ID: 1085328538

View in Genome Browser
Species Human (GRCh38)
Location 11:75627497-75627519
Sequence CTGGCCAAACAGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085328533_1085328538 10 Left 1085328533 11:75627464-75627486 CCATGTCTGTATGTGTCTTTGTG 0: 1
1: 1
2: 13
3: 193
4: 3056
Right 1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085328538 Original CRISPR CTGGCCAAACAGTAGGAGGA GGG Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
904417674 1:30373119-30373141 CTGGCCAGTCACCAGGAGGATGG - Intergenic
905120581 1:35678761-35678783 CTAGCCGAACAGTAGGAGCAAGG - Intergenic
905800484 1:40839275-40839297 GTGGCCACCCAGCAGGAGGAGGG - Exonic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908003723 1:59707382-59707404 GAGGCCAAGCTGTAGGAGGAGGG + Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911940338 1:104038202-104038224 TTGGACATACAGTAGGAGAAAGG - Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
920067367 1:203278417-203278439 GTGTCCAAACAGCAGCAGGAAGG - Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
1062859515 10:799595-799617 ATGGCCACACAATAGGAGTAGGG + Intergenic
1063463690 10:6229942-6229964 CGGGCCACACAGCAGGAGGTGGG - Intronic
1066127295 10:32354188-32354210 CTTAGCAAACAGTAGCAGGATGG + Intronic
1069625100 10:69862966-69862988 CAGGCCAAACTGTAGAAGAATGG + Intronic
1069806894 10:71131886-71131908 CTGGCCCCACCTTAGGAGGAGGG - Intergenic
1069865755 10:71501827-71501849 CCGGCCAGCCAGGAGGAGGAGGG + Intronic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1075733343 10:124649323-124649345 CTGGTCCAACAATAGCAGGAAGG - Intronic
1078139342 11:8680860-8680882 GTGACCAAAGAGTAGGAGGAAGG + Intergenic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079016948 11:16877073-16877095 CTGGCCTAAAAGTCTGAGGAGGG + Intronic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1081504430 11:43700514-43700536 ATGGACAGACAGTAGAAGGATGG - Intronic
1082000861 11:47393168-47393190 CTGGCCAGGCAGTGGGAGGTGGG + Intergenic
1082188354 11:49211115-49211137 CTGGCCAGACAGCAGAGGGAAGG - Intergenic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084801233 11:71545587-71545609 CTGGCCAGGGAGTAGGAGAAGGG - Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1086678167 11:89635528-89635550 CTGGCCAGACAGCAGAGGGAAGG + Intergenic
1087483729 11:98734467-98734489 CTGGCCAGGCAGTGGGAGGGTGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089189483 11:116643765-116643787 CTGGCCACACAGAAGGTGGGTGG + Intergenic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1090424645 11:126598946-126598968 CTGGCCAAACAATGGGAGGGAGG - Intronic
1091138538 11:133215758-133215780 CTGGCCACACTGCAGGTGGAAGG - Intronic
1091346423 11:134857212-134857234 CTGGCCAGAAAGCAGGAGGAGGG + Intergenic
1096117009 12:49060600-49060622 CCGGCCGAACAGGAGGCGGAGGG - Intergenic
1096273830 12:50188785-50188807 CTGGCCAAGCAGTTGAACGAGGG + Intronic
1096653801 12:53075848-53075870 CTAGCCCAAGAGTAGGGGGAGGG + Intronic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1099599448 12:84714157-84714179 ATGGGCAAAGAGTAGAAGGATGG + Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100893568 12:99154361-99154383 CTGTCCAAACAGTGGGACAATGG - Exonic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1103717376 12:122952914-122952936 CTGTCCACACAGTAGAAGGCAGG + Intronic
1105660417 13:22487999-22488021 TGGGCCAAATAGGAGGAGGAGGG + Intergenic
1107015725 13:35706564-35706586 CTGGCCAGCAAGTGGGAGGATGG + Intergenic
1107898611 13:44989881-44989903 CTTCCCAAACAGTAGCAGGGGGG + Intronic
1110064880 13:71091147-71091169 CTGACCAAACAGGAGCAGCAGGG + Intergenic
1110283834 13:73726444-73726466 CTTGCCAAGGACTAGGAGGAAGG - Intronic
1112696337 13:101953087-101953109 CTGGCCAAATAGTAGAGGGAGGG - Intronic
1113143923 13:107186033-107186055 CTGGCCAAAATGGAGCAGGATGG - Intronic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117339027 14:54778169-54778191 CTGGCAAAAGAGTGGCAGGAAGG - Intronic
1118452102 14:65912592-65912614 CTTCCCAAACAGTAAGTGGAGGG + Intergenic
