ID: 1085326667

View in Genome Browser
Species Human (GRCh38)
Location 11:75611442-75611464
Sequence GAGTTACCAAACTTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085326667_1085326668 -3 Left 1085326667 11:75611442-75611464 CCTGTGGGAAAGTTTGGTAACTC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1085326668 11:75611462-75611484 CTCCTGATCTTGAACAACTCTGG 0: 1
1: 0
2: 1
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085326667 Original CRISPR GAGTTACCAAACTTTCCCAC AGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
910770904 1:90831619-90831641 AGCTTACCAAACTTTCCCAGAGG + Intergenic
918053015 1:180991023-180991045 GAGTTGCCAAATTTTCCTATCGG + Intronic
1064200875 10:13283813-13283835 GAGTTAACAAAATGTTCCACGGG - Exonic
1071533118 10:86403942-86403964 GAGTTACCACACCTGGCCACGGG - Intergenic
1073028884 10:100508895-100508917 GAGATATCAAACTTTACCACTGG - Intronic
1076033132 10:127176035-127176057 GTGTTACCAGACGTTCCCTCTGG - Exonic
1081201697 11:40224135-40224157 GAGCTTCCAATATTTCCCACGGG + Intronic
1082201325 11:49372758-49372780 GAGTTACCAATCATTACCTCTGG - Intergenic
1085326667 11:75611442-75611464 GAGTTACCAAACTTTCCCACAGG - Intronic
1085726076 11:78955780-78955802 GAGTCACCAGAGTTTCCCAGAGG + Intronic
1086911089 11:92473602-92473624 GATTTATCAAACATTCACACAGG - Intronic
1089351674 11:117824908-117824930 GAGTTTCCAAACCTTCCCAAAGG + Intronic
1091630002 12:2152844-2152866 GACCTACCAATCTTTCCTACCGG - Intronic
1098763439 12:74453923-74453945 TAGTTACCCAGCTTTCCCAGAGG - Intergenic
1102360601 12:112284446-112284468 GTGTTACCAACCTTTCCCTGTGG - Intronic
1103950762 12:124549812-124549834 GAGTCACCACCCTATCCCACTGG + Intronic
1106513463 13:30431909-30431931 TAGTAACCAAACCTTCCCATAGG - Intergenic
1110944918 13:81400808-81400830 TAGTTACCAAACTTTACCATGGG - Intergenic
1113115307 13:106868922-106868944 GAGTTCCTCCACTTTCCCACTGG - Intergenic
1113550310 13:111187848-111187870 GAGTGACCACACCTTCACACTGG - Intronic
1118577749 14:67260453-67260475 GAGTTAACAAACTTTGCCTCGGG + Intronic
1120714002 14:87821076-87821098 GAGATATCAAGCTTTCCCAAGGG - Intergenic
1129320688 15:74773082-74773104 GAGTGACCAGATTTTCCCCCGGG - Intergenic
1146659498 17:34654947-34654969 GAGTTAACAAACTTTCTCAAAGG + Intergenic
1158574189 18:58622379-58622401 GAGGTACTAAACTCTCACACAGG - Intronic
1159071322 18:63626640-63626662 GAGTAACCAGACTTGCCCAAGGG + Intergenic
1161709382 19:5839213-5839235 GAGTTGCCTGACTTGCCCACCGG - Exonic
1162214386 19:9121145-9121167 GAGTCAGCAAACTTTCCCCAAGG - Intergenic
925486735 2:4342835-4342857 GTGTAACCTAACTTTCTCACAGG - Intergenic
929202915 2:39256873-39256895 CAGTTACAAAAGTATCCCACAGG - Intronic
936020258 2:108989206-108989228 GAGTTTCCAAACTTGCAGACAGG - Exonic
936519602 2:113203228-113203250 GAGTTGACAATCTTGCCCACTGG + Exonic
939813086 2:146858976-146858998 GATTTACCAAACTTTTCCTACGG - Intergenic
941198014 2:162474168-162474190 AGGTTAGCAAACTTTCCCAGGGG + Intronic
942369114 2:175262465-175262487 GAGTTACAAAACTTTGGAACTGG - Intergenic
948762260 2:240199422-240199444 AAGTGACCCAACTCTCCCACAGG - Intergenic
1171350710 20:24500918-24500940 TAGTTAGAAAACTTTCCCTCAGG - Intronic
958265651 3:91434335-91434357 CAGTCACCAAACTTTACCAGTGG + Intergenic
958453654 3:94303996-94304018 GTATTACCAAATTTCCCCACAGG + Intergenic
964066205 3:152583010-152583032 GAGGGACCAAAATTTCCTACTGG + Intergenic
967381325 3:188862148-188862170 GACTTCCTATACTTTCCCACAGG + Intronic
973318044 4:48781367-48781389 GAGTTTCCCCAGTTTCCCACTGG + Intergenic
974411961 4:61553729-61553751 GATTAACCAAACACTCCCACTGG - Intronic
978585599 4:110272767-110272789 AAGTTACAAAATTTTCCCCCAGG - Intergenic
980409403 4:132396777-132396799 TAAATACCAAACCTTCCCACAGG - Intergenic
980833818 4:138164960-138164982 GAGTTCCAAGACTTTCCCACTGG + Exonic
981616807 4:146650960-146650982 GAGTTACCTATCTTTCCCCAGGG + Intergenic
984309767 4:178042128-178042150 GAATGACAAAACTTTCCAACTGG - Intergenic
986830891 5:11576897-11576919 GAGTTACCTAATTTGACCACTGG + Intronic
987726169 5:21702819-21702841 AAATTACCAAACTTTTCCAAAGG + Intergenic
989466408 5:41760904-41760926 CTGTAACCAAACTTTCCCAGGGG + Intronic
997239558 5:132296458-132296480 GAGTTTCAAAACTTCCTCACTGG - Intronic
1003615284 6:7649618-7649640 AAGTTACGAAACTGTCCCGCTGG - Intergenic
1003752133 6:9070691-9070713 GAGTTACTATAGGTTCCCACAGG + Intergenic
1008989716 6:57588319-57588341 CAGTCACCAAACTTTACCAGTGG - Intronic
1009178299 6:60486863-60486885 CAGTCACCAAACTTTACCAGTGG - Intergenic
1010275670 6:73965978-73966000 GAGTTACCAAGGAATCCCACTGG - Intergenic
1011213022 6:84974570-84974592 GACTTCCCAAATTTTCCCAAAGG + Intergenic
1013042266 6:106447635-106447657 AAGTTAACAAACTTTCCAATTGG + Intergenic
1013120277 6:107134768-107134790 GAGTTAGTAAAATTTACCACTGG + Intergenic
1021132815 7:16931706-16931728 GAGTTACCAAAATGTAACACAGG + Intergenic
1023450276 7:40276997-40277019 GGGTTACGAGACATTCCCACTGG - Intronic
1028425469 7:90682890-90682912 CAGTTACATAACATTCCCACTGG - Intronic
1029378184 7:100194878-100194900 GAATTACCAAAATGTGCCACAGG + Intronic
1033025235 7:137765813-137765835 AAGTCACCCAACCTTCCCACTGG + Intronic
1033436601 7:141338684-141338706 CAGTGACCAAACTGTCCCCCTGG + Intronic
1033904109 7:146180115-146180137 GAGTTTCTAAACTTTCCCTGAGG - Intronic
1040880167 8:52196271-52196293 GGCTTACCAAACTTTCTCTCAGG - Intronic
1051833516 9:21308610-21308632 GAGTTACCTGACTTTCCAGCTGG + Intergenic
1053058778 9:35011974-35011996 GAAGTTCCAAACTTTCCCTCAGG - Intergenic
1060311271 9:122464641-122464663 GAGTCACCAATCTTTTCCAAAGG - Intergenic
1191171548 X:57452916-57452938 GAGGTACAAAACTTTCACACTGG + Intronic
1194644373 X:96440718-96440740 TAGTTACCAAAATTTCTTACTGG + Intergenic
1198715512 X:139554047-139554069 GAGTTACTAAACTTTCTTTCAGG - Intronic
1199022002 X:142891709-142891731 CAGTTACCATACTTTCCTATGGG - Intergenic
1199211909 X:145222519-145222541 GAGTTATCAAACTTCCCCACAGG - Intergenic
1199774733 X:151000787-151000809 AAGTTACAAACCTTTCCCTCCGG - Intergenic