ID: 1085320515

View in Genome Browser
Species Human (GRCh38)
Location 11:75571242-75571264
Sequence CAGAATAATCAGATGCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085320515_1085320521 7 Left 1085320515 11:75571242-75571264 CCCCCCTGCATCTGATTATTCTG 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1085320521 11:75571272-75571294 TTCCAGGCATCCTATCACTCTGG 0: 1
1: 0
2: 0
3: 16
4: 153
1085320515_1085320523 12 Left 1085320515 11:75571242-75571264 CCCCCCTGCATCTGATTATTCTG 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1085320523 11:75571277-75571299 GGCATCCTATCACTCTGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 81
1085320515_1085320520 -9 Left 1085320515 11:75571242-75571264 CCCCCCTGCATCTGATTATTCTG 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1085320520 11:75571256-75571278 ATTATTCTGAAGCAAATTCCAGG 0: 2
1: 5
2: 26
3: 76
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085320515 Original CRISPR CAGAATAATCAGATGCAGGG GGG (reversed) Intronic
900546669 1:3233269-3233291 CAGCATTTTCAGAAGCAGGGTGG + Intronic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903756122 1:25662244-25662266 TTGAATAAGCAAATGCAGGGAGG + Intronic
904614785 1:31743852-31743874 AAGAATCAGCAAATGCAGGGAGG + Intronic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
905407495 1:37745090-37745112 TAGAATCATCAGAGGCAGCGTGG + Intronic
906097653 1:43235115-43235137 CAGAAAAATCAGATGAGGCGTGG - Intronic
906371192 1:45255306-45255328 CAGTCTAATCAGTTCCAGGGAGG + Intronic
908670862 1:66546047-66546069 CATAATAACCATATGCTGGGTGG - Intronic
909069256 1:70974701-70974723 AAAAATAATCAGCTGGAGGGTGG - Intronic
909962545 1:81864631-81864653 CAGAAAAATCAAATCCAAGGAGG - Intronic
910584923 1:88869033-88869055 CAGAATACACAGATACAGGCCGG - Intronic
911814759 1:102333144-102333166 CAGGATAGGAAGATGCAGGGTGG - Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
917456115 1:175187429-175187451 CATGATAATCACATGCAGAGGGG + Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921668071 1:217896273-217896295 CATAATAATAAAATGCAGAGAGG - Intergenic
924206570 1:241717999-241718021 AAGAAAACTCAGATGCAGAGAGG + Intronic
924424249 1:243936140-243936162 AAGTAGAATCAGATGCTGGGAGG + Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064738038 10:18403179-18403201 CATAAATAGCAGATGCAGGGAGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068580521 10:58734144-58734166 GAAGATAATCAGAGGCAGGGTGG - Intronic
1068872876 10:61964065-61964087 CTGGATAATCAGATGTAGTGGGG + Intronic
1070517680 10:77223571-77223593 CAGAAAACTCAGAAGCCGGGAGG + Intronic
1073985781 10:109207381-109207403 CAGAATAAACAACTTCAGGGAGG + Intergenic
1075662931 10:124210620-124210642 CAGAATTATCAAGTGCAGGAGGG + Intergenic
1077182814 11:1224112-1224134 CGGAAGAATCAGATGCAAGGAGG - Intronic
1078696342 11:13635946-13635968 GAGAAACATCAGATGCAGGAAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1082809846 11:57473238-57473260 CATAAAAATCAGATGCAGATGGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085468224 11:76738620-76738642 CAAAAGAATCAGAGGCAGAGAGG + Intergenic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1087625040 11:100586319-100586341 AAGTAGAATGAGATGCAGGGAGG + Intergenic
1088768380 11:113008277-113008299 CAGAATAATCACAGATAGGGGGG + Intronic
