ID: 1085319784

View in Genome Browser
Species Human (GRCh38)
Location 11:75566891-75566913
Sequence GACCTCGGGCAGCTTGCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085319784_1085319789 -1 Left 1085319784 11:75566891-75566913 CCGACGGCAAGCTGCCCGAGGTC 0: 1
1: 1
2: 0
3: 3
4: 70
Right 1085319789 11:75566913-75566935 CACCAAGGACGTGGAGCGCACGG 0: 1
1: 0
2: 1
3: 6
4: 80
1085319784_1085319786 -10 Left 1085319784 11:75566891-75566913 CCGACGGCAAGCTGCCCGAGGTC 0: 1
1: 1
2: 0
3: 3
4: 70
Right 1085319786 11:75566904-75566926 GCCCGAGGTCACCAAGGACGTGG 0: 1
1: 0
2: 2
3: 15
4: 127
1085319784_1085319791 3 Left 1085319784 11:75566891-75566913 CCGACGGCAAGCTGCCCGAGGTC 0: 1
1: 1
2: 0
3: 3
4: 70
Right 1085319791 11:75566917-75566939 AAGGACGTGGAGCGCACGGACGG 0: 1
1: 0
2: 1
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085319784 Original CRISPR GACCTCGGGCAGCTTGCCGT CGG (reversed) Exonic
902725737 1:18334882-18334904 GACCTCGGGCAGCCTGGGGGAGG - Exonic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
912859317 1:113198885-113198907 GACCTCGAGCAGCTAGCTGCTGG + Intergenic
914932792 1:151949773-151949795 GTCCTCCGGCAGCTTCCCGTAGG + Intergenic
922221110 1:223609269-223609291 GACCTCCCGCAGGTTGACGTAGG + Exonic
1073178144 10:101569071-101569093 GACCTCAGGTAGCTTGGGGTGGG + Intergenic
1076208888 10:128625113-128625135 GTCCTCGGGCTCCTTGCCTTGGG + Intergenic
1077093136 11:788517-788539 GACCTGGGGCACCTTGGTGTCGG + Exonic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1078084114 11:8223632-8223654 GCCCTTGGGGAGCTTGCTGTGGG - Intergenic
1078354876 11:10626035-10626057 GGCCTTGGCCAGCTTGCCGCCGG + Exonic
1085025624 11:73234852-73234874 GACCTCGGGCGGCCTGCCTAGGG + Exonic
1085319784 11:75566891-75566913 GACCTCGGGCAGCTTGCCGTCGG - Exonic
1091545044 12:1496037-1496059 GCCCTCGGGCTGCCTGCCATTGG - Intergenic
1096149091 12:49297544-49297566 GCCCTCCAGCAGCTTGCGGTAGG - Exonic
1096531525 12:52245599-52245621 GCCCTCCAGCAGCTTGCGGTAGG - Exonic
1096562652 12:52447789-52447811 GCCCTCCAGCAGCTTGCGGTAGG + Exonic
1096564822 12:52469681-52469703 GCCCTCCAGCAGCTTGCGGTAGG + Exonic
1096578246 12:52568180-52568202 GCCCTCCAGCAGCTTGCGGTAGG + Exonic
1096584419 12:52610626-52610648 GCCCTCCAGCAGCTTGCGGTAGG + Exonic
1096609432 12:52791217-52791239 GCCCTCCAGCAGCTTGCGGTAGG + Exonic
1101366814 12:104079632-104079654 GACCTATGGCAGCTTGACTTAGG + Exonic
1112372765 13:98809409-98809431 GACCTCGGTCACTTTGCTGTAGG + Exonic
1113426293 13:110211175-110211197 GACCTCGGGCATCTGGATGTTGG - Intronic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129300860 15:74624707-74624729 GATCTCAGGGAGCTTGCTGTTGG + Intronic
1130118120 15:81023357-81023379 GACCTCGGACAACTTGCCTAAGG - Intronic
1140042224 16:71415746-71415768 AGCCTTGGGCAGCTTGCCCTTGG + Intergenic
1142177661 16:88652386-88652408 GCCCATGGGCAGCTTGCTGTGGG - Exonic
1147184121 17:38704649-38704671 GCCCTCGGGGAGCTTCCTGTCGG - Intergenic
1152205758 17:78973656-78973678 GTCCTCGAGCAGCTTCCTGTCGG + Intronic
1156545823 18:37962736-37962758 GACCTTGGGCAGATTGCTGTAGG + Intergenic
1160034632 18:75288583-75288605 GTCCTCGGGAGACTTGCCGTGGG - Exonic
1165059291 19:33197067-33197089 GACCCTCGGCAGCTTGCCGGTGG - Intronic
1167034257 19:46984429-46984451 GAGCACGGGCAGCTTGCCAAAGG - Intronic
927147799 2:20178449-20178471 GGTGTCGGGCAGCTTGCCCTGGG - Intergenic
933700595 2:85252720-85252742 GGCCTCGGGGAGCTTGTGGTAGG - Intronic
938046403 2:128125295-128125317 GACCTCAGGCACCTGGCTGTGGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1168979026 20:1989314-1989336 GACCTGGGGAGGCTTGCCTTGGG + Intronic
1170591409 20:17774663-17774685 AACCTCTGGAAGCTTGCTGTGGG + Intergenic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1175197011 20:57251162-57251184 GACCTCGGGCCGCCTGCAGCTGG - Intronic
1179881802 21:44296166-44296188 GGCCGTGGGCAGCTGGCCGTGGG + Intronic
1180201733 21:46228769-46228791 GACATCTGGCAGCTGGCAGTGGG - Exonic
1182472228 22:30555637-30555659 GAACTCGGTCAGCTTGTCGCCGG + Exonic
1184987200 22:48144034-48144056 GACCTGGGGCACCTGGCCCTTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
954455800 3:50599252-50599274 TACCTGGGGCAGCTGGCAGTGGG - Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
961919614 3:130412303-130412325 AACCTTGGGCAGCTTGCCCAAGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
967098128 3:186194009-186194031 GACATCGGGCACCTGGCCGCCGG - Intronic
970372340 4:15420671-15420693 GACCTTGGGCAAATTGCCTTGGG - Intronic
972586203 4:40438819-40438841 GCCCTCGGGCACCTTGGCGGAGG + Exonic
982565231 4:156977558-156977580 GGCCTCGGGCAGCTAGCCTTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1002927163 6:1611261-1611283 CCCCCCGGGCAGCCTGCCGTCGG + Exonic
1016867160 6:148778772-148778794 GGCCTGGGGCAACTTGCCGAGGG + Intronic
1024574116 7:50750144-50750166 GCCCTCCGGCAGCTCTCCGTGGG + Intronic
1025868207 7:65405785-65405807 GACCTTGTGCAGCTTGTGGTGGG + Intergenic
1027640763 7:80731143-80731165 GACTTCCGTCAGCTTCCCGTTGG - Intergenic
1031134741 7:117873084-117873106 GACCCGGGGCCGCTTCCCGTGGG + Intronic
1033361488 7:140641216-140641238 TGCCCCAGGCAGCTTGCCGTCGG + Intronic
1037808844 8:22074114-22074136 GTCCTCTGGTAGCTTGCTGTTGG + Intronic
1044574702 8:93755118-93755140 TACCTCGGGCATCTTGCCTCTGG - Exonic
1045657299 8:104400072-104400094 GACCCCAGGCAGCTTGCAGCAGG - Intronic
1052963276 9:34318945-34318967 GACCTTGGGCAGCTTGCCGTCGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058585786 9:106504812-106504834 GACTTTGGGCAGAGTGCCGTGGG + Intergenic
1059256197 9:112933569-112933591 GACTTCGGGCTGCTGGCAGTGGG + Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1191846564 X:65551573-65551595 GACCTCCTGCACCTTGCGGTAGG + Intergenic
1199927295 X:152480741-152480763 GCCCTCCAGCAGCTTCCCGTAGG - Intergenic