ID: 1085320207

View in Genome Browser
Species Human (GRCh38)
Location 11:75569284-75569306
Sequence CAGTGCTGGGCTCTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 395}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085320200_1085320207 -8 Left 1085320200 11:75569269-75569291 CCCTGGATGTCCAGGCAGTGCTG 0: 1
1: 0
2: 1
3: 24
4: 332
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320196_1085320207 0 Left 1085320196 11:75569261-75569283 CCAAGACCCCCTGGATGTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 263
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320201_1085320207 -9 Left 1085320201 11:75569270-75569292 CCTGGATGTCCAGGCAGTGCTGG 0: 1
1: 0
2: 8
3: 106
4: 608
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320193_1085320207 19 Left 1085320193 11:75569242-75569264 CCAATTCAGCAGGTCTGTCCCAA 0: 1
1: 0
2: 1
3: 14
4: 116
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320199_1085320207 -7 Left 1085320199 11:75569268-75569290 CCCCTGGATGTCCAGGCAGTGCT 0: 1
1: 0
2: 5
3: 25
4: 221
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320191_1085320207 27 Left 1085320191 11:75569234-75569256 CCCACTCACCAATTCAGCAGGTC 0: 1
1: 0
2: 1
3: 14
4: 113
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320198_1085320207 -6 Left 1085320198 11:75569267-75569289 CCCCCTGGATGTCCAGGCAGTGC 0: 1
1: 0
2: 2
3: 26
4: 205
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320192_1085320207 26 Left 1085320192 11:75569235-75569257 CCACTCACCAATTCAGCAGGTCT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395
1085320195_1085320207 1 Left 1085320195 11:75569260-75569282 CCCAAGACCCCCTGGATGTCCAG 0: 1
1: 0
2: 1
3: 9
4: 173
Right 1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG 0: 1
1: 0
2: 4
3: 57
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085320207 Original CRISPR CAGTGCTGGGCTCTGTGATG GGG Intronic
900980855 1:6045371-6045393 CAAGGCTGAGCTCTGGGATGAGG - Intronic
901215352 1:7551863-7551885 CTGTGCTTGGTTCTGTGCTGAGG - Intronic
901667474 1:10834984-10835006 CTGTATTGGGCTCTGGGATGGGG - Intergenic
902206711 1:14873649-14873671 CAGTGGTGGGCTTTGAGAAGAGG + Intronic
902237680 1:15068251-15068273 CAGGGCTGGGTTCTGGGAGGGGG + Intronic
902242079 1:15095987-15096009 CAGGGCTGGGCTGAGGGATGGGG + Intronic
902370676 1:16005042-16005064 CTGTGCTGGGCTCTGAGCGGGGG + Intronic
903268003 1:22169997-22170019 CAGTGATTGGCTCCGGGATGGGG + Intergenic
903322314 1:22550521-22550543 CTGTGATGAGTTCTGTGATGTGG + Intergenic
903415498 1:23179648-23179670 CAGCACTGTGCTCTGTCATGTGG - Intergenic
903739676 1:25551619-25551641 CAGTCCTGGGTTGAGTGATGGGG - Intronic
903934398 1:26885097-26885119 CTGTGCTGGGCACTGTGCTAAGG - Intronic
904429353 1:30451928-30451950 CAGTGAAGGGCTGGGTGATGCGG - Intergenic
905285835 1:36879777-36879799 CAAAGCTGGGCTCCCTGATGTGG - Intronic
905314340 1:37071971-37071993 CTGAGCTGGGCTCTGGGATGGGG + Intergenic
905394871 1:37660742-37660764 CAGAGCTGGTGTCTGTGGTGGGG - Intergenic
905771220 1:40639181-40639203 CAGGGCTGGGCTGTGTGAAGTGG - Intronic
905797481 1:40823779-40823801 CACTGCTGGCCTCTCTGAGGAGG + Intronic
905900782 1:41580948-41580970 CACTGCTGTACTCTGTGCTGGGG + Exonic
907504790 1:54910194-54910216 CAGGGCTGGTGTCTGGGATGAGG + Intergenic
907526641 1:55057592-55057614 CAGTGCCAGGCTCTGTGCAGGGG + Intronic
907664673 1:56424428-56424450 CAGTGCTAGGCTCTGTGGTCAGG - Intergenic
907764702 1:57397527-57397549 CAGTGCTGGGCTCTGAGGAAAGG + Intronic
910744544 1:90559123-90559145 CAGTTCTGAGCTTTGTGCTGCGG - Intergenic
910975409 1:92901283-92901305 CAGTGCTGGGTTCTGGGAGCAGG + Intronic
913192588 1:116426200-116426222 CCATGCTGGGCTGTGGGATGAGG + Intergenic
915239482 1:154509922-154509944 AGGTGCTGGGCTCTGGAATGGGG - Intronic
916122944 1:161545001-161545023 CAGTGCAGAGCTTTGTGAAGGGG + Intronic
916132848 1:161626447-161626469 CAGTGCAGAGCTTTGTGAAGGGG + Intronic
916452039 1:164930077-164930099 CAGTGCTGGGAGCTGTGAGTTGG + Intergenic
917602931 1:176595473-176595495 CAGGGATGGGCTCTGTCACGTGG + Exonic
918146957 1:181765456-181765478 GATTCCTAGGCTCTGTGATGGGG - Intronic
919792966 1:201304158-201304180 CAGTGCTGGGATCTGAGTTGGGG + Intronic