1090721082 11:129473823-129473845 CAGAATAATCAGGGAGAGGGAGG + Intergenic
1090985969 11:131766421-131766443 CAGCAAAATCAGATGCACCGAGG + Intronic
1092355665 12:7792965-7792987 CTGAATAAGCAGATCCATGGAGG - Exonic
1094391471 12:29955580-29955602 CAAAATAATCATAAGCAGGAAGG + Intergenic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1097080298 12:56425484-56425506 CAGAATAAGCAGATGCTATGAGG + Intronic
1097804654 12:63952145-63952167 CAGAATAGTGAGGTGCAGAGTGG - Intronic
1098465606 12:70783433-70783455 CAGAATGATCAGCTACAGAGAGG - Intronic
1100647429 12:96546028-96546050 CAAATTAATCAGACCCAGGGAGG + Intronic
1100962578 12:99979589-99979611 CAGAAGAATTAGATGCAAGAGGG + Intronic
1102402636 12:112643323-112643345 TAGGATAATAGGATGCAGGGAGG - Intronic
1102653904 12:114463807-114463829 CAGAAGAATCAAGTGGAGGGTGG - Intergenic
1102794046 12:115673109-115673131 CAGAACAAGCAAATGCAGGTCGG - Intergenic
1103863920 12:124036440-124036462 CACAACAATCGGCTGCAGGGTGG - Intronic
1104756114 12:131270331-131270353 CAGCATCATCAGATGAAGGCAGG + Intergenic
1104777662 12:131400694-131400716 CAGCATCATCAGATGAAGGCAGG - Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1108419229 13:50232075-50232097 CAGAACATTCAGAGGCAGGTAGG - Intronic
1111409632 13:87857621-87857643 GAGACTAATCAGATTAAGGGTGG + Intergenic
1112074393 13:95894186-95894208 CTGATTAATCAAATGTAGGGTGG - Intronic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1116295042 14:43096972-43096994 GTGAATAAGCAGATGCAGTGTGG + Intergenic
1117249463 14:53921962-53921984 AAGAATAATCAGATACATGGTGG - Intergenic
1119862208 14:77944379-77944401 CAGAATAATCTGATGGCAGGAGG + Intergenic
1125032300 15:35084922-35084944 CTGAATAAGCAGATCCATGGAGG + Intergenic
1125781399 15:42272549-42272571 GACAAAAACCAGATGCAGGGAGG - Intronic
1127655144 15:61048585-61048607 CAGAATAATCGGAAACAGGCTGG - Intronic
1127674760 15:61228772-61228794 CAGAAAAATCAAAGCCAGGGGGG + Intronic
1127765800 15:62184906-62184928 CAGAGTAATCAAATGTTGGGAGG - Intergenic
1127864448 15:63020449-63020471 CAGAACAACCATATGAAGGGGGG + Intergenic
1129383987 15:75185660-75185682 CAGAATAAGCAGATGCCTTGGGG - Intergenic
1131173537 15:90195385-90195407 CATAATAATCAAATGCAGCGAGG - Intronic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1132226243 15:100143970-100143992 CAGAATGACCAGGTGCTGGGTGG - Intronic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1138549478 16:57739786-57739808 CAGTATAATCAGATGGTGGTGGG - Intronic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140245383 16:73243812-73243834 CTGAATAATTAGATTCTGGGTGG - Intergenic
1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG + Intergenic
1140744732 16:77971536-77971558 CAGAATTATGTGCTGCAGGGTGG - Intronic
1141723227 16:85768459-85768481 CAGAACAATCAGATTCTGGGAGG + Intergenic
1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG + Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1164446143 19:28319089-28319111 CAGAATAAGCAGGCGCAGTGGGG + Intergenic
1165593998 19:36996408-36996430 CAGAGAAATCAGATGCCAGGTGG + Intronic
1167149274 19:47699462-47699484 CAGAAGAGTTAGATTCAGGGCGG + Intronic
926603864 2:14876855-14876877 CATAATCATCAGAAGCAGGCTGG - Intergenic
929968396 2:46552526-46552548 GAGAATATTCAGATGAAGGAGGG - Intronic
931046365 2:58358313-58358335 AAGGATAATCAGATGCAGATAGG - Intergenic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
934152704 2:89163657-89163679 CACAATAATTAAATGCAGTGTGG - Intergenic
934214537 2:90018277-90018299 CACAATAATTAAATGCAGTGTGG + Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
938312953 2:130306047-130306069 GAGAATACTGAGATGCAGAGAGG + Intergenic
939423448 2:142003640-142003662 CAGAGTAATGAAATGCAGGCAGG + Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
946530269 2:220563249-220563271 CAGAATAGTCAAATTCAGAGAGG + Intergenic
946554603 2:220841755-220841777 CAGATTATTCAGACCCAGGGAGG - Intergenic
948163450 2:235843647-235843669 CAGAGATCTCAGATGCAGGGCGG - Intronic
948494187 2:238335881-238335903 CAGAAGAATCACTTGCAGTGAGG - Intronic
948565776 2:238885109-238885131 CAGATTGTGCAGATGCAGGGAGG + Intronic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1170170462 20:13405486-13405508 CAGAATAATCACCAGCAGTGTGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1173562162 20:44013723-44013745 TAGAATAAGCAGCTGCAGGCAGG - Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1184455399 22:44607188-44607210 CAGAACAGTCAGGTGCAGGCAGG + Intergenic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG + Intronic
1184919751 22:47597401-47597423 CTGAACACTCAGATACAGGGAGG + Intergenic
954445627 3:50545301-50545323 CAGAAAAATCAAGTGAAGGGTGG - Intergenic
955365318 3:58305607-58305629 CAGAAGAATCACTTGAAGGGAGG + Intergenic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956409067 3:68960100-68960122 CAGAATAATCCAGTGCAGGAGGG + Intergenic
957579318 3:82050374-82050396 GAGAATAATTAGAAGCAGAGGGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
959187223 3:103059682-103059704 CAATATAATCAGATTCAGAGAGG - Intergenic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
963321928 3:143818394-143818416 GAGAATAATTTGATGCCGGGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
968295624 3:197574521-197574543 CAGAATAACTTGAAGCAGGGAGG + Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
970376780 4:15466658-15466680 TACAATAATCAGATGGAGAGTGG - Intergenic
970415843 4:15856159-15856181 TAGAATAATCAGATACAAGTTGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
973639032 4:52885414-52885436 CAAAATAATCTGGGGCAGGGTGG - Intronic
974493293 4:62594663-62594685 CAGAAGAATAAAATGCAGAGAGG - Intergenic
978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG + Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981561056 4:146048834-146048856 CAGAAGAGTCAGTTTCAGGGTGG - Intergenic
981745549 4:148049223-148049245 CAGAATCCTCAGCTCCAGGGTGG - Intronic
984150434 4:176123522-176123544 CAAACTAATCAAATGCAAGGAGG - Intronic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
986191350 5:5498880-5498902 CAGAATAACAAAATGCAGTGCGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986548760 5:8929101-8929123 CAGAAGAATCAAATCTAGGGTGG - Intergenic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991692536 5:69238856-69238878 CAGAATAACAAGTTGCAGGCTGG - Intronic
992234222 5:74692669-74692691 CAGAATAGTTAGCTGCAGGTAGG - Intronic
992970525 5:82052106-82052128 CAGAATGATCAACTGCAGGAAGG - Intronic
993082019 5:83313186-83313208 CAGAAGATTCAGAGGCAGGGTGG - Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
993728610 5:91396877-91396899 GAGATTGATCACATGCAGGGGGG - Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994214114 5:97117860-97117882 CAGAGTAGTGAGATGCGGGGTGG - Intronic
