ID: 1085327553

View in Genome Browser
Species Human (GRCh38)
Location 11:75618751-75618773
Sequence ATTTAGGGGGGCCTCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085327553_1085327567 21 Left 1085327553 11:75618751-75618773 CCTGGCCAGAGGCCCCCCTAAAT 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1085327567 11:75618795-75618817 GTAGAGCCGACAGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 7
4: 76
1085327553_1085327560 -1 Left 1085327553 11:75618751-75618773 CCTGGCCAGAGGCCCCCCTAAAT 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1085327560 11:75618773-75618795 TTGACCTCCTGTCGATGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 52
1085327553_1085327563 12 Left 1085327553 11:75618751-75618773 CCTGGCCAGAGGCCCCCCTAAAT 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1085327563 11:75618786-75618808 GATGCCCTGGTAGAGCCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 74
1085327553_1085327566 20 Left 1085327553 11:75618751-75618773 CCTGGCCAGAGGCCCCCCTAAAT 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1085327566 11:75618794-75618816 GGTAGAGCCGACAGGTGCTCTGG 0: 1
1: 0
2: 1
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085327553 Original CRISPR ATTTAGGGGGGCCTCTGGCC AGG (reversed) Intronic
900542224 1:3208860-3208882 ACCTGGGGGGGCCTCTGGACAGG - Intronic
900804665 1:4759590-4759612 CTGTACGGGGGCCTCTGGACTGG + Intronic
903383383 1:22911688-22911710 TTTCAGAGGGGCATCTGGCCAGG + Intronic
903578652 1:24354654-24354676 ACCTAGGGGGTCCCCTGGCCTGG + Intronic
906206574 1:43990612-43990634 ACTTTGGGGGGCCTCCTGCCTGG + Exonic
913367385 1:118055225-118055247 ATTTTTGGAGGCCTCTGGCAGGG - Intronic
920087785 1:203430467-203430489 ATCTAGGGGGGTATCTAGCCAGG - Intergenic
920118119 1:203635759-203635781 ATCTAGGAGTGCCTCTGGCATGG - Intronic
1063679684 10:8175059-8175081 ATGGGGAGGGGCCTCTGGCCAGG + Intergenic
1066245833 10:33582616-33582638 TTTTAGGGGGTCCTCTGATCAGG - Intergenic
1066538233 10:36414461-36414483 TGTTAGGGGGGCATGTGGCCGGG + Intergenic
1074693697 10:116029238-116029260 AATTAGGGGAGCCCCTTGCCTGG + Intergenic
1076494035 10:130885233-130885255 CTTTGGGGGGGCCTCTGGGGAGG + Intergenic
1083684935 11:64370251-64370273 CTTCCAGGGGGCCTCTGGCCAGG + Exonic
1085327553 11:75618751-75618773 ATTTAGGGGGGCCTCTGGCCAGG - Intronic
1089402202 11:118170851-118170873 TTCTAGGGGAGCCTCTGGCCTGG + Intronic
1089518138 11:119046605-119046627 ATTGAGGGGTGGCTCTGCCCGGG + Exonic
1089643993 11:119865904-119865926 CTTCAGGGAGGCCTCTGGCAGGG - Intergenic
1090829852 11:130413684-130413706 ATTCAGAGCTGCCTCTGGCCAGG - Intronic
1091399410 12:173249-173271 GTTTAGGGAGACCTCAGGCCTGG + Intronic
1092917105 12:13199054-13199076 ATGTGGGGGGCCCTCTGACCAGG - Intronic
1095464109 12:42472704-42472726 ATTTCAGGGGGCCTGGGGCCTGG - Intronic
1095951265 12:47783208-47783230 ATGTAGGGGGGCCTCTGGCGAGG + Exonic
1096006598 12:48178331-48178353 ATTTGGGGGGGCCTCTGAGAGGG + Intronic
1096673143 12:53211806-53211828 ATTAAGGGAGGCATCGGGCCTGG + Exonic
1112370288 13:98787887-98787909 ATTCAGGGGAGCGTCTGGGCTGG - Intergenic
1118452437 14:65916373-65916395 AGTGAGGGGGTCCTATGGCCAGG + Intergenic
1122264191 14:100539083-100539105 TTGTAGGGGGGCCGCGGGCCTGG + Exonic
1122833882 14:104421616-104421638 ATTTAAGGGGACCTCTGGGAGGG - Intergenic
1124135731 15:27034736-27034758 ATTTACAAGGGCCTCTGGACTGG - Intronic
1124999089 15:34753077-34753099 ACTCAGGGGGGTCTCTGTCCAGG + Exonic
1125548405 15:40525783-40525805 ATACTGGGTGGCCTCTGGCCTGG + Intergenic
1126168194 15:45671680-45671702 ATGTAGCTGGGCCTCTGGCAGGG + Intronic
1128364368 15:66986932-66986954 CTTTTGGGGAGGCTCTGGCCAGG - Intergenic
1129735963 15:77963694-77963716 ATTTAGGGTGGGGTCTAGCCAGG + Intergenic
1129787371 15:78318787-78318809 CCTTTCGGGGGCCTCTGGCCTGG - Intergenic
1132237334 15:100232157-100232179 ATCTAGAGCTGCCTCTGGCCAGG - Intronic
1135658366 16:24271588-24271610 ATTTAGGGGGACCTACAGCCTGG + Intronic
1136515294 16:30764619-30764641 CTCCAGAGGGGCCTCTGGCCAGG - Intronic
1139550484 16:67670097-67670119 TTTTAAGGGGCCCTCTGGCTAGG - Intergenic
1142178905 16:88657751-88657773 ATTGAGGTGGGCCACTGCCCTGG + Intronic
1142638606 17:1272140-1272162 AGTGAAGGGGGACTCTGGCCAGG + Intergenic
1144747810 17:17627194-17627216 ATTGAGTGAGGGCTCTGGCCTGG - Intergenic
1145774586 17:27519145-27519167 ATTTAGGGCAGCCTCTGTTCAGG - Intronic
1146925543 17:36742466-36742488 AGTTAGAGGGGCCTCAGCCCGGG - Intergenic
1147520600 17:41168618-41168640 ACTCAGTGTGGCCTCTGGCCTGG + Intergenic
1148385009 17:47228057-47228079 ATTTAAGGGGGGCTCTGGCCTGG + Intergenic
1150294075 17:63998612-63998634 GGTTAGGGAGGCCACTGGCCGGG + Intronic
1152294092 17:79456664-79456686 ACTCAGGAGGGGCTCTGGCCTGG - Intronic
1152721052 17:81924000-81924022 GTCTAGAGGGGCCTCGGGCCAGG - Intronic
1154218427 18:12432321-12432343 AGGCAGCGGGGCCTCTGGCCGGG + Intergenic
1156460946 18:37321021-37321043 ATCTAGGGGAGCCTAGGGCCAGG + Intronic
1157558482 18:48629211-48629233 ATTTTGGGGGTCCACAGGCCAGG - Intronic
1159739923 18:72154761-72154783 ATTGTGGGTGGGCTCTGGCCTGG - Intergenic
925126527 2:1461155-1461177 AGGTTGGGGGGCCTCTGGCCAGG + Intronic
935019659 2:99217444-99217466 AATTTGGGGGGCCACTGGCAGGG + Intronic
937315733 2:120930984-120931006 ATTTCTGTGGGCCTCTGGCTGGG - Intronic
940780774 2:157931550-157931572 GTTTGAGGGAGCCTCTGGCCTGG - Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
944717820 2:202392695-202392717 AGTTAAGGGAGCATCTGGCCGGG + Intronic
945115257 2:206401970-206401992 ATTTAGAGGGTCCTGTGGCCTGG + Intergenic
946139070 2:217672772-217672794 GTTTAGAGAGGCCACTGGCCTGG - Intronic
946158796 2:217823559-217823581 GTCTAGAGAGGCCTCTGGCCTGG - Intronic
946456578 2:219831576-219831598 ATTTAGCAGGGTCTTTGGCCTGG + Intergenic
948944163 2:241211082-241211104 TTTTAAGGGGGCCTCTGGGGAGG - Intronic
948976066 2:241464529-241464551 CTTTAGGGGGGACTCTGCTCTGG - Intronic
1173191653 20:40881483-40881505 GTTTACGGAGGCCTCTGTCCTGG - Intergenic
1174487933 20:50872879-50872901 TTTCAGGAGGGCCACTGGCCTGG - Intronic
1175965047 20:62656204-62656226 ATCCAGGGTGGCGTCTGGCCAGG - Intronic
1177477474 21:21643320-21643342 ATTTAGGTGGAACTGTGGCCAGG - Intergenic
1181668678 22:24415312-24415334 AGTTACGGGGGCCCCTTGCCTGG + Exonic