919942061 1:202294870-202294892 CAGAGAAGGGCTCTCTGATGAGG + Intronic
921448950 1:215279885-215279907 CAGTACTGGCAGCTGTGATGTGG - Intergenic
921722901 1:218493163-218493185 CAGTGCTGCGCTGGGTGTTGGGG + Intergenic
921898572 1:220426477-220426499 CAGTGCTCTGCTCTGTGAAGTGG - Intergenic
922163690 1:223097369-223097391 AAGAGCTGTGCCCTGTGATGGGG - Intergenic
922242025 1:223761772-223761794 CAGCTCTGGCCTCTGTGCTGGGG + Intronic
922277255 1:224090469-224090491 CAGTGATGGCTTCTCTGATGAGG - Intergenic
922659198 1:227414532-227414554 CAGTGGTGGGCTGAGTGATTGGG - Intergenic
923114561 1:230922860-230922882 CTGTGCTGTGCTGTGTGTTGGGG - Intronic
923518414 1:234717066-234717088 TAGAGCTGGGCTCTGTGCTATGG + Intergenic
924243206 1:242059298-242059320 CAGTGATGGACACTGTGAGGCGG + Intergenic
924625091 1:245690642-245690664 AAGTTCTGTGATCTGTGATGAGG - Intronic
1062864774 10:842962-842984 CAGTGCTGAGCTTCTTGATGTGG + Exonic
1063019562 10:2114292-2114314 CCCTGCTGGGCACTGTGCTGGGG - Intergenic
1063439228 10:6058844-6058866 TATTACTGGGCTCTGGGATGTGG - Intronic
1063439297 10:6059549-6059571 TATTGCTGGGCCCTGGGATGTGG - Intronic
1063699428 10:8370291-8370313 CAGTGTGGGGATCTGAGATGTGG - Intergenic
1063871977 10:10427331-10427353 AGGTGCTGGCCTCTGTGAAGAGG + Intergenic
1064438572 10:15332948-15332970 CTCTGGTGGGCTCTGTGTTGAGG - Intronic
1065020713 10:21500027-21500049 CAGTTCTGGGCTCTCAGATCGGG + Intergenic
1066473124 10:35718677-35718699 CTGTGCTGGGCACAGGGATGGGG + Intergenic
1067213626 10:44282056-44282078 CAGGGCAGGGCTCTGTGTTTGGG - Intergenic
1069595413 10:69666803-69666825 AAGGGCTGGGCAGTGTGATGAGG + Intergenic
1070628521 10:78068026-78068048 CATTGCCTTGCTCTGTGATGGGG - Intergenic
1071514093 10:86285541-86285563 CAGTGCTGGTCTCTTGGAGGTGG - Intronic
1071528161 10:86370252-86370274 CACTGGTGGGCTCTGTGCTGAGG - Intergenic
1072914247 10:99527373-99527395 CAGTGCTGGGCTTTTTCCTGGGG - Intergenic
1073283215 10:102369872-102369894 CAGTGCTGAGCTTTGTGAGCTGG + Exonic
1073473264 10:103736934-103736956 CAGTGATTGGCTCAGTGGTGGGG + Intronic
1074462919 10:113654933-113654955 CAGTGATGGGCTCAGTAATTAGG + Intronic
1075187162 10:120273455-120273477 CAGTGCTGGTCTCTGGTGTGTGG + Intergenic
1075412972 10:122242483-122242505 CAGTGCTGGGGTCAGTGAACAGG - Intronic
1075672620 10:124272930-124272952 CTGTGCTGGGCTGAGAGATGGGG - Intergenic
1076432241 10:130412476-130412498 GGGTGCTGGGCTGTGTGCTGGGG + Intergenic
1077093962 11:791604-791626 CAGAGCTGGTCTCTGGGCTGGGG - Exonic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077798027 11:5511529-5511551 CAGTGGTGGGCTCTGGCATTAGG - Intronic
1077906566 11:6539135-6539157 CTGGGCTGGGCTCTGGGATATGG + Intronic
1078436070 11:11327002-11327024 GAGAGCTAGGCTCTGTCATGGGG - Intronic
1079342991 11:19628356-19628378 TAGTGCAGGGCCCTGTGAGGAGG + Intronic
1081569980 11:44284327-44284349 GCGGGCTGGGCTCTGTGCTGTGG + Intronic
1081758886 11:45563185-45563207 CTGTGTTGAGGTCTGTGATGAGG - Intergenic
1081864602 11:46352605-46352627 CTGTCCTGGGTCCTGTGATGAGG - Intronic
1082056258 11:47819545-47819567 CATTGCCGGGTTCCGTGATGGGG - Intronic
1082060028 11:47851999-47852021 CAGTGCTGGTAACTGCGATGGGG - Intergenic
1083304738 11:61756426-61756448 CTGAGCTGGGCTTCGTGATGGGG + Intronic
1083529760 11:63409073-63409095 CAGAGCTGGTCTGTGTGATCTGG - Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083864670 11:65446984-65447006 CAGTCCTGGGCTCTGTGCCTTGG - Intergenic
1083898957 11:65634500-65634522 CTGAGCTGGGCTCTGGGATGGGG + Intronic
1084938744 11:72601196-72601218 GAGTGAGGGGCTCTGTGAGGGGG - Intronic
1084963855 11:72733220-72733242 CAGTGCTGGGATGTGTGTAGGGG + Intronic
1085040843 11:73325367-73325389 CAGGGCTGGGCCCTGTGCTTGGG + Intronic
1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG + Intronic
1085509658 11:77081854-77081876 GAGTGCTGGCGTCTGTGATGTGG + Intronic
1085530970 11:77191833-77191855 CAGTTCTGGGCACGGTGACGTGG - Intronic
1085534875 11:77211780-77211802 CAGGGCTGGGCTCAGTCCTGGGG - Intronic
1086592252 11:88529192-88529214 ATGTGCTGGGCACTGTGATAAGG + Intronic
1089331195 11:117690225-117690247 AAGAGCTGGGCACTGTGCTGGGG + Intronic
1089693321 11:120200011-120200033 GAATGCTGGGCCCTGTGAGGGGG - Intergenic