1119430681 14:74566547-74566569 CTGGCCAGACAGGAGGAGAAAGG - Intronic
1122142664 14:99672179-99672201 CAGGCCACACAGTAGGTGCATGG + Intronic
1122616546 14:103021927-103021949 CTGGCCAAGCACTAGGACGCTGG + Intronic
1125400004 15:39291930-39291952 GGGGCCTACCAGTAGGAGGAGGG - Intergenic
1126034041 15:44530969-44530991 CTGGCCAGACAGGAATAGGAAGG + Intergenic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1130004763 15:80084478-80084500 CTGGCCAAGAAGTGGGAGGGAGG + Intronic
1130758040 15:86786868-86786890 CTGGCAAAACAGTAGTACAAGGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1135863189 16:26076257-26076279 CTGGCAATTCAGTAGGAGCACGG + Intronic
1138225089 16:55287129-55287151 CTGGCCACAAAGTAGGAAGGGGG + Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1141152551 16:81574272-81574294 GTGGCCAAGCAGTTGGAGGAGGG - Intronic
1141179871 16:81745224-81745246 CCGGCCAATCAGTGGGAGGGAGG - Intronic
1141569815 16:84927844-84927866 CTGGACAAACACTTGGAGTAGGG - Intergenic
1143244990 17:5476825-5476847 CTGCCCAAACATTAGCAGGATGG + Intronic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1150285157 17:63950116-63950138 CTGGCCCAGCAGGAGGAGGTGGG - Intronic
1151728553 17:75897991-75898013 CTGGCTAACTAGTAGGTGGAGGG - Intergenic
1151934355 17:77252970-77252992 CTGGCCAATAATTAGCAGGAGGG + Intergenic
1151979314 17:77499299-77499321 CTGGCCAAGCAGTCTGCGGATGG - Exonic
1159874916 18:73800155-73800177 CTGGCCAAAGAATTGGAAGATGG + Intergenic
1161915244 19:7223471-7223493 CTGGCTAACCAGTAGCAGGTGGG + Intronic
1162017522 19:7853484-7853506 CTGGCCTAACAGGTGAAGGACGG - Intronic
1162202664 19:9032419-9032441 CTGGCCAGCCAGTAAGAGCAGGG - Intergenic
1166944566 19:46388955-46388977 CTGGGCAATCAGTGGGAGAAAGG - Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
928251660 2:29686380-29686402 ATGGCCAAACCTTAGGAGGTGGG + Intronic
928283434 2:29968554-29968576 CTGGCCAAAGAGAAGAAGGTGGG + Intergenic
932452047 2:71817248-71817270 TTGGCCAAAGAGTAGGAGATAGG + Intergenic
932786288 2:74607168-74607190 GTGGTCAAACAGTTGGAGGAAGG - Exonic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936631658 2:114209751-114209773 CTGAACAAACAGTAGGTGCATGG - Intergenic
937771878 2:125728982-125729004 CTGACCAAACAGCAGGATGTGGG + Intergenic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
941547323 2:166868252-166868274 CTGGCCACACAGCAGGAGAGCGG + Intergenic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
1172307428 20:33890954-33890976 CTATCCAAACAGTGGGAGGTGGG - Intergenic
1173616103 20:44403898-44403920 CTGGCCATTCAGCAGGAGGCTGG - Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1174872826 20:54199450-54199472 CTGGCTGAACAATAGGAGAAAGG + Intergenic
1175133704 20:56807813-56807835 TTGGCAAATGAGTAGGAGGAAGG - Intergenic
1175420485 20:58829349-58829371 CTGGCCACAGAGTACGGGGATGG - Intergenic
1175903380 20:62368591-62368613 CGGGCCGGAAAGTAGGAGGAGGG - Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1177098184 21:16865716-16865738 CTGGCCAAACATCAGGAACAAGG - Intergenic
1180235174 21:46454666-46454688 GTGGCCAAACACCAGGAAGAAGG - Intergenic
1181133481 22:20748459-20748481 CTGGCCACCCAGTGGGAGAAGGG + Intronic
1182349675 22:29692260-29692282 CTGCCCACACAGAAGTAGGAAGG - Intronic
1183300526 22:37056885-37056907 CTGGCCAGTCTGCAGGAGGAGGG + Intronic
1183859492 22:40659424-40659446 CTGGCCAAACTGAAGAATGAAGG + Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185227212 22:49659944-49659966 CTGGCCCAGAAGTAGGACGAGGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952151257 3:30595085-30595107 CTAGCCAAACATTAGGAAAAAGG - Intergenic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
956502058 3:69897369-69897391 CTTGCCAGACAGAAGGAAGAAGG + Intronic
956610953 3:71122409-71122431 CTGGCCAAATATTAGGATGGGGG + Intronic
958064725 3:88528778-88528800 CTAGCAAAGCAGTAGGGGGAGGG + Intergenic
960744496 3:120872176-120872198 CTGGCCAATCAGCAAGAGAAAGG - Intergenic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
967358118 3:188596388-188596410 TTTGCCACAGAGTAGGAGGAAGG - Intronic
967687800 3:192437856-192437878 GTGGGCAAAGAGTAGGAGGCAGG - Intronic
968215858 3:196889767-196889789 CTGGGCAAAAAGTAGAGGGAAGG + Intronic
968356016 3:198108043-198108065 CTGGCCAAACTGGGGAAGGAGGG + Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969320492 4:6409605-6409627 CTGGCCAGAGAGTAGCAAGAGGG + Intronic
970424855 4:15936582-15936604 CTGAGCAGCCAGTAGGAGGAAGG + Exonic
970475001 4:16413036-16413058 GTGGCCACACAGCAGGAGGATGG - Intergenic
971642277 4:29149701-29149723 CTGGCCCTACACTAGGAGGAAGG + Intergenic
976783665 4:88791026-88791048 CTGGCCTAAGAGGAGAAGGAAGG - Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
978216321 4:106208738-106208760 CTTGCCAAACAATGGGAGAAGGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984281388 4:177674854-177674876 CTGGCCTAAGAGGAGGAGGTTGG + Intergenic
987017854 5:13838329-13838351 CGGGCCACACAGCAGGAGGTGGG + Intronic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
992582737 5:78198445-78198467 CTGTCCACACACCAGGAGGAGGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
997631620 5:135373148-135373170 CTGCCCAAAACGTTGGAGGAAGG + Intronic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998848947 5:146336737-146336759 CTTGCCAAGCAGTAGAAGGGAGG - Intronic
999257129 5:150215982-150216004 CTGCCCAATCACTAGGAGTAGGG + Intronic
1000736947 5:164915413-164915435 TTGGGCAGAGAGTAGGAGGAAGG + Intergenic
1002059147 5:176616159-176616181 GTGGGCACACAGTAGGAGGTAGG + Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003850780 6:10220450-10220472 CGGGCCACACAGCAGGAGGCGGG - Intergenic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004480794 6:16017602-16017624 CTCCCCAACCAGTAGGATGATGG - Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006363316 6:33599668-33599690 CTGGCCAAACAGTAGGGACTGGG - Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007731430 6:43949997-43950019 TTGGCCAAATAGAAGGAGGTGGG - Intergenic
1008580801 6:52904800-52904822 CTGCTCAAACACTGGGAGGATGG + Intronic
1010550109 6:77211416-77211438 CTGGCCACACAGCAGTAGAATGG + Intergenic
1012143771 6:95656003-95656025 AAGGCCAAAAAGTAGGAAGAAGG + Intergenic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1013041003 6:106433324-106433346 CTGGTCAAACTGGAGGAGAAAGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1016063854 6:139658510-139658532 CTGGCCATACAATTGGAGAAAGG + Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1023822214 7:43986562-43986584 CCGGTCAAACAGTAGGGGCAGGG - Intergenic
1024737413 7:52320560-52320582 CTAGCCAAGCAGTAGATGGAAGG - Intergenic
1027140168 7:75651098-75651120 CTGCCCACACAGGAGGAGGGAGG + Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029750480 7:102539976-102539998 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1029768432 7:102639084-102639106 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1029995757 7:105006491-105006513 CTGGCCATAAAGTAGGAGCATGG + Intergenic
1030848621 7:114455051-114455073 CTGGCAAAAAAGTAGGATTAGGG - Intronic
1032515195 7:132501655-132501677 CTGGCCAAAAAGAGGGAGGTGGG + Intronic
1033025050 7:137764189-137764211 CTGGACAAAGAGTCAGAGGAGGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037786973 8:21909088-21909110 GTGGAAAAAGAGTAGGAGGAGGG + Exonic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1047710387 8:127545908-127545930 CCAGCCAAAGAGTTGGAGGAGGG + Intergenic
1048467989 8:134683528-134683550 GTGGCCAGACAGCTGGAGGAAGG + Intronic
1049671391 8:143871653-143871675 CTGGCCCAGCAGTACCAGGAAGG - Exonic
1055416619 9:76091095-76091117 CCGGCCACACAGCAGGAGGTGGG - Intronic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1187787918 X:22914107-22914129 CTTGCCTAATAGTAGAAGGATGG - Intergenic
1189630150 X:42943850-42943872 CTGGTCAAACAGTTACAGGAGGG + Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1192530665 X:71881049-71881071 CTGGACACAGAGTAGAAGGATGG + Intergenic
1198402652 X:136282360-136282382 CTGGCCAGACAGGAGCAGGCAGG + Intergenic
1200068005 X:153514232-153514254 CTGTCCCAACAGTGGCAGGAGGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic