ID: 1085325592

View in Genome Browser
Species Human (GRCh38)
Location 11:75604098-75604120
Sequence GTGAGGAAGGAGAAGTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 561}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085325592_1085325599 15 Left 1085325592 11:75604098-75604120 CCTTCATACTTCTCCTTCCTCAC 0: 1
1: 0
2: 5
3: 57
4: 561
Right 1085325599 11:75604136-75604158 GATAGAAAGGAAGGTCGCAGTGG 0: 1
1: 0
2: 2
3: 23
4: 216
1085325592_1085325595 2 Left 1085325592 11:75604098-75604120 CCTTCATACTTCTCCTTCCTCAC 0: 1
1: 0
2: 5
3: 57
4: 561
Right 1085325595 11:75604123-75604145 TTTTAAACCCTGAGATAGAAAGG 0: 1
1: 0
2: 0
3: 36
4: 271
1085325592_1085325600 16 Left 1085325592 11:75604098-75604120 CCTTCATACTTCTCCTTCCTCAC 0: 1
1: 0
2: 5
3: 57
4: 561
Right 1085325600 11:75604137-75604159 ATAGAAAGGAAGGTCGCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1085325592_1085325596 6 Left 1085325592 11:75604098-75604120 CCTTCATACTTCTCCTTCCTCAC 0: 1
1: 0
2: 5
3: 57
4: 561
Right 1085325596 11:75604127-75604149 AAACCCTGAGATAGAAAGGAAGG 0: 1
1: 0
2: 1
3: 35
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085325592 Original CRISPR GTGAGGAAGGAGAAGTATGA AGG (reversed) Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900791519 1:4684002-4684024 GGGAGGAAGGAGATGGAGGAAGG + Intronic
900861263 1:5234094-5234116 GTGTGAAAGGAGAAGTGTCAAGG - Intergenic
901227039 1:7619496-7619518 ATGAGGTAAGAGAAGTGTGAAGG - Intronic
901400325 1:9011189-9011211 GTCAGGAAGCAGAGGCATGAAGG - Intronic
901507605 1:9695314-9695336 CGGAGGAAGGAAAAGTATGTAGG + Intronic
901824497 1:11851891-11851913 CTGAGGCAGGAGAATCATGAAGG + Intergenic
902276482 1:15343507-15343529 GTGAGGATGGAGATGAAAGAGGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903901932 1:26653224-26653246 GGAAGGAAGGAGAAATAGGAAGG - Intergenic
903957399 1:27034774-27034796 GTCAGGAAGGAGAAGAAGAAGGG - Intergenic
904228296 1:29043625-29043647 GTGAGGTCGGAGAAGTAGGTGGG + Intronic
904412046 1:30330437-30330459 GAGAGGAAGGAGAGGAAGGAGGG - Intergenic
904599661 1:31666461-31666483 GAGAGGGAGGAGAAGTGGGAAGG - Intronic
904730658 1:32588542-32588564 GTGAGGTAGGAGAGCCATGAAGG + Intronic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905150057 1:35920263-35920285 GTCAGGGAGGAGAAGTAAGGTGG - Exonic
905856788 1:41319821-41319843 ATGAGGAGGGGGAGGTATGAAGG - Intergenic
905860089 1:41344571-41344593 GTCAGGAAGGAGAAGTAAGCTGG - Intergenic
905945829 1:41900836-41900858 GTGAGGCTGGAGAAGTAGGCAGG + Intronic
906188368 1:43879251-43879273 GTGAGGAAGGAGGAGGATCTGGG + Intronic
906566736 1:46806267-46806289 GTGAGGGAGGAGAAAGACGAAGG - Intronic
906661347 1:47584811-47584833 GTGAGGAAGTAGACCTATGTAGG - Intergenic
906805044 1:48772544-48772566 GTGAGGCTGGAGAAGTAAGGTGG + Intronic
907165087 1:52403667-52403689 GTTAGAAAAGAGAAGTAGGAAGG + Intronic
907509322 1:54946545-54946567 GTGAGGGTGGGGAAGAATGAAGG - Intergenic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
909155711 1:72073059-72073081 GTGAGGGAGGAAAAGGATGCAGG + Intronic
909584453 1:77273968-77273990 GTGGGGAAGTAGAAGTAGCAAGG + Intergenic
910359434 1:86400404-86400426 GGGAGGATGGAGAGGCATGAGGG - Intergenic
911694253 1:100870676-100870698 GTGATGGAGGATGAGTATGAAGG - Intergenic
912205922 1:107509681-107509703 GGCAGCAAGGAGAAGAATGAGGG - Intergenic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
913045752 1:115072333-115072355 GGGAGGAGAGAGAAGAATGAGGG - Intronic
913268972 1:117074148-117074170 GTGAGGAACTAGAAGTAGGGAGG + Intronic
913485562 1:119329888-119329910 GTGATTTAGGAGAAGTGTGAAGG + Intergenic
914260699 1:145996809-145996831 GAGAGGAAGGAGAGGAAGGAGGG + Intergenic
915058976 1:153163958-153163980 GTGAGGACTGAGAAATATGAGGG - Intergenic
915062078 1:153194590-153194612 CTGAGGAAGGAAAAGTTTGGAGG - Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915715066 1:157937657-157937679 GTGAGGAATGAGAGGGGTGATGG + Intergenic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916996049 1:170302414-170302436 GTGAGGAAGGAGAAGACAGGTGG - Intergenic
917223840 1:172760765-172760787 GTGAGGAAGGAGAGCCATCAAGG + Intergenic
917626394 1:176850795-176850817 GTGAGGTCAGAGAAGTATGGAGG + Intergenic
917983504 1:180290633-180290655 GGGAGGAAGGAGGAGACTGAGGG + Intronic
918522231 1:185427434-185427456 GGGAGGAAGGAACAGCATGAGGG - Intergenic
919072847 1:192777742-192777764 GTGATGTAAGAGAAGCATGATGG - Intergenic
919171207 1:193956644-193956666 GTGTGGCAGGAAAACTATGATGG + Intergenic
920062077 1:203233884-203233906 GTGAGGAAAGGGAAGGATCAAGG - Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920217564 1:204371960-204371982 TTAAGGAAGGGGAAGCATGAAGG + Intronic
920663002 1:207933995-207934017 GATGGGAAGCAGAAGTATGATGG + Intergenic
921757010 1:218869431-218869453 GTGGGGAACTAGAAATATGATGG - Intergenic
922014526 1:221631599-221631621 GGGAGGAAGCAGGAGTGTGAAGG - Intergenic
922040252 1:221889318-221889340 ATGAGGAAGGTGAAGAATGGTGG + Intergenic
922418426 1:225442921-225442943 GTAAGGAAGAAGAAGAATGGAGG + Intergenic
923191365 1:231623711-231623733 ATGAGTAAGGTCAAGTATGAGGG + Intronic