1089739693 11:120573871-120573893 CAGTGTGGGCCTCTGGGATGTGG - Intronic
1090240075 11:125175547-125175569 CTGTGCTGAGCCCTGTGCTGGGG + Intronic
1090417297 11:126549375-126549397 CAGTGCCGGGCCCTGTGCTCTGG - Intronic
1090945976 11:131430086-131430108 CTGTGCTGGGCGCTGGGATATGG + Intronic
1091375635 12:23066-23088 CTGTGCTGGGGCCTGAGATGGGG + Intergenic
1091593126 12:1857165-1857187 CAGTGCTAGGATCTGTGCTGTGG + Intronic
1091631098 12:2161513-2161535 CTGCCATGGGCTCTGTGATGGGG - Intronic
1096278677 12:50232698-50232720 CAGTTCTGGGCTGGGTGAAGTGG + Intronic
1096516736 12:52160263-52160285 CAGTTCTGGGGTCTCTGAGGTGG + Intergenic
1100656933 12:96656887-96656909 ATGTGCTGGGCACTGTGCTGAGG + Intronic
1100666476 12:96758822-96758844 CAGGGATGGGCTCTGAGATTTGG + Intronic
1101515830 12:105434354-105434376 CAGTTCTGGGGTCTCTGAGGTGG + Intergenic
1101725832 12:107387439-107387461 AAGTGCTGGGCTAGGTGCTGAGG + Intronic
1101818149 12:108161819-108161841 CACAGCTGGGCTATGTGATGTGG + Intronic
1102420680 12:112800609-112800631 CAGTGAGGGGAGCTGTGATGGGG + Intronic
1102956554 12:117062859-117062881 CAGCCCTGGGCTCTGAGGTGAGG - Intronic
1103450220 12:121023649-121023671 CAGTGCTGTTCTCAGGGATGGGG - Intronic
1103556884 12:121771725-121771747 CAGTGCTGGGGGCTGGGAGGTGG - Intronic
1104376712 12:128269434-128269456 CAGTGCTGGGGGCAGTGATTTGG + Intronic
1104491916 12:129201552-129201574 CAGTGCTGGGCTCAAGGATAAGG + Intronic
1104589026 12:130069617-130069639 CTGGGCTGGGCTCTGTGCTGAGG + Intergenic
1104703488 12:130925030-130925052 CAGGGCTGGGCTCTCTGAGATGG - Intergenic
1105700718 13:22934453-22934475 CAGAGGTGGGGGCTGTGATGGGG - Intergenic
1105853544 13:24357526-24357548 CAGAGGTGGGGGCTGTGATGGGG - Intergenic
1106174870 13:27321637-27321659 CATGGCTGGGCTGTGGGATGGGG + Intergenic
1112061420 13:95743285-95743307 GAGAGCTGGGCTCTGCAATGTGG + Intronic
1112717149 13:102200058-102200080 CAGTGTTGTCATCTGTGATGGGG + Intronic
1114969873 14:28012913-28012935 AAGTGCTGGGCTCTGCTGTGAGG - Intergenic
1118640218 14:67785266-67785288 GAGTCCTGGGCTCTGAGAGGAGG + Exonic
1119589070 14:75868009-75868031 CCATGCTGGGGTCTGTGAGGAGG + Intronic
1120565345 14:86048262-86048284 CCTTGCTGGGCTCTGTGGGGTGG + Intergenic
1121046319 14:90790919-90790941 CTTTCCTGGGCTCTGTGCTGTGG - Intronic
1121522127 14:94593386-94593408 CAGTCCTGTGCTCTGTGCTGTGG + Intronic
1121584721 14:95055342-95055364 GAGGGCTGTGTTCTGTGATGTGG + Intergenic
1122240230 14:100359886-100359908 GACTGCTGGGCTCTGTCCTGGGG + Intronic
1122895255 14:104753482-104753504 CAGGGCTGGGGTCAGTGAGGGGG + Intronic
1123894733 15:24817333-24817355 CAGTGCTGTGGTCTGTGAATAGG - Intergenic
1124390415 15:29250644-29250666 CAGTGCAGGGCTCTGTGTGGGGG - Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1129463239 15:75710347-75710369 CAATGCTTGGCTCTCTGCTGGGG + Intronic
1129670962 15:77607489-77607511 CAGTGCTGGTGTCTGAGAAGGGG - Intergenic
1129721648 15:77881055-77881077 CAATGCTTGGCTCTCTGCTGGGG - Intergenic
1130046875 15:80452648-80452670 CAGCACAGGGCTCTGTGAGGAGG + Intronic
1130879941 15:88046333-88046355 CTGTGCTGGGCTCTGAGCTAGGG + Intronic
1132013760 15:98298393-98298415 CATTGCTGGGCTCTCTGTTCTGG - Intergenic
1132694569 16:1196147-1196169 CACTGCTGGGGTCTGGGCTGGGG - Intronic
1132815678 16:1825438-1825460 CAGTGCTGGGCTGAGTGATATGG - Intronic
1133548147 16:6828009-6828031 CAGTATTGAGCTCTGTGCTGGGG - Intronic
1133947714 16:10363058-10363080 CAGAGCTAGGCACAGTGATGTGG - Intronic
1134024627 16:10944563-10944585 CAGTGCTGGGCTGTGGGCCGGGG + Exonic
1134261377 16:12653755-12653777 CACGGCTGGGCTCTGTGCTGGGG + Intergenic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1135433502 16:22408083-22408105 AAGTGCTGAGCTCTGTGATATGG + Intronic
1135675390 16:24411018-24411040 CAGTGCTGGGATCTGTCCAGTGG - Intergenic
1135861739 16:26062352-26062374 CAGTGCTTGGCACTGTGATTGGG + Intronic
1136008339 16:27346400-27346422 CGGGGCTGGGCTGGGTGATGGGG + Intronic
1137961727 16:52887927-52887949 CAGTTCTGGCCTTTGTTATGAGG + Intergenic
1139440513 16:66964339-66964361 CAGTGCTGGGGGCAGTGTTGGGG - Exonic
1139719914 16:68843955-68843977 TTGTGCTGGGCTCTGTCAGGCGG + Intronic
1140061044 16:71569913-71569935 CAATGCTGATCTCTGTTATGGGG - Exonic
1140427335 16:74871877-74871899 TAGTGCTGGGCTCTGGTCTGAGG - Exonic
1141167176 16:81668581-81668603 CACTGCGGGGCTCTGTCAAGGGG - Intronic
1141269556 16:82526529-82526551 CTGTGCTTGGCCCTGTGCTGAGG + Intergenic
1141424608 16:83936700-83936722 CAGGGCTGGCCTTTGTGAAGAGG - Intronic
1141832721 16:86518657-86518679 GAGTTCTGGGCTCTGTGTTAAGG + Intergenic
1141993640 16:87623695-87623717 CAGTGCAGGACTCAGAGATGGGG - Intronic
1142570363 17:869663-869685 CAGAACTGGGCTCTGTAATAAGG - Intronic
1142571936 17:880339-880361 CAGGGCTGGGGTTTGTGATAAGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142882205 17:2890547-2890569 CTGTGCTGGGCACTGTGAGACGG + Intronic
1142896144 17:2980410-2980432 CAGGGCTGGCCTCTGGAATGGGG + Intronic
1143776673 17:9204085-9204107 CAGTCCTAGGATCGGTGATGAGG + Intronic
1144650031 17:17001656-17001678 CAGTGCTGGGCACTGTAGGGAGG + Intergenic
1145251036 17:21297177-21297199 CGGTGCGTGGCTCTGAGATGGGG + Intronic
1145829802 17:27906808-27906830 CTGCGCTGGGCTTTGGGATGGGG + Intergenic
1146155700 17:30522505-30522527 CAGTGATGGACTCTGTGACATGG + Exonic
1146515863 17:33488879-33488901 CAGAGTTGGCCTCTCTGATGGGG + Intronic
1146517226 17:33498648-33498670 CTGCGCTGGGCTCTGGGATGTGG + Intronic
1146683753 17:34826686-34826708 CTGGGCTGTGCTCTGTGTTGTGG - Intergenic
1147922853 17:43929025-43929047 CAGTGGTGGGCTCTGGCATGAGG - Intergenic
1147938152 17:44025506-44025528 GAGAGCTGGGCTCTGGGAGGAGG - Intergenic
1148785614 17:50144814-50144836 AGGTCCTGGGCTCTGTGTTGGGG - Intronic
1149165690 17:53749358-53749380 CAGTGCTGGGGTGTGGGTTGGGG + Intergenic
1149522074 17:57324953-57324975 CAGCACTGGGCTCTGAGCTGTGG - Intronic
1150276197 17:63899348-63899370 CAGTGCTGGGGACTTAGATGTGG + Intergenic
1150278351 17:63914077-63914099 CAGTGCTGGGGACTTAGATGTGG + Intronic
1150623343 17:66824504-66824526 GAGTGCTGGACTCTGCAATGGGG - Intergenic
1150923072 17:69504082-69504104 CATTGCTGACCTCTGTGATGTGG + Intronic
1151435154 17:74090786-74090808 CTGTGCTGGGCTCTGTAAGAAGG - Intergenic
1151885690 17:76922110-76922132 CAGAGGTGTGCTCAGTGATGGGG + Intronic
1152144527 17:78560390-78560412 CACTTGTGGGCTCTGGGATGTGG - Intronic
1152469372 17:80482310-80482332 CAGTGCTGGGGTCAAGGATGGGG + Intergenic
1152537233 17:80957790-80957812 CTTTGCTGGGTTCTGTGACGAGG - Intronic
1152920501 17:83064257-83064279 CAGGGCTGGGGGCTGTGGTGGGG - Intergenic
1153614926 18:6925555-6925577 TAGTTCTGGGCTCTGTGCTTGGG + Intergenic
1155241241 18:23865642-23865664 CAGTGCTGGGGTCTGGGTAGGGG + Intronic
1155397698 18:25403767-25403789 CAGAGCTGTGCTGTGTGCTGGGG + Intergenic
1155437442 18:25827726-25827748 ATGTGCTGTGCTCTGTGATGTGG - Intergenic
1156487730 18:37477249-37477271 CAGTGCTGGGTGCTTGGATGGGG + Intronic
1159972561 18:74671767-74671789 AGGTTCTGGGCACTGTGATGTGG + Intronic
1160089358 18:75811818-75811840 AGGTGCTGGGCTTTGTGATGCGG - Intergenic
1160735450 19:660318-660340 CTGTCCTGGGCTCTGGGATCAGG - Intronic
1162451349 19:10757073-10757095 CAGTGCTGGGGATTATGATGAGG - Intronic
1162553584 19:11372610-11372632 CTGTGCTGGACTCTGTGATGTGG + Intergenic
1163294841 19:16405346-16405368 CTGCGCTGGGCTCTGTGGTGGGG + Intronic
1163324921 19:16597213-16597235 CAGTGCTGGGCACAGGGACGTGG - Intronic
1163601151 19:18249952-18249974 ATGTGCTGGGCTCTGTGCTGGGG - Intronic
1165382195 19:35489360-35489382 CCGTGTTGGGCTCTGTCATGGGG - Intronic
1165435044 19:35790826-35790848 CACTGCTGGGCTGTGTGACCTGG - Intergenic
1165881516 19:39047339-39047361 CAGTGATGGGCTCTGGCATTAGG + Intergenic
1166229961 19:41420979-41421001 CTGTGCTGGGCACAGTGCTGAGG - Intronic
1166299579 19:41906392-41906414 CTGGGCTGGGATCTGGGATGGGG - Intronic
1168080242 19:54004831-54004853 CAGTGCTGGTCTCTCTGAGGTGG - Intronic
1168134082 19:54338760-54338782 CAGTTCTGGGCTGACTGATGGGG - Intronic
1168169028 19:54574196-54574218 CAGTTCTGGGCTGACTGATGGGG + Intronic
1168176525 19:54631391-54631413 CAGTTCTGGGCTGACTGATGGGG + Intronic
926161785 2:10494745-10494767 CAGTGCTGGGCTCCCAGGTGGGG - Intergenic
926197280 2:10771642-10771664 CAGGGCCAGGCTCTGTGCTGGGG - Intronic
926998187 2:18761808-18761830 CAGTTATGAGTTCTGTGATGTGG - Intergenic
929458854 2:42086403-42086425 CAGTCCTGGGCTGTGTGTTGGGG - Intergenic