994392444 5:99203575-99203597 CAGAATATTCAGAGGAAGAGAGG - Intergenic
996149607 5:120019452-120019474 TAGAATAATCACAGGCAGGGAGG - Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
1000203870 5:159038465-159038487 AAAAAAAATCAAATGCAGGGTGG + Intronic
1001552363 5:172612201-172612223 CACACTCATCAGCTGCAGGGTGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003284262 6:4721131-4721153 CAGGATAACCATATGCAGGAAGG + Intronic
1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1008136241 6:47780444-47780466 CAGAATCATAAGATGAAGGTTGG - Intergenic
1008601202 6:53097151-53097173 CAGCATAATTATAGGCAGGGGGG - Intronic
1011544694 6:88470386-88470408 CAAATTAATCAAATGCAAGGAGG + Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013152966 6:107464247-107464269 CAGAATGACCAGGTGCTGGGTGG + Intergenic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1014222577 6:118812738-118812760 CAAAATAATAGGATGCATGGTGG + Intergenic
1014287432 6:119516476-119516498 CAGAAGGATCAAATACAGGGTGG - Intergenic
1015569736 6:134608480-134608502 CAGAATAGTCAGATGCCATGAGG - Intergenic
1018583064 6:165324500-165324522 CAGAAAAATGAAATGCAGAGCGG - Intergenic
1022312728 7:29212466-29212488 CTGAATAAGCAGATCCATGGAGG - Intronic
1022964919 7:35463871-35463893 GAGAAGCATCAGAAGCAGGGTGG - Intergenic
1027128382 7:75573259-75573281 TAGGATAATCAGCTGCAGAGAGG + Intronic
1027266434 7:76497528-76497550 CAGAAGAGTCAGAGGCAGCGAGG - Intronic
1029378202 7:100195071-100195093 CCGAATAACCACATGCAGAGGGG + Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030505689 7:110418887-110418909 CAAAGTAATCTGATACAGGGAGG - Intergenic
1037085556 8:14844906-14844928 CAGAGTTTTCAGATGCAGGGAGG + Intronic
1037314833 8:17591175-17591197 CAAAATAATCAGAAGCAGCCAGG - Intronic
1037721187 8:21445405-21445427 CAGAAAACTAAGATGCAGAGAGG + Intergenic
1038274637 8:26110377-26110399 CAGAAAAATAAAATGCAGAGAGG + Intergenic
1040407693 8:47122876-47122898 AAGAATAATCAAAGGCAGCGGGG - Intergenic
1043712790 8:83443439-83443461 CACAATTATCAGCTGCAGAGTGG + Intergenic
1046358059 8:113113946-113113968 CAGAATCATCATATACATGGAGG + Intronic
1046380734 8:113446526-113446548 AAGAATAATCCCATTCAGGGTGG - Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1048421680 8:134283954-134283976 CAGAATGATCAACTGCAGAGAGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1050493566 9:6215616-6215638 TAAAATATTCAGATGGAGGGAGG + Intergenic
1051894236 9:21971222-21971244 CAGAATGGTCAGAGCCAGGGTGG + Intronic
1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1057187536 9:93065299-93065321 TAGAATAATGAGATGCCTGGAGG - Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1185925666 X:4142868-4142890 AAGAAGAATGAGATGCAGTGGGG - Intergenic
1186315409 X:8364618-8364640 CAGAATAAGCAAATGCATGAAGG - Intergenic
1186674095 X:11797755-11797777 CAGAATAATCAAATACATAGAGG + Intergenic
1187269765 X:17769128-17769150 AAGATTCAACAGATGCAGGGAGG - Intergenic
1187527624 X:20068428-20068450 CAGAAGAAGCAGATGCTGTGTGG - Intronic
1187954027 X:24497925-24497947 CAGAAAAATGAGATCCAGAGAGG - Intronic
1189819070 X:44852640-44852662 CCTAATAATGAGATACAGGGAGG + Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG + Intergenic
1193900754 X:87173815-87173837 CAGAATAATCATGGGCAGTGTGG + Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic