:136538309-136538331 GGCGAGGCCTGCGCTGGGCTCGG - Intronic
1062457646 9:136646991-136647013 GGCCAGGCCAGCGCCTCTCTGGG - Intergenic
1062521940 9:136961584-136961606 GGCCGGGAGGGCGCTGCTCTCGG - Intergenic
1062527013 9:136981995-136982017 CACCAGGCCGGTGCTGAGCTGGG + Intronic
1185747532 X:2584419-2584441 GGCCCGGCGGCCGCTGGGCTGGG + Intergenic
1187826290 X:23335273-23335295 GGTCGGGCTGGCTCTGCGCTGGG + Intronic
1189294875 X:39910960-39910982 GGGCAGGCCCGGGCTGCGCAAGG + Intergenic
1189308824 X:40006213-40006235 GGCCTGGCCGGCTCAGCGCTAGG - Intergenic
1190008120 X:46759152-46759174 CGCCGGGCCGGGGCTGCGCCCGG + Intronic
1190278221 X:48912793-48912815 GGCCAGGGCGGGGCTGGGGTTGG - Intergenic
1197891961 X:131277707-131277729 AGCCAGGCAGGCGTGGCGCTGGG - Intronic
1200090305 X:153632872-153632894 GGCTAGGCCGGGGCTGGGCTGGG + Intergenic
1200224817 X:154411659-154411681 GGTCAGGCCGGAGCAGCGCCCGG - Exonic
1200239990 X:154488386-154488408 GGCCAGGTCGGCGCTGAGGGTGG + Exonic