932361206 2:71107592-71107614 CAGTGATGGGTTCAATGATGTGG - Intergenic
932405955 2:71512797-71512819 CAGCACAGGGCTCTGTGGTGAGG + Intronic
933980264 2:87543626-87543648 CAGCGATGGGCTCTGAGAGGAGG - Intergenic
934584676 2:95480580-95480602 AAGTTGTGGGCTCTGTGAGGTGG - Intergenic
934787999 2:97029484-97029506 AAGTTGTGGGTTCTGTGATGTGG - Intergenic
935133369 2:100277997-100278019 CAATGCTGGGCTCTGGGAAAAGG + Exonic
936313562 2:111407165-111407187 CAGCGATGGGCTCTGAGAGGAGG + Intergenic
936610418 2:113996960-113996982 CAGGGCTGGGATGTGGGATGTGG + Intergenic
937261939 2:120592024-120592046 CAGTGCTTCCCTCTGTGATGAGG - Intergenic
937355145 2:121193568-121193590 CTGTGCTGGGCACTGGGGTGGGG + Intergenic
938708806 2:133957509-133957531 CAGTTCTGGGCTCTGAGACACGG - Intergenic
941760829 2:169241156-169241178 CAGGGCATGGCTCTGTGATCGGG - Exonic
941903670 2:170701081-170701103 CAGTGCTGTTCACTGGGATGTGG + Intergenic
943290230 2:186061658-186061680 CACTGTTGGGCAGTGTGATGAGG + Intergenic
943412503 2:187560952-187560974 GAGGGCTGGTGTCTGTGATGGGG + Intronic
944143373 2:196480512-196480534 CAGTGATGGGTTCTTGGATGTGG + Intronic
944907623 2:204278473-204278495 GGGTGCTGGGCTCTGGGATCTGG - Intergenic
947097678 2:226584729-226584751 CACTGATGGGCTCTGGAATGTGG - Intergenic
948107861 2:235429433-235429455 AAGTGCTGTGCCCTGTGAAGGGG + Intergenic
948237328 2:236400752-236400774 CAGGGTTGGGCTCCGGGATGCGG + Intronic
948371845 2:237494525-237494547 CAGCGGTGGGCTCTGTGAAGTGG + Intronic
948408521 2:237741078-237741100 GACTGCTGGGCTCTGGGATGGGG - Intronic
948624611 2:239261438-239261460 CAGGCCTGGGCTCTGGGAGGTGG + Intronic
1168814326 20:726454-726476 CAGAGGTGGGCTCTGGGGTGAGG - Intergenic
1168837869 20:889949-889971 CTGTGCTGGGCACTGGAATGAGG - Intronic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1169715237 20:8608897-8608919 CAGTGATGGCCTCTGTAATTTGG + Intronic
1170566753 20:17612004-17612026 CAGGGCTGGGCTCTGCAATGTGG - Intergenic
1170910991 20:20567982-20568004 CAGTGCTGGACTCTGTGCTGGGG - Intronic
1172484656 20:35291086-35291108 GGCTGCTGGGCTCAGTGATGGGG - Intronic
1172767427 20:37358312-37358334 CAGAGCTGGGCTTTGGGAAGGGG + Intronic
1172997053 20:39078612-39078634 CAGGGGTGGCCTCTCTGATGAGG - Intergenic
1173142298 20:40494907-40494929 CTGTGCTGACCTCTGGGATGAGG - Intergenic
1173218869 20:41114718-41114740 CAGTGATGGGCTCAGAGATCTGG - Intronic
1174062116 20:47840107-47840129 CAGTGCAGGGCTCCGCGTTGGGG - Intergenic
1174069388 20:47889124-47889146 CAGTGCAGGGCCCCGTGTTGGGG + Intergenic
1174525043 20:51163920-51163942 CTGTGCTGGGATCTGGGATCTGG - Intergenic
1174538781 20:51273425-51273447 CAGAGCTGGGCTCTGTTTTTTGG + Intergenic
1175263178 20:57687519-57687541 CAGGGCTGGGCTCTTTGAGAAGG - Intronic
1175285968 20:57837010-57837032 GTGTGCTGGGCTCTGTGCTTAGG + Intergenic
1175306662 20:57980632-57980654 GAGTGCTGGGCTCCGTGCTGGGG + Intergenic
1175317325 20:58058140-58058162 CACAGGTGGGATCTGTGATGGGG - Intergenic
1175360048 20:58402600-58402622 CTGTGCTAGGCACTGGGATGTGG - Intronic
1175755275 20:61525624-61525646 GTGTGCTCGGCTCTGTGCTGCGG + Intronic
1175893745 20:62327045-62327067 CAGCACAGGGCTCTGTGCTGGGG - Intronic
1175925067 20:62467449-62467471 CAGAGCTGTGCTCTGAGATTCGG - Intronic
1176382571 21:6120631-6120653 CAGGCCTGGGCTCTGTGCAGGGG - Exonic
1178805228 21:35833780-35833802 GAGTGAGGGGCTATGTGATGGGG - Intronic
1178817384 21:35944219-35944241 CAGTGCCGGGCACTGTGATAAGG - Intronic
1179309787 21:40185423-40185445 CAGGCCTGGGCTCAGTGATTTGG - Intronic
1179502420 21:41818518-41818540 CTGTGCTGGCCTCTGAGGTGAGG + Intronic
1179510136 21:41867084-41867106 CTGTGCTGAGCTCTGAGATGTGG + Intronic
1179740898 21:43417608-43417630 CAGGCCTGGGCTCTGTGCAGGGG + Exonic
1179819074 21:43925900-43925922 CAGAGCTGGCCTCTCTGGTGTGG + Intronic
1179984239 21:44912263-44912285 CAGCGCTGGGTGCTGTGCTGTGG + Intronic
1180730202 22:17975691-17975713 CAGTGCTGGGTTCTGTTTTTTGG - Intronic
1180956804 22:19744878-19744900 CAGCCCTGGGCCCAGTGATGTGG + Intergenic
1181044141 22:20206723-20206745 CATGGGTGGGCTCTGAGATGTGG + Intergenic
1181630683 22:24149680-24149702 CAGTGATGTGCCCAGTGATGGGG - Intronic
1181689201 22:24549031-24549053 GAGTGGTGGGCTCTGCGCTGAGG - Intronic
1181810552 22:25401235-25401257 CAGTGTTGGCCTCTGAGAGGAGG - Intronic
1182477211 22:30582820-30582842 CAGTGCTGGGCTGTGGGAAATGG - Intronic
1182619243 22:31609733-31609755 CAGTGCTGGTTTCTGAGCTGAGG - Intronic
1183273762 22:36878284-36878306 AAGTCCTCGGCTGTGTGATGAGG + Intergenic
1183342581 22:37289880-37289902 AAGTGCTTGGGTATGTGATGAGG + Intronic
1183436896 22:37801613-37801635 CTGGGATGGGCTCTGTGATATGG - Intergenic
1183542982 22:38440649-38440671 CAGTGCCAGTCGCTGTGATGAGG + Intronic
1183911174 22:41080466-41080488 CAGTGCTGGGCGCAGAGAAGAGG + Intergenic
1183991696 22:41601213-41601235 GAGGGGTGGGCTCTGGGATGTGG + Intronic
1184374460 22:44102977-44102999 CTGTGCTGGGCCCTGGGATTCGG + Intronic
1185195572 22:49467335-49467357 CGGTGCTGGGCTCAGGGATCAGG - Intronic
950120815 3:10481455-10481477 CAGGGCAGGGCTCTCTGAGGAGG - Intronic
950183128 3:10928849-10928871 ACATGCTGGGCTCTGTGCTGGGG - Intronic
950587014 3:13900082-13900104 CACTGGTGGGCTCTGAGATATGG + Intergenic
951318624 3:21217869-21217891 CTGTGCTGGGTTATGTTATGGGG - Intergenic
952276386 3:31881220-31881242 CACTGCTGGGCGCTGTGGGGAGG - Intronic
952702936 3:36344837-36344859 CAGTCTTGGGCTGTGTGATGTGG + Intergenic
952746599 3:36787686-36787708 CTGTGGTGGGCTCTATGAGGGGG - Intergenic
952761185 3:36915564-36915586 CTATGCTGGGCACTGTGCTGGGG + Intronic
953875224 3:46662759-46662781 CAGTGCTGAGCACTCTGATCTGG - Intergenic
954400394 3:50316642-50316664 CTGTGCTGGGCTAGGTGCTGGGG - Intergenic
954876353 3:53805508-53805530 CCCTGCTGCACTCTGTGATGGGG + Intronic
955559664 3:60175114-60175136 CACTGCTGGGCTCTGTGGATAGG - Intronic
956695881 3:71919104-71919126 GAGAGCTGGGCTCTGTCCTGAGG - Intergenic
956765276 3:72479561-72479583 CAGGGCTGGGAACTGTGTTGTGG - Intergenic
959524038 3:107355979-107356001 CAGTGGTGGGCTCTGGCATTAGG + Intergenic
960940825 3:122932670-122932692 CAGTGGTGGGCTCTGGCATTAGG + Intronic
961375543 3:126463028-126463050 CAGGGCTGGGCACTGTGCTGGGG - Intronic
961393108 3:126568331-126568353 CAGGCCTGCGCTCTCTGATGAGG + Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961537594 3:127579400-127579422 CAGTGCTTGGCTCAGGGATGAGG + Intronic
962056102 3:131873380-131873402 CAAAGCTGGGCTCTGAGATTTGG + Intronic
966328269 3:178781661-178781683 GACTGCTGGGATCTGGGATGAGG + Intronic
966882513 3:184358301-184358323 CACTGCTGGGCTGTGGGAAGAGG + Exonic
967112163 3:186303622-186303644 CAGAGCTGGGCTTTGTGATCAGG + Intronic
967594912 3:191317185-191317207 CAGTGCGGCGCTCAGTGCTGGGG + Intronic
967785613 3:193490856-193490878 CAATGATGAGCTCAGTGATGGGG + Intronic
967874285 3:194256197-194256219 CTGTGCTGGGCTCCGTCCTGGGG + Intergenic
967883145 3:194315628-194315650 CAGTGATGTGCTCCGTGCTGGGG - Intergenic
968443146 4:634532-634554 CCCTGCTGGGCACTGGGATGTGG - Intronic
968808296 4:2788754-2788776 CAGTGCTGGGCTGTGTGGCCAGG + Intergenic
970193537 4:13535894-13535916 CGGCGCTGGGTTCTGTGCTGCGG - Intergenic
970864768 4:20745767-20745789 CAGTGCTGGCCACTATGCTGGGG + Intronic
972541560 4:40043603-40043625 CAGTGTTCGGCTCTGGGTTGAGG + Intergenic
972774583 4:42229345-42229367 CAGTGGTGTGATCTGTGATCTGG - Intergenic
973333693 4:48934813-48934835 GCATGCTGTGCTCTGTGATGAGG - Intergenic
973631635 4:52825626-52825648 CACTCCTGGGCTGTGTGATGTGG - Intergenic
978978475 4:114911406-114911428 CATGGCAGGCCTCTGTGATGAGG - Intronic
981889666 4:149719732-149719754 CAGTGATGGGTTGAGTGATGGGG - Intergenic
982009284 4:151091309-151091331 TAGTGCTAGGTACTGTGATGTGG - Intergenic
983216107 4:165004559-165004581 CAATGAAGAGCTCTGTGATGGGG - Intergenic
984083866 4:175284191-175284213 TACTGCTGGGCCCAGTGATGTGG + Intergenic
985494352 5:196433-196455 CCGTGGTGGGCGCTGTCATGAGG - Intergenic
985770791 5:1809376-1809398 CAGAGCGGGGCTTTGTGTTGTGG + Intronic
985997538 5:3605289-3605311 CAGTGCTGGGTCCTGTGGTGTGG - Intergenic
986001285 5:3633005-3633027 AGGTGCTGGGCCCGGTGATGGGG + Intergenic
986741562 5:10710022-10710044 GATTGCCAGGCTCTGTGATGAGG + Intronic
986980884 5:13447083-13447105 CAATGCTGGGATTTTTGATGGGG - Intergenic
987027377 5:13940891-13940913 AAGTGCTGTGCTCTGTGATATGG - Intronic
988714983 5:33816626-33816648 TAGTGCTGTGCTATGTGTTGAGG + Intronic
990672587 5:58149641-58149663 CAGGGCGGGGCTCTGTGAAGTGG - Intergenic
991580747 5:68152616-68152638 CCCTACTGGGCTCTGAGATGGGG - Intergenic
992861019 5:80909844-80909866 AAGTCCTGGCCACTGTGATGAGG + Intergenic
992867938 5:80976542-80976564 ATGTGCTGGGTTCTGTGCTGAGG + Intronic
993806180 5:92412762-92412784 CAGAGCTGGTGTCTGAGATGTGG - Intergenic
994030675 5:95138635-95138657 CAGTGGTGGTCTCTGTGAGGGGG - Intronic
994498228 5:100540341-100540363 CATTACTAAGCTCTGTGATGAGG + Intronic
996807707 5:127476006-127476028 CAGTGGGGGGCTCAGTCATGGGG - Intergenic
997378740 5:133420231-133420253 CAGTGCTTGCCTCTGTGAATGGG + Intronic
997428133 5:133818321-133818343 TGCAGCTGGGCTCTGTGATGGGG - Intergenic
997640517 5:135445759-135445781 CAGTGTGGGGCTCTGCCATGAGG - Exonic
997980932 5:138466997-138467019 CAGGGGTGGGCTCTGGGAGGCGG - Exonic
998150950 5:139757158-139757180 CCCTCCTGGGCTCTGGGATGGGG + Intergenic
998156096 5:139788097-139788119 CAGTGCTGGGCACTGGGACGCGG + Intergenic
999234503 5:150082317-150082339 CAATTCTGGGCTCTATGGTGGGG - Intronic
999476540 5:151904837-151904859 CAGATCTAGGCTTTGTGATGGGG + Intronic
1000234167 5:159342293-159342315 CAGGGGAGGGCTCTCTGATGAGG + Intergenic
1000822862 5:166006961-166006983 CAGCGTTGTGCTGTGTGATGGGG + Intergenic
1000894625 5:166840732-166840754 CAGTGCAGGACTCTCTGAGGAGG + Intergenic
1001081924 5:168673381-168673403 CATGGCTGGGCCCTGTGCTGTGG + Intronic
1002045769 5:176541111-176541133 CACTTCTGGGCTCTGTGGCGAGG - Intergenic
1004775227 6:18836694-18836716 CAGTGATGGGCTGTATAATGAGG + Intergenic
1005521723 6:26607474-26607496 AAGTACTGGGCTTTGAGATGTGG + Intergenic
1006400285 6:33813603-33813625 CAGTGCTAGGCTGTCGGATGGGG - Intergenic
1006440507 6:34050871-34050893 CTGTGTTGGGCTCAGTGAGGGGG - Intronic
1006731757 6:36241464-36241486 CAGTGCTGGCCTCAGTTTTGGGG + Intergenic
1006825978 6:36936793-36936815 CAGAGCTGGGATTTGTAATGAGG - Intergenic
1006988835 6:38195437-38195459 CAGGGCTGGGCGCTGAGAGGAGG + Intronic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1007925302 6:45645142-45645164 AGGTGCTGGTCTCTGTGAAGGGG + Intronic
1007953238 6:45891728-45891750 CAGTGGTGAGCTCTGGGAAGGGG + Intergenic
1008872769 6:56291306-56291328 CAGTGCTGGGGTGTTTGAAGGGG + Intronic
1011131100 6:84052441-84052463 CATTGCTGGGCTTGGTAATGGGG + Intronic
1014813155 6:125907405-125907427 CAGTGCTGTGCTCTGTGTTTGGG - Intronic
1015330215 6:131969066-131969088 CACTTATTGGCTCTGTGATGTGG - Intergenic
1015755568 6:136602639-136602661 AAGTGCTGGGCATTGTGCTGGGG + Intronic
1016408862 6:143760678-143760700 GGGTGCTTGGCTCTGGGATGGGG + Intronic
1017126533 6:151069723-151069745 CACCGCTGAGCTCTGAGATGAGG - Intronic
1017763111 6:157586175-157586197 CAGCCCTGGGCTCTGAGCTGGGG - Intronic
1019744862 7:2694001-2694023 GGGTGCTGGGCCCTGTGCTGGGG - Intronic
1019809952 7:3158037-3158059 CTGTGGTGGGGTCTGTGCTGGGG - Intronic
1020115415 7:5473398-5473420 CTGTCCTGGGCTCTGGGAAGAGG - Intronic
1021926022 7:25534611-25534633 CAGTGGTGGGCTCTGGGGGGAGG - Intergenic
1022124898 7:27346946-27346968 CAGTGCTGAGCTAAGTGGTGGGG - Intergenic
1023965157 7:44960306-44960328 TGCTGCTGGGCTCTCTGATGAGG + Intergenic
1024045251 7:45581255-45581277 CTGTTCTGGGCTCAGTGAAGTGG + Intronic
1025230845 7:57202465-57202487 CAGAGCTGGGCCCAGGGATGGGG - Intergenic
1026261329 7:68758437-68758459 CAGTTTTGGGCTCTGTAAGGTGG + Intergenic
1026304803 7:69131497-69131519 CTGTGTTGGGTTCTGTGATCTGG + Intergenic
1026586765 7:71661836-71661858 CTGTCCTGGGCTCTGTGGTGTGG - Intronic
1026677767 7:72442289-72442311 CAGCGCTGGGCTCTGAGCAGAGG - Intronic
1027221597 7:76217637-76217659 CAGTGGTGGGCTCTGACATTAGG - Intronic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1032742657 7:134754202-134754224 CTGTGCTGGGGCCTGAGATGTGG + Intronic
1034551543 7:151823721-151823743 CAGGGCTGGGCCCAGGGATGTGG + Intronic
1034762196 7:153683171-153683193 CACTGCTGGGCTGTGTAATTGGG - Intergenic
1035182250 7:157097808-157097830 AAGGGCTGGGCACTGTGATGAGG + Intergenic
1035578963 8:728018-728040 CAGGGCTGGGCCCTGGGACGGGG + Intronic
1035765543 8:2102009-2102031 GGGTGCTGGGCCCTGTGGTGGGG + Intronic
1035962653 8:4155019-4155041 CAGTGTTAGGTTCTGTGATGAGG - Intronic
1038782124 8:30577165-30577187 CCGTCGTGGGCTCTGTGATCAGG - Intergenic
1040728298 8:50410296-50410318 CAGTGAGTAGCTCTGTGATGTGG - Intronic
1040919461 8:52600131-52600153 CCTTGCAGGGCTGTGTGATGAGG - Intergenic
1041138112 8:54782649-54782671 CTGTGCTTGGCTGTGTGGTGTGG + Intergenic
1041348565 8:56926504-56926526 CATTGCTGGGATCTGTGCTCAGG + Intergenic
1043750216 8:83925730-83925752 CAGTGCCTGGCTCTGTGCTGTGG - Intergenic
1044016909 8:87056281-87056303 CACTGCTGGGCTGGGAGATGAGG + Intronic
1044927256 8:97219950-97219972 CAGTGATGGGGGCTGTGATGGGG - Intergenic
1044948075 8:97409642-97409664 AAGTGCTGGCCTCTGGGCTGTGG - Intergenic
1047204639 8:122793371-122793393 CAGTGCTGGGCTCTGTGGCTGGG - Intronic
1048964936 8:139608575-139608597 CAGGACAGGGCTCTGTGGTGGGG - Intronic
1048998790 8:139810923-139810945 AAGTGCTGGTCTCTGTGCTTGGG - Intronic
1049242784 8:141546902-141546924 CTGGGCTGGGATCTGGGATGTGG + Intergenic
1049625563 8:143618213-143618235 CAGGACTGGGCTCTGAGCTGAGG - Intergenic
1052049109 9:23824983-23825005 CTGTGCTGGGCGCTGGGAAGTGG - Intronic
1052280133 9:26723609-26723631 CTGTGCTGGGCTTTGTGATGGGG + Intergenic
1052653774 9:31331630-31331652 GAGGGCTGGCCTCTGGGATGAGG - Intergenic
1053293044 9:36894686-36894708 CTGTGCTGGGCCCTGTGCTAGGG - Intronic
1053562198 9:39208223-39208245 CAGTGCTGGATTCTGTGGTGAGG + Intronic
1053828005 9:42046224-42046246 CAGTGCTGGATTCTGTGGTGAGG + Intronic
1054134920 9:61410735-61410757 CAGTGCTGGATTCTGTGGTGAGG - Intergenic
1054602552 9:67141222-67141244 CAGTGCTGGATTCTGTGGTGAGG - Intergenic
1055064265 9:72102711-72102733 CTGGGCTGGGCTCAGTGAAGTGG - Intergenic
1055964203 9:81849650-81849672 CTGTGCTGGGCTCTGGGATGCGG + Intergenic
1057847652 9:98537988-98538010 CTGTGATGGGCCCTGTGCTGTGG - Intronic
1057883052 9:98807790-98807812 CCGGGCTGGGCTCGGTGCTGCGG + Exonic
1058649492 9:107161566-107161588 CAGGGATGGCCTCTGTGATAAGG + Intergenic
1058811569 9:108644582-108644604 AAGAGCCAGGCTCTGTGATGTGG + Intergenic
1059489268 9:114653709-114653731 CAATGCTAGGCTCTGTCAGGAGG - Intergenic
1060049293 9:120366022-120366044 CTGTGCTGGCCTCAGGGATGGGG + Intergenic
1060264110 9:122100344-122100366 CTGTGCTGGGCCCTGTGCTGGGG - Intergenic
1060795069 9:126507709-126507731 CAGAGCAGGGGTCTGGGATGTGG - Intergenic
1061164975 9:128916926-128916948 CCGGGCTGGGCTCTGCGGTGCGG + Exonic
1062127320 9:134870616-134870638 CAGGGCCGGGCTCTGTGCTCAGG - Intergenic
1062425364 9:136503724-136503746 CGGTGGTGGGCTGTGTGGTGAGG + Intronic
1062461728 9:136665236-136665258 CAGGCCTGGGCTCTGCCATGTGG + Intronic
1062695363 9:137873168-137873190 CAGTGATGACCTCTGAGATGCGG + Intergenic
1186494047 X:9997689-9997711 CAGCTCTGGGCTGTGTTATGAGG + Intergenic
1186500808 X:10048946-10048968 CAGTGCTGGGCTTTGCTGTGTGG + Intronic
1187266548 X:17738498-17738520 AAGTGCTGGGCGATGGGATGCGG + Intronic
1187306304 X:18098483-18098505 TGGTGCTTGGCTCTGTGCTGGGG - Intergenic
1187652255 X:21421804-21421826 CAGTCCAGGGTTCTGTGCTGGGG + Intronic
1188085233 X:25895212-25895234 CAGTCCTGGGCTCCCTGAGGTGG - Intergenic
1188414259 X:29913287-29913309 CAGTGCTTTGTTCTGTGAAGAGG - Intronic
1190641946 X:52488405-52488427 CAGTTCTGGGCTCAGTAGTGAGG - Intergenic
1190645726 X:52524461-52524483 CAGTTCTGGGCTCAGTAGTGAGG + Intergenic
1191761773 X:64654578-64654600 CAGGGCTGGTGTCTGGGATGAGG - Intergenic
1191813354 X:65216364-65216386 CAGTGTTGAGCTCTGTGACAGGG - Intergenic
1191969343 X:66796132-66796154 CAGTGCTGGGGTAAGTGATAGGG + Intergenic
1192221815 X:69202567-69202589 CACTGCTGAGCTCAGGGATGTGG + Intergenic
1192924405 X:75740568-75740590 CTGTGCAGGGCTCTTTGAGGTGG - Intergenic
1195094612 X:101492150-101492172 CAGTGGAGGGCTCTGGGCTGGGG + Exonic
1196685783 X:118509220-118509242 CTGTGCTGGGCTCAGTCATATGG - Intronic
1196705013 X:118709989-118710011 CAGGGAAGGCCTCTGTGATGAGG - Intergenic
1199239015 X:145525526-145525548 GAGGGATGGGCTCAGTGATGCGG - Intergenic
1199239735 X:145532347-145532369 CAGTGCTAGGCCCTCTGCTGGGG - Intergenic
1199899649 X:152160380-152160402 CAGTCCTGTGCTAAGTGATGGGG - Intergenic
1200047549 X:153410755-153410777 CGGGGCTGGGATATGTGATGTGG + Intergenic
1200235243 X:154464890-154464912 AGGGGCTGGGCTCTGTGGTGCGG + Intronic
1201474624 Y:14366976-14366998 AGGTTCTGGGCTTTGTGATGTGG - Intergenic