ID: 1085322384

View in Genome Browser
Species Human (GRCh38)
Location 11:75583194-75583216
Sequence GGAGTCCCCGGTGGCTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085322384_1085322393 7 Left 1085322384 11:75583194-75583216 CCAGACCAGCCACCGGGGACTCC No data
Right 1085322393 11:75583224-75583246 CCTCGGCCCAGCTCCCGGAAAGG No data
1085322384_1085322399 21 Left 1085322384 11:75583194-75583216 CCAGACCAGCCACCGGGGACTCC No data
Right 1085322399 11:75583238-75583260 CCGGAAAGGGTCTCCCAGCCAGG No data
1085322384_1085322389 -10 Left 1085322384 11:75583194-75583216 CCAGACCAGCCACCGGGGACTCC No data
Right 1085322389 11:75583207-75583229 CGGGGACTCCAGAGAGGCCTCGG No data
1085322384_1085322394 8 Left 1085322384 11:75583194-75583216 CCAGACCAGCCACCGGGGACTCC No data
Right 1085322394 11:75583225-75583247 CTCGGCCCAGCTCCCGGAAAGGG No data
1085322384_1085322391 2 Left 1085322384 11:75583194-75583216 CCAGACCAGCCACCGGGGACTCC No data
Right 1085322391 11:75583219-75583241 AGAGGCCTCGGCCCAGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085322384 Original CRISPR GGAGTCCCCGGTGGCTGGTC TGG (reversed) Intergenic