923247569 1:232147412-232147434 GGGAAGAAGGAAAAGAATGAAGG + Intergenic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923984296 1:239363391-239363413 CTGAGGTGGGAGAAGTATTAAGG + Intergenic
924141425 1:241027730-241027752 GTTGAGAAGGAGAAGTATGGAGG + Intronic
924330321 1:242935031-242935053 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
924419755 1:243897091-243897113 GTAAGGGAGGAGAAGTTTTAAGG + Intergenic
924539110 1:244964390-244964412 GGAAGGAAAGAGAAGTATGAAGG + Intergenic
1063654099 10:7969897-7969919 GGGAGGAAGGAGACGGAGGAAGG - Intronic
1064348453 10:14554494-14554516 GGGAGGCAGGAGAGGGATGAAGG + Intronic
1065623822 10:27610644-27610666 GGGAAGAAGGAGAAGAAAGAAGG - Intergenic
1065710316 10:28510344-28510366 ATGAGGAAGAAGAAGAATGTGGG - Intergenic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1067659406 10:48223291-48223313 GTGTGGAAGGAGAAGCAGTAGGG + Intronic
1067672911 10:48342039-48342061 ATGTGGCAGGAGAAGTATGCAGG + Intronic
1068275452 10:54790094-54790116 ATGGGGAAGGAGAAGTCTTATGG - Intronic
1069067414 10:63958100-63958122 GAGAGTAACAAGAAGTATGAGGG - Intergenic
1069245719 10:66202759-66202781 GAGAGGAAAGAGAAGTAGTATGG - Intronic
1069279440 10:66636458-66636480 GGGAGGAGGGAGGAGTAAGAAGG + Intronic
1069753338 10:70758933-70758955 GTGAGGAAGGAAAAGAGAGATGG - Intronic
1069784199 10:70977505-70977527 GTGGGGAAGGAGAAGCAGGTGGG + Intergenic
1070151745 10:73809489-73809511 GTTAGGAAGGAGAAGTAGAGTGG - Intronic
1070252801 10:74787735-74787757 GTGAGGAAGGAGAACAAGGAAGG + Intergenic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1071121247 10:82281507-82281529 GTGAGGATGGAGAGGAATGTGGG + Intronic
1071249744 10:83805159-83805181 TTAATGAAGGAGAAGTATCACGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG + Intronic
1074737012 10:116445957-116445979 GGGAAGAAGGAGAAGAATGAAGG + Intronic
1075291979 10:121238495-121238517 ATGAGGAAGGAGAAGCATAAAGG - Intergenic
1075497626 10:122939433-122939455 GTGAGAAAGGAGAATAATAAGGG + Intronic
1075791663 10:125088772-125088794 GTGAGAAGTGGGAAGTATGAAGG - Intronic
1077294816 11:1821305-1821327 GGGAGGGAGGAGAAGAAGGAGGG + Intergenic
1077757383 11:5047288-5047310 GTAAGGAAAGAGAAGACTGAAGG - Exonic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1078195166 11:9131138-9131160 GTAAGGAAGAAGAGGTATTAAGG - Intronic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078848573 11:15143397-15143419 CAGAGGAAGGAGTACTATGAAGG + Intronic
1079101980 11:17547557-17547579 GGGAGGAAAGAGAGGTTTGAGGG + Intronic
1080237905 11:30092884-30092906 GGAAGGAAGGAGAAGGAGGAAGG - Intergenic
1080930400 11:36804202-36804224 GTGAGGAAGGAGGAAGTTGATGG + Intergenic
1083556906 11:63636842-63636864 GTGGGGAAGGAGAAAAATGAAGG - Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083617614 11:64034494-64034516 GTGAGGAGGGAGAGGCAGGAAGG + Intronic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084697804 11:70766427-70766449 GGGAGGAAGGAGAAGTCAGAGGG + Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085190242 11:74614372-74614394 TTGGGGATGGAGAAGTATGAAGG + Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085596910 11:77819779-77819801 GAGAGGAAGGAGAACTATGGAGG + Intronic
1086571603 11:88291330-88291352 GGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1086571613 11:88291385-88291407 GGAAGGAAGGAGAAGGAAGAAGG + Intergenic
1086758378 11:90594219-90594241 GTGAGGCAGGAAAAGTCTGGGGG + Intergenic
1086875243 11:92087928-92087950 GTGAGGAGGGAGAGGAAAGATGG - Intergenic
1087131735 11:94674566-94674588 TTGATGAAGGAGAAGAATAAAGG + Intergenic
1087269532 11:96097426-96097448 GGGAGAAAGGAGAAGTATTAGGG + Intronic
1087955756 11:104285995-104286017 GTGAGGAAAGAGAAAAAAGAAGG + Intergenic
1088047982 11:105476838-105476860 ATGAGGAAGGGGAAATCTGAAGG - Intergenic
1088336116 11:108705916-108705938 GTGAGGGAAGAGAAGTAACATGG + Intronic
1089195277 11:116690764-116690786 GGCAGGAAGGAGAAGAATGAGGG + Intergenic
1089662859 11:119996858-119996880 GCCAAGAAAGAGAAGTATGAAGG - Intergenic
1089681995 11:120123777-120123799 GTGATGAAGATGAAGAATGAGGG - Intronic
1090274350 11:125409172-125409194 GTGAGGAAGGAATAGGATGTGGG - Intronic
1090355949 11:126140454-126140476 GTAAGGCAGGGGAAATATGAAGG + Intergenic
1090861429 11:130656205-130656227 GTGACAAAGGAAAAGTAGGAGGG + Intergenic
1090990193 11:131810286-131810308 GGGAGTAAGAAGAAATATGAGGG - Intronic
1091030601 11:132184203-132184225 GTGAGGAGGCAGAAGTGTCAGGG - Intronic
1091083468 11:132695392-132695414 GGGAGGCAGGAGCAGTATTATGG + Intronic
1091397268 12:161698-161720 GTGAGGCAGGAGATGTGTGTTGG + Intronic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1091983817 12:4890752-4890774 GAGAGGAAGGGGAGGTATAATGG + Intergenic
1092951804 12:13510556-13510578 GTGAGGAAAGAGAAGGATCAGGG + Intergenic
1093011241 12:14109644-14109666 GTGAGGATGGAGAAGTGGCAGGG - Intergenic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093326009 12:17774764-17774786 GTGAGCAAGGAGAAGAATCATGG - Intergenic
1093658225 12:21722327-21722349 GAGAGGAAGGAGAAGCACGATGG - Intronic
1093973511 12:25396428-25396450 ATGAGGAAGCATAAGTTTGAAGG + Intergenic
1094019666 12:25900907-25900929 GAAAGGAAGGAGAAGAATGGCGG + Intergenic
1094180847 12:27591169-27591191 GAGAGGAAGGAGAGGGATAAGGG + Intronic
1094229968 12:28091798-28091820 GTGAGGAAAGAGAACTAGAATGG + Intergenic
1094827081 12:34277838-34277860 GTGAGGGAGGAGGAGAAGGATGG - Intergenic
1095775855 12:46009265-46009287 TTGAGGAGGGAGAAGTCGGAAGG + Intergenic
1096556083 12:52404857-52404879 GTGAGGAAGGGGAGGAATGACGG - Intronic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098249153 12:68550829-68550851 GTGAGGAAGGGGGAGAGTGAGGG - Intergenic
1098597161 12:72287188-72287210 ATGAGGAAGAACAAGGATGATGG - Intronic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1099945079 12:89234784-89234806 GTGAGGACAGAGGAGAATGATGG + Intergenic
1100943182 12:99747386-99747408 GTCAGGAAGGAAACTTATGAAGG - Intronic
1100951932 12:99860410-99860432 GGGAGGAAGGTGGAGTTTGATGG + Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101433118 12:104643391-104643413 ATGAGGAAGCAGAAGTTTGGAGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102598745 12:114012888-114012910 GGGAGGAGGGAGAAGGAGGAGGG + Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102732134 12:115121037-115121059 GTGAGGAAGGAAAAGAGGGAGGG - Intergenic
1103052291 12:117790759-117790781 GGGAGGAAGGAGATTTATCAAGG - Intronic
1103341093 12:120221559-120221581 GTAAGGGAGGAGAAGGATGAGGG + Intronic
1103859728 12:124002719-124002741 ATGAGGAAGGAACAGTTTGAGGG + Intronic
1104456019 12:128913132-128913154 GGGAGGAAGGAGGAGTATGAAGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106088117 13:26561106-26561128 GTGAGGGAGGAGAAGTAAGGAGG + Intronic
1106111557 13:26782011-26782033 GGGAGGAGGGAGGAGTATGGAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1107152712 13:37130332-37130354 ATAAGGAAGGAGAAGTATGATGG - Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1108697811 13:52918171-52918193 GTAAGGGAAGAGTAGTATGAGGG + Intergenic
1108997908 13:56758744-56758766 ATGAGGAAGAAGAAATATAATGG - Intergenic
1110560837 13:76909364-76909386 GTGAGACAGCAGAATTATGAGGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111663021 13:91234853-91234875 GTGAGGAAGGGCCAGTAAGAGGG + Intergenic
1111909734 13:94297485-94297507 GTGAGGAAGGAGGAGTTACAAGG - Intronic
1112066479 13:95798590-95798612 GTGAGGAAGAGGAAACATGATGG - Intergenic
1112090395 13:96077272-96077294 GTGAGGAAGAAGAATTGTCAGGG + Intergenic
1112817685 13:103292085-103292107 GTGAGGAAGGAGGAGTCTGCTGG + Intergenic
1113043168 13:106126124-106126146 TGGAGGAAGGAGATATATGAAGG - Intergenic
1113322193 13:109244895-109244917 GTGAGTAAGGAGAAGAATGTTGG + Intergenic
1115082109 14:29467193-29467215 GTGAGAAAGGAGAATACTGATGG - Intergenic
1115091143 14:29577356-29577378 CTGAGGTGGGAGAAGTATGCAGG - Exonic
1115353795 14:32425617-32425639 GGAAGGAAGGAGAGGAATGAAGG + Intronic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1116696094 14:48180542-48180564 GAGAGGAAGGAAAAGGAAGAAGG - Intergenic
1117079020 14:52132585-52132607 GTGAGGAAGTGGAGGTCTGAGGG + Intergenic
1117140101 14:52781212-52781234 GTAAGCAAGGAGTAGAATGATGG - Intronic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1118998016 14:70854891-70854913 ATGAGGATTGAGAAGGATGATGG + Intergenic
1119726167 14:76922953-76922975 GGGAGAAAGGAGAAATAGGAGGG - Intergenic
1120178910 14:81323687-81323709 TTGAGGAAGAAAAAGTGTGAAGG - Intronic
1120774447 14:88418135-88418157 ATGATGAAGAAGAAGAATGAAGG - Intronic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122201850 14:100127629-100127651 GTGAGGAAGGAGGAAAAGGATGG - Intronic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1124213117 15:27780302-27780324 GGGAGGGAGGTGAAGAATGATGG - Intronic
1124252635 15:28117038-28117060 GTGAGGAAGGAGGAGGCTGTCGG + Exonic
1124259733 15:28178100-28178122 GTAAGGAAGGGGGAGAATGAGGG - Intronic
1124702786 15:31931284-31931306 GGGAGGAAGGAGAATGAGGATGG + Intergenic
1124708611 15:31986055-31986077 GAGAGGAGGGACAGGTATGATGG + Intergenic
1124810854 15:32936686-32936708 GGAAGGAAGGAGAAGAAAGAAGG + Intronic
1125072441 15:35571928-35571950 GTGAGGAAGGTGAAGCAACAGGG - Intergenic
1125147698 15:36491407-36491429 GTAAGGAAGAAGGAGAATGAGGG + Intergenic
1125766077 15:42137438-42137460 GGGAGGAAGGAAAAGCAAGAAGG + Intergenic
1126160032 15:45602675-45602697 GTGAGGAAGATGAAGTATCAAGG - Intronic
1126252228 15:46581581-46581603 GGAAGAAAGGAGAAGTATGAAGG - Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126504998 15:49394756-49394778 GTGAGTTAGGAGCAGTAGGAAGG + Intronic
1126951554 15:53887175-53887197 GTGTGGAAGGAGAAGGGTTATGG + Intergenic
1127499606 15:59544007-59544029 GTGAGAAAGGAGAAGTCAGGAGG + Intergenic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1128301045 15:66566383-66566405 GTGAGGAAAGAAATGAATGAGGG - Intergenic
1129601575 15:77001863-77001885 GAGAGAAAGGAGATGGATGAGGG + Intronic
1129624805 15:77185685-77185707 GGCAGGAAGGAGAAGCAAGAAGG + Intronic
1129695273 15:77737432-77737454 GGGAGGAAGGAGAGGGAGGAAGG + Intronic
1130065794 15:80604087-80604109 GTGAGTAAGGAGAGGTGAGAGGG + Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130719780 15:86375310-86375332 GGCAGGAAAGAGAAGCATGAAGG + Intronic
1131539062 15:93260871-93260893 GGAAGGAAGGAGAAGAATAAAGG - Intergenic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131735719 15:95329666-95329688 GTGAGGAAGGGAAAAAATGACGG + Intergenic
1131791685 15:95972443-95972465 GTGAAGAAGGAGAAGTGAGGAGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1131960041 15:97780612-97780634 GTGGGGAAGGACAAGAAGGAAGG + Intergenic
1133431674 16:5742353-5742375 GAGAGGAAGGAGAGGAAGGAAGG - Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133589561 16:7229601-7229623 GGAAGGAAGGAGAAGAAAGATGG + Intronic
1133674104 16:8053725-8053747 GTCAGGAAGGAAAAGTCAGAGGG + Intergenic
1133717897 16:8466938-8466960 GGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1133717929 16:8467066-8467088 GGGAGGAAGGAGAAGAAGAAAGG + Intergenic
1134111920 16:11520710-11520732 GTGACCAAGAGGAAGTATGAAGG + Intronic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1135967615 16:27049007-27049029 GTGAGGCTGGAGAGGTAGGAGGG - Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136285569 16:29238457-29238479 GGGAGGGAGGAGAAGTGGGAGGG + Intergenic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1137813431 16:51375210-51375232 GTGTGGATGATGAAGTATGATGG + Intergenic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1139030035 16:62868753-62868775 GTGAGGAAATAGAGGTTTGAAGG - Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141005228 16:80345909-80345931 GTAATGAAGGACAAGTATGGGGG - Intergenic
1142090902 16:88208611-88208633 GGGAGGGAGGAGAAGTGGGAGGG + Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142714936 17:1742230-1742252 GTGAGGGAGGAGAAATGAGAGGG - Intergenic
1142941083 17:3380210-3380232 GGGAGGAAGCAGAAGAATCATGG + Intergenic
1142958237 17:3535425-3535447 GTGAGGAGGGAGAGGGAGGAAGG - Intronic
1142986920 17:3700994-3701016 GTGAGGGAGGAGAAGGAGGGGGG - Intergenic
1143185441 17:5007329-5007351 CTGAGGATGGAGAGGTGTGAGGG + Exonic
1143210658 17:5184917-5184939 GGGAGGAAAGAGCAGTATGCTGG - Intronic
1143818535 17:9540530-9540552 GAGAGGAAGGAGAATGATGTCGG - Intronic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1144361805 17:14502270-14502292 GTCAGGAATCAGAAGAATGAAGG + Intergenic
1144365635 17:14541846-14541868 GGGAGGAAGGAGAAAAAAGAGGG - Intergenic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146210130 17:30935822-30935844 GTGAGCAAGGAAAAGTGTGGAGG + Intronic
1146592754 17:34142284-34142306 GTGAGGAAGGGGAAATACAAGGG + Intronic
1147203846 17:38822776-38822798 GTGAGAAAGGAGCAGAATAAGGG + Intronic
1147588562 17:41666865-41666887 GTGAGGAAGGAGCACTAGGGAGG - Intergenic
1149198803 17:54157798-54157820 GTGTGGAAGTAGAAAAATGAAGG + Intergenic
1150064459 17:62097395-62097417 GTAAGGGATGTGAAGTATGAGGG - Intergenic
1150808886 17:68340695-68340717 TTGAGGAAGGAGAAGTACCAGGG - Intronic
1151146140 17:72043195-72043217 GTAAGGAAAGAGAAGGATAAAGG - Intergenic
1151345764 17:73500359-73500381 GGGAGGATGGAGAAGGATGGAGG - Intronic
1151345810 17:73500549-73500571 GGGAGGATGGAGAAGGATGAAGG - Intronic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1154941514 18:21117561-21117583 GTGAGTCAGGAGAAGTCTTAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1157098811 18:44711378-44711400 GAGAGGAAGGAAAAGAAGGAAGG - Intronic
1157521922 18:48351418-48351440 GTGAGGGAGGAGAAGTTTGCTGG - Intronic
1157723114 18:49941148-49941170 GTGAGAAATGAGGAGTGTGAGGG - Intronic
1157771908 18:50356397-50356419 GTGAAGAAAGAGAAACATGAGGG - Intergenic
1157881598 18:51326047-51326069 TGGAGGAAGGAGAAATATAAGGG - Intergenic
1158695331 18:59697952-59697974 GTGAGGAAGGAGGAGTTGAAAGG + Intergenic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159075960 18:63682460-63682482 GTGAGGGAGGAGAAGGACGAAGG - Intronic
1159579273 18:70217105-70217127 GTAAGGAAGGAGAAGCATGAGGG - Intergenic
1160273589 18:77409753-77409775 GTGTGGAAGCAGGTGTATGATGG + Intergenic
1160676372 19:393535-393557 GTGATGATGGGGAAGGATGACGG + Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160676735 19:395101-395123 GGGATGATGGAGAAGGATGATGG + Intergenic
1162188716 19:8927760-8927782 GTAAAGAAGGACAATTATGATGG + Intronic
1162964748 19:14150581-14150603 GTGAGGAGGGAGAACTTGGAAGG - Exonic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164681161 19:30134678-30134700 GTGAGGGAGGAGTAGTAGGAAGG + Intergenic
1165095593 19:33408102-33408124 GTAAGGACGGAGCAGTAGGAGGG + Intronic
1165333151 19:35152592-35152614 GTGAGGATGGAGAAGAAAGCTGG + Intronic
1165670670 19:37676101-37676123 GTGAAGAACAAGAAATATGAAGG + Intronic
1166001749 19:39881613-39881635 AGGAGGAAGGAGACGTTTGAAGG - Intronic
1166004531 19:39897864-39897886 AGGAGGAAGGAGACGTTTGAAGG - Intronic
1167008956 19:46793907-46793929 GTGAGGAATTAGATGAATGAAGG + Intergenic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925715876 2:6783903-6783925 GTGAGAAAGAGGAAGCATGAGGG + Intergenic
925902055 2:8515836-8515858 GGGAGGAAGGAGAGGGAGGAGGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
925918294 2:8622926-8622948 GGGAGGAAGGAGGAGCCTGAGGG - Intergenic
926266879 2:11330998-11331020 GGGAGGAAGGAGCAGAAAGAAGG + Intronic
926575868 2:14580570-14580592 GGGAGGATGGAGAAGAAAGACGG - Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
926631559 2:15141189-15141211 GAGAGGAAGGAAAAGAGTGAAGG - Intergenic
927314580 2:21667127-21667149 GTGAGAAGGGAGAAGTATTTTGG - Intergenic
927604140 2:24471063-24471085 GTGAGGAAGGGGATGTAACATGG - Intergenic
928619701 2:33076354-33076376 GAGAGGAAGGAGAGGTCTCAAGG + Intronic
929053167 2:37855081-37855103 GTGAGGAAGTACAAGGGTGATGG - Intergenic
929914694 2:46124794-46124816 GTGGGGAATGATAAGGATGATGG + Intronic
930530534 2:52582878-52582900 ATGAGGAATAAGAATTATGAAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932208151 2:69902231-69902253 AGGAGGAAGGAGAAGAAAGAAGG - Intronic
932208155 2:69902255-69902277 AGGAGGAAGGAGAAGAAAGAAGG - Intronic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933896243 2:86812357-86812379 GTGAGGAAGGGAAAGTAGTATGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934535331 2:95128662-95128684 ATAAGGAAGAAGAAGTAAGAAGG + Intronic
934903557 2:98179965-98179987 GGGAGGAAGGAGATAGATGAAGG - Intronic
935865373 2:107382039-107382061 GTGGGGAAGGGGAACTCTGAGGG - Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937138359 2:119575357-119575379 GTGAGGAAGGAGATTCAGGAGGG - Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938654645 2:133418528-133418550 GTGAGAAAAGAGAAGGATCAGGG + Intronic
940532934 2:154903625-154903647 GGCAGGAAGGAGAAGAATGAGGG + Intergenic
941688854 2:168477145-168477167 GTGAGGGAGGAAAGGAATGAGGG + Intronic
941764652 2:169283971-169283993 GCGAGGAGGGTGAAGGATGATGG - Intronic
941995242 2:171595743-171595765 GAAAGGAAGGAGAAGAAGGAAGG + Intergenic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
942417397 2:175773293-175773315 GTGGGGAAGGAGAAGAAAAAAGG + Intergenic
943753523 2:191535003-191535025 GTGTGGGAGGAAAAGTATGGTGG + Intergenic
944226828 2:197356546-197356568 GTGCGGAAAGAAAAGTGTGAGGG + Intergenic
945346676 2:208726137-208726159 GTAAGGAAGGAGGAGTTTCAGGG - Intronic
945427429 2:209723774-209723796 GTGAGAAAGGAGCAGTGTGTTGG - Intronic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
945693460 2:213071632-213071654 GTGTGGAAGGAGAAGTATAAAGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
946835424 2:223767827-223767849 GTGGGGAAGGGGAAGTATGTTGG - Intronic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947040545 2:225913945-225913967 ATGGGGAAGGAAAAGCATGAAGG - Intergenic
947274403 2:228373889-228373911 GTGAGGGAGGAGAATTATACAGG - Intergenic
948083767 2:235229160-235229182 GTGAGGAGAGAGACGTGTGAAGG + Intergenic
948710267 2:239820937-239820959 GGGAGGAAGCAGAGGTCTGATGG + Intergenic
948952013 2:241259303-241259325 GTGAGGAGGGAGCAGGGTGAAGG + Intronic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168965716 20:1896683-1896705 GGGTGGAAGGAGAAGTATGGGGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169043342 20:2515037-2515059 GGAAGGAAGGAGAAGAAGGAAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169163880 20:3406783-3406805 GGGAGGAAGTAGAGGTATTAGGG - Intronic
1169586071 20:7086859-7086881 GGAAGGAAGGGCAAGTATGAGGG - Intergenic
1170114027 20:12837801-12837823 GGGAGGAAAGACAAGTCTGAGGG + Intergenic
1170261645 20:14414889-14414911 GTGATGAGGAAGAAGTATGTTGG - Intronic
1170561606 20:17563369-17563391 GGGAGGAAGGAAAGGTAGGAAGG - Intronic
1171937843 20:31292990-31293012 GGGAGGAAGGTGAAGCAAGATGG + Intergenic
1172063677 20:32204754-32204776 CTGAGGAAGGACAAGTCTGAAGG - Intronic
1173822035 20:46025807-46025829 GTGGGGAAGAAGAAGAGTGAAGG + Intronic
1174046377 20:47736828-47736850 GTGAGGATGGAGGAGCGTGAGGG + Exonic
1174603973 20:51747028-51747050 GAGTGGAAGGAAAGGTATGAAGG + Intronic
1175073295 20:56352767-56352789 GAGAGGAAGGTGAAGTAAGGAGG - Intergenic
1175202580 20:57288248-57288270 GTGAGGAAGGAGAGGTCTTGGGG - Intergenic
1175657895 20:60787557-60787579 GGGAGGAAGAAAAAATATGAAGG - Intergenic
1175676760 20:60952921-60952943 ATCAGGAAGGAGAAGCAGGATGG + Intergenic
1177035656 21:16039352-16039374 GGCAGCAAGGAGAAGAATGAGGG + Intergenic
1177407586 21:20690479-20690501 GGGAGAAGGGAGAAGGATGAGGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177618706 21:23558869-23558891 GGAGGGAAGGAGAAGTAAGACGG - Intergenic
1177735491 21:25083883-25083905 GAGAGCAAGAAGAAGTATAAGGG - Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1178883457 21:36466446-36466468 AGCAGGAAGGAGAAGAATGAGGG + Intronic
1179896105 21:44364604-44364626 GGGAGGAAGGAGAGGGATGCAGG + Intronic
1182351675 22:29703278-29703300 GTGAGGAGGGGGAAGGATGAAGG - Intergenic
1182847044 22:33439895-33439917 GTGAGGAATGAGGAGCAGGAGGG - Intronic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1184103997 22:42356999-42357021 CTGAGGAAGGAGAAGCTTAAGGG + Intergenic
1184377774 22:44125356-44125378 GTGAAGAAAGAGAAGTATTATGG + Intronic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
949829519 3:8198987-8199009 CTGAGGAAGGATAAGTGAGAGGG - Intergenic
949948264 3:9207574-9207596 GGGAGGGAGGAGAAGGAAGAAGG + Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950753877 3:15155952-15155974 GGGAGAAAAGAGAAGTAGGAAGG + Intergenic
950907358 3:16551533-16551555 GTGAGGAAGGAAAAGAAGGAAGG + Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951170719 3:19539035-19539057 ATCAGGAAGGAGAGGTAAGAAGG - Intergenic
951807532 3:26662919-26662941 ATGAGGAAGGAGGGATATGAGGG + Intronic
952735908 3:36691369-36691391 GGGAGGCAGGAGAAGGAGGAAGG + Intergenic
953188438 3:40660665-40660687 GTGAGGAGGGAGAAAGAAGAAGG + Intergenic
953317720 3:41944115-41944137 GGGAGGAAGGGGAAGAAAGAGGG - Intronic
953867025 3:46593126-46593148 GGGAGGTAGGAAAAGTAGGAGGG - Intronic
954111066 3:48433451-48433473 CTGAGGAAGGAGAACTATGGAGG - Intronic
954300756 3:49699634-49699656 GGGAGGAGGGAGAAGTGTGAGGG - Intronic
954987556 3:54809190-54809212 GAAAGGAAGGAGAAGAAAGAAGG - Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
956161783 3:66362512-66362534 GTGAGGAAGGACAGGAAGGAGGG + Intronic
956189931 3:66598709-66598731 GTGGGGAAGGAGGGGTGTGAAGG + Intergenic
956432428 3:69200612-69200634 GGGAGGAAGGAGTAGAATTAGGG - Intronic
956681294 3:71784679-71784701 GTGATGAGGGAGAAGTAAGCGGG + Intronic
956833047 3:73072408-73072430 GGGAGAAAGGAGAAACATGAAGG + Intergenic
957191104 3:77010888-77010910 GAAAGGAAGGAGAAGAAAGAGGG - Intronic
957202999 3:77161798-77161820 GTAAGAAAGGAGAAAGATGAAGG - Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959283521 3:104378632-104378654 GAGAGGCTGGAAAAGTATGAGGG + Intergenic
959427765 3:106214085-106214107 ATGAGGATGGACAAATATGAAGG - Intergenic
959840954 3:110973853-110973875 ATCAAGAAGGAGGAGTATGATGG - Intergenic
960431685 3:117576905-117576927 ATCAGGAAGGAGAAGAATGAGGG - Intergenic
961101480 3:124202743-124202765 GTGATGAAGCAAAAGTATGGTGG - Intronic
961415361 3:126752855-126752877 ATGAGGAAGGAGAAATATTGGGG + Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
962149380 3:132876664-132876686 GTGAGGAGGTAAAATTATGAGGG + Intergenic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
962734912 3:138317178-138317200 GAAAGGAGGGAGAAGTAGGAAGG - Intronic
962876962 3:139542478-139542500 CTGAGGAAGGATAACTTTGATGG - Intergenic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
964940222 3:162151276-162151298 GGGAGGGAGGAGCAGGATGAGGG - Intergenic
965855268 3:173080513-173080535 GAGAGGAAGGATGAGGATGACGG + Intronic
965962557 3:174445605-174445627 GTGAGGAAAGAGAGGTAGAAGGG - Intronic
966901862 3:184492479-184492501 GTGAGGAAGGGGGAGGGTGAAGG + Intronic
968615054 4:1573952-1573974 GTGAGGGAGGAGCTGGATGAGGG - Intergenic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969965492 4:10990188-10990210 ATGAGGAATGAGAAATTTGACGG + Intergenic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
970372292 4:15420136-15420158 GTGAGGAGGAAGAAGGATGGGGG - Intronic
970499490 4:16662821-16662843 GTAAGGAAAAAGAAGTATAATGG - Intronic
971374490 4:26045836-26045858 GTCAGGGAGGAGAAGCAAGAAGG + Intergenic
971382178 4:26109019-26109041 GTGAGGAAGAGTAAGAATGAGGG - Intergenic
972017518 4:34264564-34264586 GGCAGGAAGGAGAAGTGTCAAGG + Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972629653 4:40832449-40832471 GTGAGGAAGCAGGAGTAGGTTGG - Intronic
972647510 4:40982980-40983002 GTGAAGGTGGATAAGTATGAAGG + Intronic
974651547 4:64759700-64759722 GTGAAGAAGAAGAAGAGTGAAGG - Intergenic
974753194 4:66168413-66168435 GTGAAGAACAAGAAGAATGAAGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976227320 4:82805792-82805814 ATGAGGAAGATGAAGTATTATGG + Intergenic
977611231 4:99034184-99034206 GAGAGGAAGGAGGAGAAGGAGGG - Intronic
978033080 4:103959658-103959680 GTGAGGAAGGAGGGGGATGTGGG + Intergenic
978465795 4:109007536-109007558 TTGAGGAAGGATAGGTATTAGGG - Intronic
979712972 4:123802653-123802675 GAGAGCAAGGAGAAGTATGTAGG - Intergenic
981141619 4:141276094-141276116 ATGAGAATGGAGAAGTATGTAGG - Intergenic
982492509 4:156046577-156046599 GGGAGGAAGGAGGAGAAGGAAGG - Intergenic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
984902587 4:184598319-184598341 GTGAGGAAGGAGAGGGCTGATGG - Intergenic
985761479 5:1751445-1751467 TGGAGGAAGGAGAGGGATGAGGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987522536 5:19005466-19005488 GTGAGGAAAGTGAAATAGGAAGG + Intergenic
988410205 5:30877019-30877041 GTGAGGAAGGTGAGATTTGAAGG + Intergenic
988787619 5:34579138-34579160 GGGAGGAAGGAGAAGGAGAAAGG + Intergenic
988888646 5:35589132-35589154 GTGAGGAGGATGAAGTGTGAGGG - Intergenic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
990166194 5:52995865-52995887 GTGAGGAAGAGGAAATGTGAAGG + Intronic
990658741 5:57988203-57988225 GTGAGGAAGGAAAGGAAGGAGGG - Intergenic
991061877 5:62384760-62384782 GTGAGGAAGGGGGATTGTGAAGG - Intronic
991452336 5:66766105-66766127 GTGAGGAAGCTGCAGAATGAAGG + Intronic
992034968 5:72764172-72764194 GTGAGGAGGGAAAAGGAGGATGG - Intergenic
992548582 5:77840024-77840046 GTGAACAAGGAGATGTATCACGG + Intronic
993118963 5:83751846-83751868 CTGAGGACAGAGAAGTTTGAAGG - Intergenic
994080981 5:95708850-95708872 GTGAGGAGGAAGGAGTAGGAAGG + Intergenic
995374768 5:111461682-111461704 GGGAGGAGGGAGAAGAGTGAAGG - Intronic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996546621 5:124685862-124685884 GTGAGGAAAATGAAGTATGGGGG - Intronic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
997124733 5:131214432-131214454 GTGAGGGAGGAGTACTTTGAGGG + Intergenic
997441098 5:133909077-133909099 TGCAGGAAGGAGAAGGATGAGGG + Intergenic
997759470 5:136431315-136431337 GGGAGGAGGGAGAGGTGTGATGG - Intergenic
998254414 5:140573801-140573823 GTGAGCAAGGTGAAGCCTGAGGG - Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999095950 5:148978461-148978483 GTGGAGGAGGAGAGGTATGAAGG - Intronic
999651106 5:153768243-153768265 GTGAGAAAGAAGAAGAAAGAAGG - Intronic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000209805 5:159098612-159098634 GGGAGGAAGGAAAAGAGTGAGGG + Intronic
1001004745 5:168040178-168040200 GTGAGGGACTAGAAGTAGGAAGG + Intronic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001666557 5:173438081-173438103 GTAAGACAGGAGATGTATGAGGG + Intergenic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003610758 6:7613068-7613090 GTGAGGAGGCAGAGGTTTGACGG - Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003781021 6:9426896-9426918 GTGATGAAGATGAAGTAAGATGG + Intergenic
1004131185 6:12921571-12921593 GGAAGGAAGGAGAAGAAGGAAGG + Intronic
1005277370 6:24234201-24234223 ATGAGGAAGGAGAATTTTAAAGG + Intronic
1007357568 6:41332548-41332570 GTAAGGAAGGAGAAGAAGCAGGG + Intergenic
1007667918 6:43526843-43526865 GTGAGGAAGGAGGAAGATGGGGG + Intronic
1008592709 6:53010055-53010077 GGGAAGAAGGAGAAGGATAAAGG - Intronic
1008966609 6:57319180-57319202 GGGTGGATGGAGAAGTATGGAGG + Intronic
1009369820 6:62884928-62884950 GTCAGGAAGGAAAAAAATGAAGG - Intergenic
1009424573 6:63500244-63500266 GTTATGAAGGAGAAGTATAATGG + Intergenic
1010386368 6:75284866-75284888 GGGAGGAGGGAGAAGAAGGAGGG + Exonic
1011051495 6:83155579-83155601 TTGAGGAAGGAGAGGTAGGTAGG + Intronic
1011124170 6:83988339-83988361 GTCAGGAAGTAGAATTTTGATGG + Intergenic
1011356756 6:86479332-86479354 GTGAGGAGGAAGGAGTAGGAAGG - Intergenic
1011627696 6:89296728-89296750 TTGAGGAAGGAGCAGCGTGATGG + Intronic
1012401599 6:98846051-98846073 GTGAGGAAGGAGAGGAGTAAGGG - Intergenic
1012411225 6:98959751-98959773 AAGAGGTAGGAGAAGTTTGAAGG - Intergenic
1012562676 6:100603619-100603641 GTTAGCAAGCAGGAGTATGAGGG - Intronic
1012911404 6:105121952-105121974 GTGAGGGTGGAGAAGCCTGATGG + Intronic
1013201635 6:107903372-107903394 GTATGGAAGGAAAAGAATGAGGG - Intronic
1013263547 6:108471080-108471102 ATGAGGAGGGAGAAATGTGAGGG + Intronic
1013701333 6:112773799-112773821 GTAGAGATGGAGAAGTATGAGGG + Intergenic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1014963257 6:127713798-127713820 GTGAGAAAGGAGAAGTAGAGAGG + Intronic
1015232156 6:130927571-130927593 TTGAGGATGGAAAAGTCTGATGG - Intronic
1015280028 6:131423142-131423164 GTGATGAAGGTGAAGAAGGAAGG - Intergenic
1015974071 6:138771689-138771711 GTACTGAAGGAGAAGTATCAGGG - Intronic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1016804315 6:148197580-148197602 GTGAGGAAGGAGAAGCTTTGAGG - Intergenic
1016964437 6:149705826-149705848 TTGAGGAAGGTGAATTATGAGGG - Intronic
1018212971 6:161499964-161499986 GTGGGGAAGGAGGAGAGTGAGGG - Intronic
1019212421 6:170417383-170417405 GTGGGGAAGGAGGGGTAGGAAGG - Intergenic
1019327630 7:446090-446112 GTGGGGAGGGAGAGGAATGAGGG + Intergenic
1020384939 7:7590797-7590819 GTGAGAAATGTGAAGTATGAGGG - Intronic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1022039923 7:26571246-26571268 GGGAGGAAGGAAAAGAAAGAAGG + Intergenic
1022556884 7:31306871-31306893 ATGTGGCTGGAGAAGTATGAGGG + Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022637768 7:32153453-32153475 GTGTGGATGGAGAAGAATGAAGG + Intronic
1023041504 7:36176803-36176825 GTGAGGAAAAAGAAGTGGGAGGG + Intronic
1023725065 7:43134822-43134844 GTGATCATGGAGAAGTCTGAGGG + Intronic
1023991943 7:45133739-45133761 GTGAGACAGGAGATGTAGGAAGG - Intergenic
1024266843 7:47613255-47613277 GGGAGGAAGGAAAAGAAGGAAGG - Intergenic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026560314 7:71443294-71443316 GTGATCAAGGGGAAGCATGACGG + Intronic
1028061705 7:86326852-86326874 TGGAGGAAGAAGAAATATGATGG - Intergenic
1028228197 7:88274436-88274458 ATGAGGGAGGTGAAGGATGAAGG - Intergenic
1029105267 7:98169881-98169903 GTTTGGAAGGAAATGTATGAAGG + Intronic
1029469299 7:100744040-100744062 TTGAGAAAGGATAAGTATTAAGG - Intronic
1030522199 7:110611724-110611746 GTGAGGAAGAACAGGTAGGAGGG + Intergenic
1030746974 7:113177702-113177724 GTGAGAAAGGTAAAGTTTGAGGG - Intergenic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031247688 7:119337675-119337697 GTGAGGAGGGAGAGGGAGGAGGG - Intergenic
1031759904 7:125699467-125699489 GGGAGGAAGCAGAAGTAAGAAGG + Intergenic
1031775057 7:125898552-125898574 GTGAAGAAGTAGAAAAATGATGG + Intergenic