1181755929 22:25024783-25024805 ATTTGGGGTGTCCTCTGGCGGGG + Intronic
1182719574 22:32386531-32386553 ATATAGGGGAGGCTATGGCCAGG + Intergenic
951713373 3:25610137-25610159 ATTGCGGTGAGCCTCTGGCCTGG + Intronic
957186314 3:76946294-76946316 ATTTAGGTGGTTCTCTGTCCAGG + Intronic
961577707 3:127851686-127851708 ATTCAAGAGGGCCTCTGGTCTGG + Intergenic
962605127 3:137026449-137026471 GCTTAGGGAGGCCTCTGGCATGG + Intergenic
963492836 3:146022478-146022500 ACTTTGGGGGGCTACTGGCCAGG - Intergenic
964028699 3:152110510-152110532 ATTAAGGGGAGCATCTGCCCAGG + Intergenic
970440001 4:16072542-16072564 AGTTAGCTGGGCCTATGGCCAGG - Intronic
974549028 4:63348913-63348935 AGTAAGGGTGGCCTCTGCCCGGG + Intergenic
978287325 4:107094659-107094681 ATTTAGGAGCGCTTGTGGCCTGG - Intronic
979187813 4:117820383-117820405 ATTTGGGGTTGCCTCTGGCAGGG + Intergenic
980550752 4:134330993-134331015 ATTTAGTGTAGCCTCTGGTCAGG + Intergenic
983179822 4:164634575-164634597 ATTTATTGGAGGCTCTGGCCAGG + Intergenic
985961421 5:3306046-3306068 ATTAAGAAGGGCCTCTGGTCTGG - Intergenic
987313719 5:16704462-16704484 ATTGAGGGGAGCCTCAGGTCAGG - Intronic
991137705 5:63202184-63202206 CTATAGGGAGGCCTCTGGCCAGG + Intergenic
997392755 5:133530684-133530706 TTTTAGGTGGACCTATGGCCAGG + Intronic
999291674 5:150429975-150429997 ATTTAAGGGGGCCGGAGGCCAGG + Intergenic
1002652469 5:180710233-180710255 TTTGAGGAGGGCCTCTGCCCGGG + Intergenic
1005994272 6:30922066-30922088 CTTGAGGGGGGCCTGGGGCCTGG + Intronic
1007147479 6:39650249-39650271 ATTTAGAGAGCACTCTGGCCTGG - Intronic
1008868753 6:56247322-56247344 ATCTCGGGGGGCCTCAGGGCTGG - Intronic
1018155673 6:160983323-160983345 ATCCAGCGGGGCCTTTGGCCTGG - Intergenic
1018330298 6:162720333-162720355 CTTTATGGGGGCCTCTGTTCAGG + Intronic
1018469848 6:164085611-164085633 CTTTAGGGCAGCCACTGGCCGGG - Intergenic
1018472058 6:164106191-164106213 AATTAGCAGTGCCTCTGGCCGGG - Intergenic
1020186448 7:5962786-5962808 AGTCAGGGGGGCTTCTGGGCAGG - Intronic
1020296466 7:6761988-6762010 AGTCAGGGGGGCTTCTGGGCAGG + Intronic
1026889726 7:73974855-73974877 AGAGAGGGGGGCCTCAGGCCAGG - Intergenic
1029278016 7:99419014-99419036 CTTCAGGGGGGCCTCTGGGCTGG - Exonic
1034333326 7:150302898-150302920 ATGTTAGGGAGCCTCTGGCCAGG - Exonic
1034664717 7:152806995-152807017 ATGTTAGGGAGCCTCTGGCCAGG + Intronic
1034746690 7:153529445-153529467 TTTTAAGAGGACCTCTGGCCTGG - Intergenic
1034956406 7:155338129-155338151 ATGTAGGAGGGCCGGTGGCCAGG + Intergenic
1034956480 7:155338459-155338481 ATGCAGGGGGGCCAGTGGCCAGG + Intergenic
1036382791 8:8248968-8248990 ATTTCTGGGGGTGTCTGGCCAGG + Intergenic
1036673814 8:10812427-10812449 ATTTAGCTGGGACTCTTGCCTGG + Intronic
1045701881 8:104876217-104876239 ATTTAGGGTGGCATTTGGCTGGG - Intronic
1049850892 8:144829541-144829563 CTGTAGAGGGCCCTCTGGCCAGG - Exonic
1055207180 9:73746547-73746569 ATAAAGGGGGGCTTCTGGACAGG - Intergenic
1057874343 9:98742680-98742702 ATTGAGTGGTGCCTTTGGCCTGG + Intronic
1057959448 9:99440368-99440390 ATTAAGAGGGGCTTCTGGCTAGG + Intergenic
1194815757 X:98439717-98439739 AATTAGGGAAGCCTATGGCCTGG + Intergenic
1200158024 X:153988174-153988196 AATTAGGCTGGGCTCTGGCCAGG - Intergenic