ID: 1085322584

View in Genome Browser
Species Human (GRCh38)
Location 11:75583829-75583851
Sequence GGTGGGGAAGGGGACGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085322569_1085322584 17 Left 1085322569 11:75583789-75583811 CCGCAGCTGGGAGGAAGAAGGAG No data
Right 1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG No data
1085322568_1085322584 18 Left 1085322568 11:75583788-75583810 CCCGCAGCTGGGAGGAAGAAGGA No data
Right 1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085322584 Original CRISPR GGTGGGGAAGGGGACGCCGC GGG Intergenic
No off target data available for this crispr