1032580519 7:133099172-133099194 GTGAGGAAGGTGACATATCAAGG + Intergenic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033039127 7:137902334-137902356 GTATAGAGGGAGAAGTATGATGG - Intronic
1033478666 7:141716378-141716400 GTGAGGAAGGAGAAAAGGGAGGG - Intronic
1034151416 7:148918408-148918430 GAGAGAAAGAGGAAGTATGAAGG - Intergenic
1034158166 7:148972538-148972560 GTGGGGTAGGAGATGTATCAAGG - Intergenic
1035084191 7:156242955-156242977 GGAAGGAAGGAGAAGAAGGAAGG - Intergenic
1035574522 8:696288-696310 GGGAGGAAGGAGAGGAGTGAAGG - Intronic
1035845133 8:2855210-2855232 GGCAGGAAGGAGAAGAATAAAGG - Intergenic
1036288349 8:7464085-7464107 GTGAGGAAGGAGAAGTGGAGGGG - Intergenic
1036333126 8:7847443-7847465 GTGAGGAAGGAGAAGTGGAGGGG + Intergenic
1037838533 8:22228532-22228554 GGGAGGCTGGAGAAGGATGATGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1039460694 8:37741619-37741641 GTGAGGAAGGAGGATTAGGTGGG + Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042813957 8:72857483-72857505 GTGAGGCTGGAGAAGTAGGTTGG + Intronic
1042930320 8:74007031-74007053 GGGAGGAAGGAGAATTAAGTAGG + Intronic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1043263406 8:78230310-78230332 GTGAGGAAGGCCAAGGATTAGGG + Intergenic
1043632612 8:82355258-82355280 GGGAGGAAGGAAAAGACTGAGGG + Intergenic
1045851454 8:106703796-106703818 GAAAGGAAGGAGAAGTAGCAAGG + Intronic
1046629373 8:116608143-116608165 GTGAGAAAGGAGGTGCATGATGG - Intergenic
1047073647 8:121375986-121376008 AAGAAGAAGGAGGAGTATGAGGG - Intergenic
1048288905 8:133164674-133164696 GTGAGGAAGGGGAATTAGGCAGG - Intergenic
1048365248 8:133732881-133732903 GGGGTGAAGGAGAAGTAAGAAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1050277513 9:4015223-4015245 GTGAGGAAGGGGGTGTTTGAGGG + Intronic
1050488665 9:6163729-6163751 GTGAGCAAGGATAAGTAGGAAGG + Intergenic
1051795486 9:20864395-20864417 TGGAGGAAGGAAAAGTTTGAAGG - Intronic
1053283743 9:36837763-36837785 GTGAGGGAGGAAAGGTATGGGGG + Exonic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056491150 9:87108356-87108378 GTGAGGAAGGAGTAGCTTTAGGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057195842 9:93115405-93115427 GTGAGGAAGGAGATGAGGGAGGG + Intergenic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1057343293 9:94223078-94223100 GTGAGTAAGCACAAGCATGATGG - Intergenic
1058022663 9:100105773-100105795 GTGAGGAAGGAAAAGACAGAAGG - Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058815016 9:108675099-108675121 GTGAGGAAGGAGCAGAGGGAAGG - Intergenic
1058957011 9:109958688-109958710 GAGAGGAAGGAGAGGAAGGAAGG + Intronic
1059355313 9:113694702-113694724 ATGAGGAGGGAGAAGAATCATGG + Intergenic
1059479304 9:114576033-114576055 GTGAGGCCGGAGAAGTAGGCAGG - Intergenic
1060100763 9:120839241-120839263 GTGAGGTTGGAAAAGTAGGATGG + Intronic
1060646982 9:125289198-125289220 GTGAGGTAGGAGAGGTAAGGTGG + Intronic
1060720912 9:125976774-125976796 GGGAGGAAGGAGAAGAAGGGAGG - Intergenic
1061281986 9:129602764-129602786 GGGAGGAAGGAGGGGTAAGAAGG + Intergenic
1061875703 9:133542561-133542583 GTGAATATGGAGAAGAATGAGGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062394534 9:136347443-136347465 GTGAGCAGGGAGGAGGATGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1203697959 Un_GL000214v1:114723-114745 GAGGGGAAGGTGAAGTTTGAGGG + Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185485846 X:481525-481547 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485914 X:481752-481774 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485936 X:481820-481842 GGGAGGAAGGAGACGGAGGAAGG + Intergenic
1185485956 X:481894-481916 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485981 X:481979-482001 GGGAGGAAGGAGAGGAAGGAAGG + Intergenic
1186630109 X:11339512-11339534 GTGAGGAAATGGAGGTATGATGG - Intronic
1187043970 X:15626904-15626926 GTGAGGAAGGCAAAGTGTGGCGG - Intergenic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1189701022 X:43716360-43716382 TTGAGGAAGGAGGGGAATGATGG + Intronic
1192084187 X:68079181-68079203 GTAAGAAAGGAGATGAATGATGG - Intronic
1192552474 X:72065187-72065209 GGGAGGAAGGAGAGGAAGGAAGG + Intergenic
1192553573 X:72072452-72072474 GTGAGGCTGGAGAAGTAGGAGGG - Intergenic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193643077 X:84035389-84035411 TTTAGGAAGGAGAAATATCAGGG + Intergenic
1196108194 X:111918334-111918356 GTGAGGGAGGAGAAGTTGGCAGG + Intronic
1196193682 X:112818936-112818958 CTTAGGAAGGAGCAGGATGAGGG - Intronic
1196679341 X:118455137-118455159 GTGAGGAAGGAGAAGTGTTAGGG + Intergenic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1196993400 X:121353724-121353746 GGCAGGAGAGAGAAGTATGAAGG - Intergenic
1200846793 Y:7838627-7838649 GTGAGGAGGAAGGAGTAGGAAGG - Intergenic
1201070543 Y:10143955-10143977 GTGAGGAAGTCCAAGGATGAGGG - Intergenic
1201227684 Y:11834166-11834188 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
1201248265 Y:12028738-12028760 GGGAGGAAGGAGATGAAAGAGGG + Intergenic
1201319249 Y:12679332-12679354 TGGGGGAGGGAGAAGTATGAAGG - Intergenic
1201737665 Y:17286761-17286783 GTGAGGAAGGAGAAATGGGGAGG + Intergenic