ID: 1085323972

View in Genome Browser
Species Human (GRCh38)
Location 11:75592639-75592661
Sequence GAGCAAGAATACATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085323972 Original CRISPR GAGCAAGAATACATGGAACA GGG (reversed) Intronic
900862911 1:5245760-5245782 GAGCAAGAAGACACTGAAGATGG + Intergenic
900946925 1:5836176-5836198 GAGAAATGAGACATGGAACAAGG + Intergenic
902068898 1:13714957-13714979 TACTATGAATACATGGAACATGG + Intronic
903018890 1:20379849-20379871 GAGCAGGATTACATGGAGCCTGG - Intergenic
903844728 1:26272074-26272096 GAGCAGGAATCCTTGGGACATGG + Intronic
904152498 1:28453913-28453935 GGAAAAGAATACATGGAACACGG + Intronic
904392331 1:30194345-30194367 GAGAAAGTATACTTGGAAGAAGG + Intergenic
906238542 1:44227270-44227292 GGGCAAGAGTCCATGGAACAGGG + Intronic
907018932 1:51046141-51046163 GAGGAAGAATACATGAAGCCAGG + Intergenic
908437923 1:64124986-64125008 AAGCAAGAGACCATGGAACATGG - Intronic
908844460 1:68310725-68310747 TAGCAAGAATTCATGGATCTGGG - Intergenic
911107982 1:94152362-94152384 GAGTGAGAAAACATGGACCATGG - Intronic
911642161 1:100301066-100301088 TCGCCAGAATACATGGATCAAGG - Intergenic
913015605 1:114731158-114731180 TATCAAGAGTACCTGGAACATGG + Intronic
913025866 1:114839576-114839598 GAGCAAGATAATATGGAGCAGGG - Intergenic
914926808 1:151895897-151895919 GAGCAAGAGTGCAAGGCACAAGG - Intronic
915659159 1:157388204-157388226 GAGAAAGAATCAATGGAATAAGG - Intergenic
916853190 1:168724827-168724849 GAGAAAGAATCTATGCAACAGGG - Intronic
917662978 1:177195860-177195882 GAGCAAAAAAACCTGGCACATGG + Intronic
917800187 1:178562976-178562998 AACCAAGAATAAAGGGAACAGGG - Intergenic
920281964 1:204850304-204850326 AAGGAAGAAAACATGGGACAAGG - Intronic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921508089 1:215998807-215998829 GAGAAAGAAAAGATGGACCACGG + Intronic
922015295 1:221639002-221639024 GATGAAGAATGCATAGAACAAGG + Intergenic
1063996746 10:11626899-11626921 AAGGAAGAATACATGAAATAAGG - Intergenic
1066280159 10:33909331-33909353 GAGCAAGGATAACTGAAACAAGG - Intergenic
1068335180 10:55626054-55626076 GAGAAAGAATACAAGTAACAAGG + Intronic
1068416524 10:56730964-56730986 GCACAAGGATACATAGAACATGG + Intergenic
1069205544 10:65679758-65679780 CAGCAAGCATACATGGCAAAAGG + Intergenic
1069445880 10:68472636-68472658 GAGGTAGAATAAATTGAACACGG + Intergenic
1070351436 10:75596424-75596446 TAGGAAGAAAACATGGACCAAGG - Intronic
1071044918 10:81361901-81361923 GCGCAAGAATATCTGGAACCCGG - Intergenic
1071921045 10:90350963-90350985 GGCCAAGAATAGATGGTACATGG - Intergenic
1072267458 10:93744376-93744398 TAGGAAGAAAACAGGGAACAAGG - Intergenic
1072502797 10:96035213-96035235 GTGAAAGGATACATGCAACATGG - Intergenic
1074419297 10:113294946-113294968 GGGAAATAATACATGGAACTTGG + Intergenic
1078154339 11:8785870-8785892 AAGCAAGAATACAAGTTACATGG + Intronic
1078302621 11:10148233-10148255 GAGAGAGAATACTTGGTACATGG + Intronic
1079546974 11:21644126-21644148 GAGCAAGAACACATCTTACATGG - Intergenic
1081550041 11:44102436-44102458 GAGCAAGGAGACAGGCAACAGGG - Intronic
1083097318 11:60264969-60264991 GAGCCAGAATGCATAGAACCTGG + Intergenic
1085323972 11:75592639-75592661 GAGCAAGAATACATGGAACAGGG - Intronic
1085493854 11:76948666-76948688 GACCTAGAATACATGATACAAGG - Intronic
1086437507 11:86796926-86796948 GAGCTAGAGAACATGGAAGAGGG - Intronic
1087321106 11:96659608-96659630 AATCAAGACTACATTGAACAAGG + Intergenic
1087492860 11:98849897-98849919 CAGCAAGAATGTAAGGAACAGGG + Intergenic
1088264540 11:107976750-107976772 CAGGAAGAATACATGGATCCAGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1091948090 12:4567265-4567287 AATCAAGAATACAAGAAACAAGG - Intronic
1095431712 12:42141777-42141799 GAGCCAGAATACTGAGAACACGG + Intronic
1099375160 12:81889891-81889913 TAGAAAAAATACATGGATCAAGG - Intergenic
1102805520 12:115776471-115776493 TAGCAGGAATACATGGGAAAGGG + Intergenic
1103116772 12:118341088-118341110 GAACAAGAATACCTTGAACCTGG - Intronic
1104059825 12:125258207-125258229 CAGCAATAGTACCTGGAACACGG - Intronic
1105897681 13:24730927-24730949 GAGCTAGCATATCTGGAACAGGG + Intergenic
1106889547 13:34228521-34228543 GAACCAGACTCCATGGAACAGGG + Intergenic
1107596472 13:41968050-41968072 GAGGATAAATACATGGATCAAGG - Intergenic
1108173858 13:47772596-47772618 GAGAAAGAATCAATGCAACAAGG - Intergenic
1110136822 13:72077841-72077863 GGGCAAGAAGACATAGAACTTGG + Intergenic
1110319127 13:74140539-74140561 TAGCAAGAACACAGGGAAAATGG - Intergenic
1111314105 13:86529297-86529319 GAGCCAGAAGAAATGGAATAAGG - Intergenic
1114911134 14:27199234-27199256 AAAAATGAATACATGGAACATGG - Intergenic
1115267897 14:31519991-31520013 CAGCAACAATACAAGGATCAAGG + Intronic
1116939962 14:50781564-50781586 GAGTAAGAATCCAGGGAAGAAGG - Intronic
1117196057 14:53341257-53341279 GAGCAAAAATACATGAGAGAGGG - Intergenic
1119409721 14:74423016-74423038 GAGGAAGAATAAATGCAACATGG - Intronic
1121577158 14:94997638-94997660 GAGAAAGAACACAGGCAACATGG - Intergenic
1121670802 14:95709547-95709569 GAGCAAGAGGACAGGGCACAGGG + Intergenic
1122841761 14:104468247-104468269 GAGCAGAAATCCAGGGAACATGG - Intergenic
1127317103 15:57807609-57807631 GGGCAAGACTACAGGGAACATGG - Intergenic
1127919668 15:63483679-63483701 GAGAATGAATACATGAATCATGG + Intergenic
1129515807 15:76156642-76156664 GAGCAAAAATACCTGCCACACGG - Exonic
1129635550 15:77312920-77312942 GAGCCAAAATACATTTAACATGG + Intronic
1129788441 15:78324264-78324286 GAGAAAGAATGTATGGAAGATGG + Intergenic
1129946349 15:79542359-79542381 GAGGAAGAATACAGGAACCAAGG + Intergenic
1132336000 15:101049099-101049121 AACCAAGAATAAATGGCACAGGG - Intronic
1134296112 16:12947215-12947237 AAGCAAGTATACCTGGAAAAAGG + Intronic
1139184987 16:64795279-64795301 GAACAAGAACAGATTGAACACGG - Intergenic
1139715522 16:68810138-68810160 GAGGAAGAAAACATGGGAGAAGG - Intronic
1145751717 17:27359948-27359970 GAGCAAGACTGCAAGGCACAGGG - Intergenic
1145827063 17:27885014-27885036 GAGCAAGAATCCAGGGAACCAGG - Intronic
1147831185 17:43299290-43299312 CAGCGAGAACACATGGGACACGG + Intergenic
1150735201 17:67730902-67730924 GAGCAAGAATGCAGGGAAACTGG - Intronic
1151837753 17:76594648-76594670 AAAGAAGAAAACATGGAACATGG - Intergenic
1154330694 18:13426825-13426847 GTTGAAGAATACAGGGAACATGG + Intronic
1156106198 18:33665014-33665036 CAGAAAGAAGACAGGGAACAAGG - Intronic
1156221195 18:35053972-35053994 GAGGAAAAATAAATGTAACAAGG + Intronic
1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG + Intergenic
1158888004 18:61847228-61847250 AAGCAAAAATACATCTAACAGGG + Intronic
1161908729 19:7176796-7176818 TATAAAGAATACATGGAACTGGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
925504229 2:4543111-4543133 GAGCAAAAATACATCTTACATGG - Intergenic
926599721 2:14829404-14829426 TATAAAGAATACATAGAACAAGG + Intergenic
926736477 2:16077293-16077315 GAGCAAGTATAAAAGGAATAGGG - Intergenic
926924508 2:17973572-17973594 GAGGAAAAATACATGGACCTGGG + Intronic
927995217 2:27480414-27480436 GAGCAAAAAAATATGGAACAAGG + Intronic
928531218 2:32193703-32193725 GAGCAACAGTAGATGGGACATGG + Intronic
928543935 2:32311394-32311416 GAGAAAGAATATAGGGAAGATGG + Exonic
930173880 2:48281408-48281430 GAGAAAGAATAAATGAATCATGG - Intergenic
930797878 2:55411875-55411897 GAGCAAGATTTCATGGTCCATGG - Intronic
932921726 2:75923381-75923403 AAGCAAGAACTCATGGAGCAAGG - Intergenic
933317479 2:80733228-80733250 AAGCAAAAATACATGGTACAGGG + Intergenic
934506188 2:94896642-94896664 GAGCAAGAATAAACAGAGCAGGG + Intergenic
935810276 2:106790824-106790846 TAACTAGAATACATGGATCAAGG - Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
937509176 2:122574246-122574268 TAGCAAATATGCATGGAACAAGG - Intergenic
937961877 2:127466335-127466357 GAGCAAGAATAGAAGTAGCAAGG - Intronic
939660433 2:144882221-144882243 GAACAATAAAACATGGAAAATGG + Intergenic
941530630 2:166666286-166666308 AAGCAAGTATACCTGGAAAAAGG + Intergenic
943214150 2:185009138-185009160 AAGCAAGAATACATATCACATGG + Intergenic
945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG + Intergenic
945531213 2:210955532-210955554 CAGCAAGAATAAATGGAAGTTGG - Intergenic
946457605 2:219840582-219840604 GAGCATGAAGACAAGGGACAGGG - Intergenic
946785187 2:223236118-223236140 GAGCAAGAAGGAATGGAAGATGG - Intergenic
946990725 2:225326577-225326599 CAGGAAGAATAAATGGAACTGGG + Intergenic
1171046999 20:21818224-21818246 GTGGAAAAATAAATGGAACAAGG + Intergenic
1171893716 20:30741682-30741704 GAGCAAGAATAAACAGAGCAGGG + Intergenic
1175355583 20:58364665-58364687 GAGCAAGAATTCAAGTATCAAGG + Exonic
1175493582 20:59396046-59396068 GAGCAAGGATGCATGGAATCTGG - Intergenic
1177354572 21:19991553-19991575 CAGCAAGACTACATGACACAAGG - Intergenic
1178619341 21:34160273-34160295 GAGCAAGAAAACAAAGACCAGGG - Intergenic
1180572852 22:16745253-16745275 GAGCAAGTATACAGAGAACTAGG + Intergenic
1181386718 22:22551092-22551114 GAGGAAACATACAGGGAACAAGG + Intronic
1182832616 22:33315948-33315970 GAGCAGGAAGAGATGGCACATGG - Intronic
1184953430 22:47862552-47862574 GAGGAAGAATGGATGGAGCAGGG + Intergenic
949204006 3:1416305-1416327 GAGCAAGAATACATTGTTGAGGG - Intergenic
950175458 3:10870334-10870356 GAGAAAGCATAAATGAAACATGG + Intronic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
952212940 3:31247557-31247579 GAAGAAGAATGCATGTAACATGG + Intergenic
952659716 3:35830934-35830956 GAGCAAGAACACATGTAAGGTGG + Intergenic
953051159 3:39345209-39345231 CAGGCAGAATACATGTAACAAGG + Intergenic
954210160 3:49092403-49092425 CAGCAGAAATACATGCAACATGG - Intronic
955208671 3:56920389-56920411 GAACAAGAACACAGGAAACATGG - Intronic
955419372 3:58721517-58721539 GGGCATTAATACATGCAACAGGG + Intronic
955786760 3:62549290-62549312 TAGCAAGAAGACATGGAAAAGGG + Intronic
957104840 3:75873662-75873684 GAGCAAGTATACAGAGAACTAGG - Intergenic
957887800 3:86312658-86312680 GAGCATGCATACATGGATCTGGG + Intergenic
958740487 3:98064548-98064570 GACCAAGAACACCAGGAACAGGG - Intergenic
959229350 3:103628634-103628656 GAGCAAGAATATGTGGCAGAAGG - Intergenic
959493770 3:107024229-107024251 GAGCAAGACTTCAAGAAACATGG + Intergenic
959799501 3:110474805-110474827 GAACAAGAAATCATGTAACAGGG + Intergenic
972023616 4:34347684-34347706 TAGCCAAAATACATGGAAAATGG + Intergenic
973724360 4:53759100-53759122 GAGCAGAAATAAATGAAACAGGG + Intronic
974703900 4:65486994-65487016 GAGCAGGAATACAAGAGACAGGG - Intronic
976508654 4:85881431-85881453 GAGGAAGAATAGATTGTACAGGG + Intronic
983061743 4:163168431-163168453 GTGCAAAAATACTTGGAAAATGG + Intergenic
983542611 4:168929157-168929179 AAGTAAGTATAAATGGAACAAGG + Intronic
985235353 4:187867050-187867072 CAGTAAGAATGCATGAAACAGGG + Intergenic
986837728 5:11659570-11659592 GAACAAGGAAACATGGAACAAGG + Intronic
987155109 5:15081446-15081468 GGGAAAGAAAACAGGGAACAGGG + Intergenic
987746260 5:21976380-21976402 GACCAAGAATAAATGAAAAATGG + Intronic
990151370 5:52821628-52821650 GAGGAAGAATACAAGGAGAATGG - Intronic
991766467 5:69986493-69986515 GACCAAGAATAAATGAAAAATGG + Intergenic
991780847 5:70131612-70131634 GACCAAGAATAAATGAAAAATGG - Intergenic
991845700 5:70861578-70861600 GACCAAGAATAAATGAAAAATGG + Intergenic
991873293 5:71131925-71131947 GACCAAGAATAAATGAAAAATGG - Intergenic
991972375 5:72153464-72153486 GAGTAAGACTATATGGAAGATGG - Intronic
994509219 5:100683104-100683126 AAGGAAGAATACATGAAAGAAGG - Intergenic
995469256 5:112483299-112483321 GAGCAAAAATAGATGAAACCTGG - Intergenic
998726166 5:145017186-145017208 AGGAAAGAAGACATGGAACATGG + Intergenic
999377335 5:151095907-151095929 GAGCGAGAAAACAGGGAAAAGGG - Intergenic
999639521 5:153658216-153658238 GAACAAGAATACACAGAACAAGG + Intronic
999842182 5:155439712-155439734 GAGCAAGAATACAATGAAGGGGG + Intergenic
1000877648 5:166660756-166660778 CAGCATGAATACCAGGAACAGGG + Intergenic
1004966455 6:20857331-20857353 GAGAAAGAATTGATGAAACAAGG + Intronic
1005664709 6:28040409-28040431 GACCTAGAATGCATGGGACATGG + Intergenic
1005742582 6:28806098-28806120 GAGCCAGAGAACATGGAGCATGG + Intergenic
1006450756 6:34104511-34104533 GCCCAAGAATACATGGAAACAGG + Intronic
1006485205 6:34334341-34334363 GAGCAAGAAAAAATGGGACCAGG + Intronic
1006682527 6:35807387-35807409 GAGCAAGACCACTTGGCACAAGG - Intronic
1007584380 6:42979789-42979811 GGGCAAGAAGTCCTGGAACATGG - Intergenic
1008665090 6:53708239-53708261 CAGCAGGAAGTCATGGAACATGG - Intergenic
1009663515 6:66646881-66646903 GAGCAAGAATCCATGAAAGCTGG + Intergenic
1011466386 6:87661607-87661629 GAGAAAGGATACTTGGAAGAAGG + Intronic
1013436577 6:110116033-110116055 GAGAAAGAAGACATAGAAGAGGG + Intronic
1013662191 6:112308999-112309021 GACTAAGAAAACATGGAATAGGG + Intergenic
1014899292 6:126943672-126943694 GGGAAAGAATACAGGGAAAATGG + Intergenic
1015490530 6:133820196-133820218 GAGCAAGGTTACATGTAACAAGG - Intergenic
1015660925 6:135572461-135572483 GAGGACGAATACATGGATCTGGG + Intergenic
1019189125 6:170240011-170240033 CAGCAAGCATGCAGGGAACAAGG - Intergenic
1019982325 7:4630552-4630574 AAGCTGGAATTCATGGAACATGG - Intergenic
1020933035 7:14424351-14424373 GAGGAAGAATATTTTGAACAGGG - Intronic
1021906596 7:25339835-25339857 CAGCAAAAATACTAGGAACATGG - Intergenic
1022468873 7:30669548-30669570 GAGACAGAATCCATGGAACTTGG - Intronic
1023741714 7:43287172-43287194 GAGAAATAATACAGGGAATAGGG + Intronic
1024337787 7:48226706-48226728 GTGCAAAAATAGAAGGAACATGG - Intronic
1026019042 7:66694107-66694129 GAGCAAGAATTTACCGAACAAGG - Intronic
1028218806 7:88169390-88169412 GTGGAAGACTACATGGTACAGGG - Intronic
1028667139 7:93359518-93359540 TGGCAAGAGTACATGGAAAATGG - Intronic
1028684936 7:93581453-93581475 GAGCAGGAATACAGAGGACATGG - Intergenic
1029326919 7:99817763-99817785 GGGCAAGGAGACATGGAACGTGG + Intergenic
1030478075 7:110062867-110062889 CAGTAAAAATACATGGAGCAAGG - Intergenic
1030485177 7:110156502-110156524 GAGCAGTAATTCATGGAACTGGG + Intergenic
1030506801 7:110434717-110434739 GAGGAAGAATTCAGTGAACACGG + Intergenic
1031153857 7:118086127-118086149 GAGGAAGAAAACATGGGATAGGG - Intergenic
1033002562 7:137523138-137523160 AAGAAAGAATACATGAAAGAAGG + Intronic
1033393043 7:140947114-140947136 GAGCAAGAATATGGGGAAAATGG + Intergenic
1033965190 7:146966641-146966663 GAGCAAGTATATATGGAGGATGG + Intronic
1035130932 7:156652407-156652429 TAGAAAGAAAACATGGAAAATGG - Intronic
1037672496 8:21027372-21027394 GAGAAAGAATCGATAGAACATGG + Intergenic
1038523601 8:28254582-28254604 GAGGTAAAATACATGGAACTTGG - Intergenic
1039976024 8:42365796-42365818 TAGCAAGAATACAAGGTAAAAGG + Intronic
1041379004 8:57232773-57232795 GAGCAGGAATACATATAGCAAGG - Intergenic
1041672543 8:60506577-60506599 GAGGAAGTATACGTGTAACATGG - Intergenic
1042328878 8:67556944-67556966 GGGCAAGAAGACATGGAAAGAGG - Intronic
1044880899 8:96721152-96721174 GAGGAAGAAACCATGCAACATGG - Intronic
1046061578 8:109145819-109145841 GAACAAGAATAAATGATACATGG - Intergenic
1046360524 8:113147956-113147978 GACCAAGAATACAGGGAACTAGG - Intronic
1046893765 8:119450809-119450831 CAGGGAGAATACATGGAGCAAGG - Intergenic
1047706227 8:127502450-127502472 GAGCAACAATGTATGGAACGAGG + Intergenic
1047882007 8:129205242-129205264 GAGCAAGAATATATGCCAGAAGG + Intergenic
1053120070 9:35539667-35539689 GAGTAAGAAAACATTGACCAGGG + Intronic
1054354916 9:64051014-64051036 GAGCAAGAATAAACAGAGCAAGG - Intergenic
1058780520 9:108329573-108329595 AAAAAAGAATAAATGGAACATGG + Intergenic
1058817489 9:108698499-108698521 GAGCAAGAGAAAATGGAAAAGGG + Intergenic
1060463272 9:123878811-123878833 GAGCATGAATAAAAGGAAAAAGG + Intronic
1060620501 9:125061326-125061348 GAGCAAGAATAAATGTAACATGG - Intronic
1186020059 X:5245092-5245114 GAGAAAGAAGAAATGGAAGAAGG - Intergenic
1187063372 X:15809492-15809514 GAACAAGGATAGAGGGAACAGGG - Intronic
1187653723 X:21444016-21444038 GAGCAGGAATACATTTAAAAAGG - Intronic
1187771602 X:22704796-22704818 GAGGAAGAATACATGGGAACTGG - Intergenic
1187819622 X:23273139-23273161 GAGCAAGAATACACAGATCTAGG + Intergenic
1189831631 X:44980298-44980320 GAAAAAGAATACAGGGAACTTGG - Intronic
1191773998 X:64792911-64792933 GGGCAAGAATACTTGCAGCAAGG + Intergenic
1192857710 X:75031432-75031454 CAACAAGAACACATGGACCAGGG - Intergenic
1194720335 X:97333535-97333557 GAAGTAGAATCCATGGAACATGG - Intronic
1194988970 X:100524054-100524076 GAGCAAGAGTTTATGGAAAAGGG + Intergenic
1196036944 X:111155824-111155846 GAGCAAGGAAACAAGGAATATGG + Intronic
1199901945 X:152183542-152183564 GAGCAGAAATACATGAAATAGGG - Intronic
1200358691 X:155578748-155578770 GAGCCAGAATACATGGCTCTGGG + Intronic
1201156785 Y:11137611-11137633 GAGCAAGAATAAACAGAGCAAGG - Intergenic
1201899977 Y:19039039-19039061 TAACAGGAATACACGGAACATGG + Intergenic