ID: 1085322568

View in Genome Browser
Species Human (GRCh38)
Location 11:75583788-75583810
Sequence TCCTTCTTCCTCCCAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085322568_1085322585 25 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322585 11:75583836-75583858 AAGGGGACGCCGCGGGAGACTGG No data
1085322568_1085322583 17 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322583 11:75583828-75583850 AGGTGGGGAAGGGGACGCCGCGG No data
1085322568_1085322582 8 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322582 11:75583819-75583841 AGGAGGGAGAGGTGGGGAAGGGG No data
1085322568_1085322581 7 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322581 11:75583818-75583840 GAGGAGGGAGAGGTGGGGAAGGG No data
1085322568_1085322576 -3 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322576 11:75583808-75583830 GGAGAGGAGGGAGGAGGGAGAGG No data
1085322568_1085322580 6 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322580 11:75583817-75583839 GGAGGAGGGAGAGGTGGGGAAGG No data
1085322568_1085322578 1 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322578 11:75583812-75583834 AGGAGGGAGGAGGGAGAGGTGGG No data
1085322568_1085322577 0 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322577 11:75583811-75583833 GAGGAGGGAGGAGGGAGAGGTGG No data
1085322568_1085322575 -8 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322575 11:75583803-75583825 AAGAAGGAGAGGAGGGAGGAGGG 0: 2
1: 13
2: 290
3: 3187
4: 20352
1085322568_1085322574 -9 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322574 11:75583802-75583824 GAAGAAGGAGAGGAGGGAGGAGG No data
1085322568_1085322579 2 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322579 11:75583813-75583835 GGAGGGAGGAGGGAGAGGTGGGG No data
1085322568_1085322584 18 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG No data
1085322568_1085322586 26 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322586 11:75583837-75583859 AGGGGACGCCGCGGGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085322568 Original CRISPR TCCTTCTTCCTCCCAGCTGC GGG (reversed) Intergenic
No off target data available for this crispr