ID: 1085330821

View in Genome Browser
Species Human (GRCh38)
Location 11:75649431-75649453
Sequence GGGAAGAAGCAGAATGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085330810_1085330821 12 Left 1085330810 11:75649396-75649418 CCTCTTTATAACAGTGATGACTG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG 0: 1
1: 0
2: 2
3: 48
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085330821 Original CRISPR GGGAAGAAGCAGAATGGGTC TGG Intronic
900105934 1:981050-981072 GGAGGGTAGCAGAATGGGTCCGG + Intronic
900269872 1:1781553-1781575 GGCAAGAAGCAGAATTGGTGGGG + Intergenic
900306177 1:2009650-2009672 GGGAGGAAACAGAATCGGGCTGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
902181339 1:14690902-14690924 AGGAAGAATAAGAATGGATCAGG - Intronic
902409510 1:16204925-16204947 GGGATGGAGAAGGATGGGTCAGG + Intronic
902721336 1:18306305-18306327 GGGTAGAAGAAGAATGTATCTGG - Intronic
902764686 1:18606437-18606459 TGGAAGAAGCAGGAGGGGTGGGG + Intergenic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
902873880 1:19329557-19329579 AGGAAGAAGCAGAATGGTTAAGG + Intergenic
903066196 1:20701012-20701034 GGGAAGCACCAGCATCGGTCTGG - Intronic
903448672 1:23438053-23438075 TGGAAGCAGGAGAGTGGGTCTGG - Intronic
904709765 1:32421118-32421140 TGGAAGAAGCAGAAAGGGATGGG + Intergenic
905395726 1:37665211-37665233 TGGAAGAAGCAGACAGGGTGGGG - Intergenic
905874933 1:41426599-41426621 GGGAAGAATCAGAAAGGGTCTGG + Intergenic
906108084 1:43306583-43306605 GGGGAGAAGCGGACTGGGTTAGG + Intronic
906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG + Intergenic
907110157 1:51919867-51919889 AGGGAGAAGCAGACTGGGTGTGG + Exonic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
908018830 1:59878535-59878557 TGGAGGGAGCAGAATGGGTTTGG - Intergenic
908200725 1:61792823-61792845 GTAAAGAAGTAAAATGGGTCAGG - Intronic
908921188 1:69194727-69194749 GGGAAGAAGAACATTTGGTCAGG - Intergenic
911398090 1:97337364-97337386 GGGAGGAAGCAGAATTCCTCAGG + Intronic
911827731 1:102508675-102508697 GAGATGAATCAGATTGGGTCAGG + Intergenic
912354353 1:109042380-109042402 GGGGAGTAGCAGAACGGGTGCGG + Intergenic
912492563 1:110070283-110070305 AGGAAGAAGAAGAGAGGGTCGGG + Intronic
912551112 1:110485933-110485955 GGGAAGAAAGTGAATGGCTCAGG - Intergenic
913384196 1:118241800-118241822 GGGAAGCAGCAGCATGAGTTAGG - Intergenic
914195504 1:145446207-145446229 GGATAGAAGCAGCATGGGGCTGG - Intergenic
914394438 1:147251307-147251329 GTGAAGAAGCAGACTGGCTAGGG - Intronic
914927063 1:151897915-151897937 GGGAAGCAGCAGAAAGGCCCTGG + Intronic
915141317 1:153770403-153770425 GGGAAGGAGGACAATGGATCTGG - Intronic
915267458 1:154729158-154729180 GGGAGGAAGCAGGATGGGAAAGG + Intronic
916167275 1:161975404-161975426 GGCAAGAAGCAGGCTGGCTCTGG - Intergenic
916471127 1:165123780-165123802 GGAAAGAAGGAGAATGATTCAGG + Intergenic
917057984 1:171004413-171004435 GGGAAGCAGCAGAAAGGCCCTGG - Intronic
917837331 1:178951854-178951876 GGAAACAATCAGAATGGGTCTGG - Intergenic
918233826 1:182559539-182559561 GGGATGAAGCAGAGTGTGTTGGG - Intronic
918590607 1:186237016-186237038 GCGAAGAAGCAGAGTGTGTGAGG + Intergenic
921911443 1:220553485-220553507 GGGGAGCAGGAGTATGGGTCAGG + Intronic
922930565 1:229385995-229386017 GAGAAGAACCAGCGTGGGTCAGG + Intergenic
923419528 1:233798809-233798831 AGGAGGTAGCAGAATTGGTCTGG + Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923496872 1:234533393-234533415 GGGAAGAAGCAGGATTGGACTGG + Intergenic
1063601155 10:7482670-7482692 GAGAAGAAGCAGCCTGAGTCTGG - Intergenic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064099723 10:12453030-12453052 GGGAGAAAGTAGAATGGGGCTGG - Intronic
1064452225 10:15452964-15452986 TGGAGGAAGAAGAATGGGGCTGG + Intergenic
1065603242 10:27391218-27391240 GGGAAGATGAAGAATGGGGTTGG + Intergenic
1066571552 10:36778601-36778623 GGTCAGAAGCAGAATGGGAGAGG - Intergenic
1066755044 10:38703218-38703240 GGGAAGCAGCACAAGTGGTCGGG + Intergenic
1067526468 10:47042256-47042278 GGGCAGAAGGACAAAGGGTCAGG + Intergenic
1067940567 10:50651482-50651504 GGGAAGAGGCATGATGGGGCAGG - Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068553818 10:58435574-58435596 GGGAAGAGGAAGAATGAATCAGG + Intergenic
1069322895 10:67195027-67195049 GGGAAGAATCAAAATGTGTCTGG + Intronic
1070380168 10:75874033-75874055 GGGATGAAGAAGAAGGGCTCAGG - Intronic
1070871296 10:79755825-79755847 GGAAGGAAGCAGAATAGGACAGG + Intergenic
1071132577 10:82411999-82412021 GTCAAGAAGAAGAATGAGTCTGG + Intronic
1071150144 10:82624417-82624439 GGGAAAAAGGAGAATGGTTAAGG - Intronic
1071638232 10:87278033-87278055 GGAAGGAAGCAGAATAGGACAGG + Intergenic
1071657012 10:87459919-87459941 GGAAGGAAGCAGAATAGGACAGG - Intergenic
1072278099 10:93842292-93842314 GGGAAGCAGCAGCGTTGGTCAGG - Intergenic
1072459605 10:95607004-95607026 GGAAAGCAGCAGGGTGGGTCTGG - Intronic
1077778648 11:5300341-5300363 GGGAAGAAGGAAAACGGGGCTGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078738178 11:14041185-14041207 GGGAAGAAGGAGGATGGGGGAGG - Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079013104 11:16845839-16845861 GGGGAGGAGCAGACAGGGTCTGG + Intronic
1079231205 11:18650273-18650295 GGGACTGAGGAGAATGGGTCTGG + Intergenic
1080614761 11:33936144-33936166 CGTAGGAAGCAGTATGGGTCTGG + Intergenic
1081457236 11:43235909-43235931 GGGAAGAAACACACTGGATCTGG + Intergenic
1083006441 11:59351190-59351212 TGGCAGAGGCAGAATGGCTCTGG + Intergenic
1083071381 11:59986729-59986751 GGGAATAAGCAGAATAGATTTGG + Intergenic
1083780192 11:64913712-64913734 GGGAAGAGGCAGGGTGGATCTGG - Intronic
1084724005 11:70928611-70928633 GGGAAGAGGAAGACTGGGTGGGG + Intronic
1085047314 11:73360998-73361020 GGGAGGAAGGGGAATGGGGCAGG + Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1086915580 11:92526430-92526452 TGGAAGAAGCAGAATCTGACTGG - Intronic
1087058938 11:93959860-93959882 GGAAAGAACCAGAATAGGCCAGG - Intergenic
1087475577 11:98629686-98629708 GGTAAAAAGCAGAATAGGCCAGG - Intergenic
1088592124 11:111412902-111412924 GGGGAGAAGGAAAATGGGTTGGG + Intronic
1088693498 11:112347310-112347332 GGGAAGAAGAAGAATGGCAATGG - Intergenic
1090083096 11:123627405-123627427 GGGAAAAAGCACCATGGGTTTGG - Intronic
1091311758 11:134579879-134579901 GGGAAGAGGGACAATGGGGCTGG + Intergenic
1091562149 12:1623004-1623026 GGGGAGAAACAGGATGGGTTTGG + Intronic
1091590374 12:1839155-1839177 GGGACGGAGCAGACAGGGTCAGG - Intronic
1091726188 12:2848290-2848312 GGGAAGAAGCTGAAATGGTGGGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093870150 12:24281364-24281386 GGGAAAATGCAGATTGGGGCTGG - Intergenic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094657103 12:32430909-32430931 GGGAAGGAGGAGAAGGGTTCTGG + Intronic
1095054384 12:37582265-37582287 GGGAACATGGAGAATGTGTCAGG + Intergenic
1095864483 12:46956615-46956637 GGGAAGAAGGAAACTGGGTGGGG + Intergenic
1096801253 12:54112150-54112172 AGGAATGAGCACAATGGGTCTGG + Intergenic
1098906719 12:76170112-76170134 TGCCAGAAGCACAATGGGTCAGG - Intergenic
1098934270 12:76459942-76459964 AGGAAGAAGCAAAATGCATCAGG + Intronic
1099451514 12:82813491-82813513 GAGAATAAGCAGAATGGTTAAGG - Intronic
1100192710 12:92209782-92209804 GGAAGGAAGCAGAATGGGATGGG - Intergenic
1101406687 12:104435034-104435056 AGGAAGAAGAAGGATGGATCTGG - Intergenic
1101833514 12:108278227-108278249 TGGAAGAAGGGGAATGGGTTAGG - Intergenic
1102453040 12:113055826-113055848 GGGAAGATGAAGGATGCGTCCGG - Intergenic
1103328917 12:120140383-120140405 GGGAGGAAGCATATTGCGTCTGG - Intronic
1107285135 13:38781966-38781988 GGGCAAAAGCAGAGTGGGCCAGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107666328 13:42694315-42694337 GGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1107828616 13:44353615-44353637 AGGAAGAAGTGGAATGGGACTGG + Intergenic
1109392720 13:61713597-61713619 TGGAAGAGGCAAAAAGGGTCTGG - Intergenic
1110549211 13:76792905-76792927 GGCAGGAAGCAGAATGAGCCAGG + Intergenic
1111733327 13:92104172-92104194 TGGATGAAGCAGAATGGGTTTGG - Intronic
1112214830 13:97419439-97419461 GGGAATAATCACAACGGGTCAGG - Intergenic
1112250944 13:97779859-97779881 GAGAAGATGAAAAATGGGTCAGG + Intergenic
1113129355 13:107018305-107018327 GGGAAGAAGGATAATAGATCTGG + Intergenic
1113301994 13:109032394-109032416 GGGAAGAAGCACAAAGGATGGGG - Intronic
1113412759 13:110104937-110104959 GGGAAGGAGCAGGCTGTGTCGGG - Intergenic
1114633335 14:24173287-24173309 AGGAAGCAGCAGGCTGGGTCTGG - Exonic
1115361438 14:32507828-32507850 GGCAAGAACCAGAATGAGTCAGG + Intronic
1115682813 14:35760566-35760588 GGGAAGCACCAGAGTTGGTCAGG - Intronic
1116785973 14:49289168-49289190 GGGAAGAGAAAGGATGGGTCAGG - Intergenic
1117624143 14:57618417-57618439 CCCAAGAAGCAGAAGGGGTCGGG + Intronic
1118078557 14:62329960-62329982 GGGAAGAAGGAGAATGTGCTAGG + Intergenic
1118162214 14:63301898-63301920 AGGAAGAAGCAGAAAGGCCCTGG + Intergenic
1119158143 14:72430427-72430449 GGGAAGAAACTGCAGGGGTCAGG + Intronic
1119542441 14:75449510-75449532 GGTGAGAAGCAGAATGCATCTGG - Intronic
1119670309 14:76513466-76513488 GGGAAGAAGCAGAATTGACCTGG - Intergenic
1119800544 14:77441096-77441118 GGGAAGAAGCAGAAGGGAGCAGG + Intronic
1120212892 14:81651642-81651664 GGGAAGCAGCAGACTGATTCTGG - Intergenic
1120701623 14:87704860-87704882 TGGAAGAAGCAGAGTTGGCCTGG - Intergenic
1121472635 14:94167186-94167208 TGAAGGAAGCAGAATGGGTGAGG + Intronic
1121739538 14:96241760-96241782 GGGAAGGAGCAGGCTGGCTCAGG - Exonic
1121881710 14:97506779-97506801 GGGAAGCACCAGATTTGGTCAGG + Intergenic
1122359934 14:101153112-101153134 GGTAAGAAGGACAATGGGGCAGG - Intergenic
1123132304 14:105998649-105998671 GGGAAAAAGAGGAATGGGTGGGG + Intergenic
1123582523 15:21729761-21729783 GGGAAAAAGAGGAATGGGTGGGG + Intergenic
1123619173 15:22172357-22172379 GGGAAAAAGAGGAATGGGTGGGG + Intergenic
1124198064 15:27650607-27650629 GGGAAGAAGAGGAATGGGGGGGG - Intergenic
1124345241 15:28917922-28917944 AGAAAGGAGCAGAATGGGGCGGG - Intronic
1125277262 15:38006156-38006178 GGGAAGCAGCAGAGTAGATCAGG + Intergenic
1125400784 15:39300468-39300490 GAGAAAAAGCAGATTTGGTCTGG + Intergenic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1125792192 15:42375377-42375399 GGGATGAAGCAGTTTGTGTCAGG + Intronic
1126166775 15:45660194-45660216 AGGAAAAAGCAAAATGGATCAGG + Intronic
1126281473 15:46956516-46956538 GGGAGGAATCAGAAAGGGTTCGG + Intergenic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127531071 15:59843998-59844020 GGGAAGAAACAGAACGTTTCTGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129236363 15:74225959-74225981 GGGAAGATGGAGAATGCGTGTGG + Intergenic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1132208908 15:100005968-100005990 GGGAAGATGCAGGCTGGGGCTGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133768750 16:8855527-8855549 GGGAAGGAGCTGATTGGGCCAGG - Intronic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1133866034 16:9644173-9644195 GGGAAGAAGCTGAAGGGGTGTGG + Intergenic
1133872316 16:9700965-9700987 GGGAAGCAGCAGGGTTGGTCAGG + Intergenic
1135170263 16:20177672-20177694 GGTTAGAAGCAAATTGGGTCTGG - Intergenic
1136272758 16:29158326-29158348 GGGAAGCTGGAGAATGGCTCAGG - Intergenic
1136727633 16:32373623-32373645 GGGAAGCAGCACAAGTGGTCGGG - Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137977270 16:53042328-53042350 GGGGAGAGGCAGAATGGGAGAGG - Intergenic
1139356682 16:66371064-66371086 AGGAGGAAGCAGAAGGGGCCAGG + Intronic
1139682528 16:68576165-68576187 TGGAAGGAGCAGAATAGGTTTGG + Intergenic
1140583370 16:76257238-76257260 GGAAAGAAGCATAATGAGTTGGG - Intergenic
1140851039 16:78934807-78934829 GAGAAGAAGCAGACTGGGCATGG + Intronic
1141092190 16:81137849-81137871 GGGAAGGAGCAGGGTGGGGCAGG - Intergenic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141585156 16:85028428-85028450 GGGAAGACGCAGAATGGACAGGG - Intronic
1141752800 16:85970374-85970396 GGGAAGAAGAGAAATGGGTGAGG - Intergenic
1142076313 16:88120138-88120160 GGGAAGCTGGAGAATGGCTCAGG - Intergenic
1142153169 16:88521582-88521604 GGGAAGGAACAGCATGGGTTGGG - Intronic
1202998799 16_KI270728v1_random:144127-144149 GGGAAGCAGCACAAGTGGTCGGG + Intergenic
1203130398 16_KI270728v1_random:1680535-1680557 GGGAAGCAGCACAAGTGGTCGGG + Intergenic
1143004775 17:3822880-3822902 GGTAAGATGCAAAATGAGTCTGG + Intronic
1143413463 17:6727058-6727080 GGGAAGAAGGAGCTTGGGTAGGG + Intergenic
1144404513 17:14939840-14939862 GGCAATAAGCAGAAGGGGGCTGG - Intergenic
1144422087 17:15107976-15107998 GGAAAGAAAGAAAATGGGTCAGG + Intergenic
1144944395 17:18962338-18962360 GGGAAGAGGCAGGATGTGTCTGG + Intronic
1145374924 17:22338328-22338350 GGGAACATGGAGAATGTGTCAGG + Intergenic
1146116879 17:30148514-30148536 GGGAAGAACCAGTTTGGATCAGG + Intronic
1146380410 17:32323378-32323400 GGGAGGATGCAGAAGGAGTCAGG + Exonic
1146597099 17:34179024-34179046 GGGAGGAATGAAAATGGGTCTGG - Intergenic
1146677248 17:34781975-34781997 GGGAAGAAGCAGCATGCTTCAGG + Intergenic
1147298413 17:39503716-39503738 GGGAAGAGGCTGGATGGATCAGG - Intronic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1148029825 17:44611850-44611872 GGGAAGAAGTAGAAGTTGTCAGG + Intergenic
1148463979 17:47853595-47853617 GGGAAAAGGCAGAAGGGGCCAGG - Intronic
1151139139 17:71975233-71975255 GGAAAGAGGCAGAAGGAGTCTGG + Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1152021560 17:77782439-77782461 GGGAAGAAGAAGAAAGCGCCTGG + Intergenic
1152370870 17:79887859-79887881 TGGAAGGAGCAGGATGGGACTGG - Intergenic
1153093473 18:1374455-1374477 AGGAAGCACCAGAATAGGTCAGG + Intergenic
1153350642 18:4077578-4077600 GAGAGGAAGCAGGGTGGGTCAGG - Intronic
1154349904 18:13574265-13574287 GGGAAAAAGCAGAATGTGGCTGG + Intronic
1155337833 18:24783537-24783559 GGGATGAAGTAGAAAGGGTAAGG - Intergenic
1156561747 18:38133430-38133452 GGGAAGAGGCAGCATGTGTCAGG + Intergenic
1156788908 18:40948633-40948655 GAGAAGAAACATAATGGATCTGG - Intergenic
1157736360 18:50053295-50053317 GGGAAGGAGGAGATGGGGTCTGG + Intronic
1158206204 18:54995921-54995943 AAGAAGCAGCAGAATGGATCTGG - Intergenic
1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG + Intronic
1158605797 18:58895033-58895055 GAAAAGAAGGAGAATGGCTCAGG - Intronic
1159065506 18:63564486-63564508 GGGAGGAAACAGAAAGGGTTGGG + Intronic
1159588228 18:70302388-70302410 GGGAAGGAGAAGAATGGACCAGG + Intronic
1159956419 18:74521471-74521493 GGGAAGATGCAAGATGAGTCTGG + Exonic
1160134318 18:76259613-76259635 GACAAGAGGCAGAAGGGGTCAGG - Intronic
1162454862 19:10777237-10777259 GGGAAGCAGGAGGATGGGTGGGG + Intronic
1162892343 19:13742930-13742952 TGGATGAGGCAGAATGAGTCAGG - Intronic
1163611255 19:18302948-18302970 GGGAAGGGGCAGAGGGGGTCAGG - Intergenic
1164148742 19:22530559-22530581 GAGAAGCGGGAGAATGGGTCTGG - Intronic
1164462065 19:28457471-28457493 GGGAGGAAGGAAAAGGGGTCAGG - Intergenic
1164809806 19:31147138-31147160 GGGAAGAAGCTGTAGGGGGCTGG + Intergenic
1165081624 19:33310240-33310262 GGGAAGAAGCAGGATGTGAATGG - Intergenic
1165632305 19:37312287-37312309 GGGAACATGGAGAATGTGTCAGG - Intergenic
1166264571 19:41670994-41671016 GGGAAAAAGCAGGGTGGGCCTGG - Intronic
1167008333 19:46789377-46789399 GGGAGGCAGCAGAGTGGGTGCGG - Intergenic
1167530390 19:50012265-50012287 GGGATGAAGAAGAATGGGCCAGG - Intronic
1167786630 19:51643206-51643228 GGGAATAAGTAGAAGGGGTATGG + Exonic
924977899 2:194899-194921 GGGAAGGACCAGCATGGGTGGGG - Intergenic
924982310 2:235369-235391 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982398 2:235631-235653 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982419 2:235694-235716 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982432 2:235735-235757 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982438 2:235757-235779 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982472 2:235858-235880 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982478 2:235880-235902 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982498 2:235943-235965 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982504 2:235965-235987 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982530 2:236044-236066 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982550 2:236104-236126 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982557 2:236126-236148 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982578 2:236189-236211 GGGAGGCAGCAGCATGGGTCAGG + Intronic
924982584 2:236211-236233 GGGAGGCAGCAGCATGGGCCAGG + Intronic
924982591 2:236233-236255 GGGAGGCAGCAGCATGGGCCAGG + Intronic
925285456 2:2712791-2712813 GGGAAGAAGGAAGATGGGTCTGG - Intergenic
925739525 2:6993494-6993516 GGGAACAAGCACGATGGGGCAGG + Intronic
925752795 2:7104847-7104869 GGGAGGAAGCTGATTGGATCAGG + Intergenic
925924072 2:8658162-8658184 GGGAAGAGGCAGCAGGGGCCCGG + Intergenic
926390678 2:12388968-12388990 GAGAAGAGACAGAATGGGACAGG - Intergenic
927291909 2:21412950-21412972 AGCAAGAAGCACAAGGGGTCGGG - Intergenic
927310020 2:21620058-21620080 GGAAGGAAGCAGAATTGGACAGG + Intergenic
930232393 2:48856642-48856664 GGGAAGCACCAGACTGGGACAGG + Intergenic
930690104 2:54353438-54353460 TGGAAGAAGCGGAAGGGGTTTGG - Intronic
930864572 2:56109796-56109818 GGGAAGAATCTGAATGGAGCAGG - Intergenic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
932571066 2:72938640-72938662 GGACAGATGCAGAATGGATCTGG + Intergenic
933224454 2:79729447-79729469 GAGAGGAAGCAGCACGGGTCAGG - Intronic
933567002 2:83962484-83962506 GGGAAGAAGCAGGATAGATCCGG + Intergenic
933773306 2:85757139-85757161 GGGAAGGGGCAGAATGGCTAGGG - Intronic
934318336 2:91947451-91947473 GGGAAGCAGCACAAGTGGTCGGG + Intergenic
936502667 2:113078413-113078435 GGGAAGATGAAGCAGGGGTCAGG - Intergenic
937057757 2:118953892-118953914 GGGAAGCAGCAGAAAGGCCCTGG + Intronic
937069356 2:119050807-119050829 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
937887458 2:126909626-126909648 GGGAAGCACCAGGGTGGGTCAGG - Intergenic
937974045 2:127570375-127570397 GAGAGGAAGCAGCTTGGGTCGGG + Intronic
938575133 2:132596535-132596557 GGCAGGAAGGAGAATGGGACTGG - Intronic
939513424 2:143136057-143136079 GGAAAGAAGCAGGCTGGGTTGGG - Intronic
940306761 2:152235167-152235189 GGGAAGAAGTAGAGGGGGGCAGG + Intergenic
941039544 2:160605070-160605092 GGGAAGCACCAGAGTGGATCAGG - Intergenic
941364865 2:164597998-164598020 GTGAAGAAACAGCATGGTTCAGG - Intronic
941648932 2:168072225-168072247 GGAAAGAAACAGAAAAGGTCTGG + Intronic
942315223 2:174691565-174691587 GGAAAGCACCAGCATGGGTCAGG + Intergenic
944937214 2:204581869-204581891 GGGAAGCAGCAGAGTAGGACTGG - Intronic
945809803 2:214534973-214534995 TGAAAGAAACTGAATGGGTCAGG - Intronic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
947457178 2:230265606-230265628 GGGAAGCAGCGGAAAGGGCCTGG - Intronic
947534604 2:230933068-230933090 GGGAAGAGGCAGGAAGGGGCAGG - Intronic
947976801 2:234373629-234373651 GGGAAGGAACAGAATGGGAGGGG + Intergenic
948323105 2:237086747-237086769 GGGCAGAATCAGAATGCTTCAGG + Intronic
1169096015 20:2899393-2899415 GGGAAGCACCAGGGTGGGTCAGG + Intronic
1169291870 20:4359623-4359645 GGGAAGAAGGAGGATGGGTTTGG - Intergenic
1171131620 20:22658879-22658901 GGGGAGAAGTAGAATGATTCTGG + Intergenic
1171853021 20:30321950-30321972 AGGAATGAGCACAATGGGTCTGG + Intergenic
1172102776 20:32495536-32495558 GGGAGGAAGTTGAGTGGGTCAGG - Intronic
1172324461 20:34023759-34023781 GGGAATAAGGAGACTGGTTCTGG - Intronic
1172324510 20:34024052-34024074 GGGAATAAGGAGACTGGTTCTGG + Intronic
1172659455 20:36557562-36557584 GGGAAGCTGCAGAATAGGCCAGG + Intergenic
1172874186 20:38154365-38154387 GGAAAGAAGCATCATGGGCCAGG - Intronic
1173510330 20:43623048-43623070 GGAAAGAAGCAGATAGGGCCTGG + Intronic
1174386925 20:50192910-50192932 GGGGAGAAGAGTAATGGGTCAGG + Intergenic
1175572032 20:60030707-60030729 GGGAAGAGGCAGAGTGGTTGGGG + Intronic
1176289117 21:5034923-5034945 GGGAAGACCCACAGTGGGTCTGG - Intronic
1176411504 21:6451702-6451724 GGGAAGCAGCAGAGGGAGTCAGG + Intergenic
1176870381 21:14079039-14079061 GGGAAGAAGCACCGTGGCTCGGG + Intergenic
1177734364 21:25070473-25070495 GGGCAGAAGTAGAATGTGACAGG - Intergenic
1179686998 21:43060024-43060046 GGGAAGCAGCAGAGGGAGTCAGG + Intronic
1179868118 21:44228681-44228703 GGGAAGACCCACAGTGGGTCTGG + Intronic
1180907683 22:19426331-19426353 GGCAAGAGGGAGAATGGGGCTGG - Intronic
1181443807 22:22953080-22953102 GAGAAGCAGCAGCATTGGTCAGG + Intergenic
1181585318 22:23849764-23849786 GGGAAGAAGCTGAACGGGGGCGG + Intergenic
1182544202 22:31064166-31064188 AGGAAGAAGCAGAACTGGGCAGG + Intronic
1182558885 22:31143512-31143534 GGGAAGAAGCAGGACTGGGCAGG + Intergenic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1183304334 22:37074300-37074322 AGGAAGGAACAGAATGGGTGAGG - Intronic
1183378896 22:37480772-37480794 AGGAAGGAGAAGAAGGGGTCAGG + Intronic
1184039829 22:41936213-41936235 GGAGAGAAGCAGAGTGGGGCTGG + Intergenic
1184042091 22:41950351-41950373 GGGAAGAATCACAAAGGGGCAGG - Intergenic
1184255629 22:43285332-43285354 GGGCAGAGCCAGGATGGGTCTGG - Intronic
1184390271 22:44199798-44199820 GGCAAGAACAGGAATGGGTCAGG + Intronic
949576721 3:5345604-5345626 GGGAAGCACCAGCATTGGTCAGG + Intergenic
950218794 3:11178749-11178771 CGGAGAAAGCAGAAAGGGTCTGG - Intronic
950263623 3:11559558-11559580 GGGAGGTGGCAGACTGGGTCAGG - Intronic
950685994 3:14619015-14619037 GGGAAAAAACAGCGTGGGTCTGG - Intergenic
950968944 3:17167492-17167514 AGGAACAAACAGAATGGGTTTGG + Intronic
952255387 3:31690712-31690734 GAGATGGAGCAGAATGGGTTGGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952723569 3:36558332-36558354 GGGAGGAATCAGAAGGGATCAGG - Intergenic
952918377 3:38266899-38266921 GGGAAGCAACAGAGTGGGACTGG - Intronic
953493219 3:43366681-43366703 GGGAAGGAGCAGACAGGGTGGGG + Exonic
953674650 3:44991383-44991405 TGGAGGAAGCAGAATGCCTCTGG + Intronic
953760506 3:45683249-45683271 GGGAAGCAGGAGATAGGGTCTGG + Exonic
955281293 3:57597162-57597184 GGGCAGAAGCAGAAGGGGTTTGG + Exonic
955478998 3:59370027-59370049 GGGGAAAAGCAGTAGGGGTCAGG - Intergenic
955486391 3:59438825-59438847 AGGAAGAAGAAGGAGGGGTCTGG + Intergenic
955500807 3:59580696-59580718 GGGATGAAGCAGAAAGTGTTAGG - Intergenic
955520484 3:59770867-59770889 GGGCAGAAGCAGAGTGGCACAGG - Intronic
955701396 3:61685468-61685490 GGGAAGAAGCAGGATTGGACAGG + Intronic
956077295 3:65519112-65519134 AGTAAGAAGCAGAGTGGGTGGGG + Intronic
956748551 3:72328797-72328819 GGGAAAAAGAAGAAAGGGGCGGG + Intergenic
956950025 3:74272121-74272143 TGGAAGAAGAAGAATTGTTCTGG + Intronic
956995789 3:74824999-74825021 AGGAAGCAGCAGAAAGGCTCTGG - Intergenic
957001022 3:74884934-74884956 GGGAAGAAGGGGAATGGGTGTGG - Intergenic
958462033 3:94410562-94410584 GGGTAGAAAGAGAATGGCTCTGG + Intergenic
959133296 3:102385254-102385276 TGGAAGAGGCAGAATGGGGGTGG - Intronic
959257134 3:104029871-104029893 GGGAAGCACCAGCATTGGTCAGG - Intergenic
959436064 3:106316874-106316896 AGGAAGCAGCAGAAAGGCTCTGG + Intergenic
960050175 3:113232100-113232122 GGGAAGGAGCAGAGGGGGTGGGG - Intronic
960223873 3:115147454-115147476 GGGAAGAGGAAGAAAGGGGCGGG - Intergenic
960368074 3:116798616-116798638 GGGACAAGGAAGAATGGGTCAGG + Intronic
960739282 3:120815109-120815131 TGGAAGAAGCAGGATTGGGCAGG - Intergenic
961243851 3:125434933-125434955 GGGAGGAAGAGGTATGGGTCAGG - Intergenic
962028766 3:131576655-131576677 GGGAAGCACCAGGATAGGTCAGG + Intronic
962044310 3:131739414-131739436 GGGAAGCAGCAGCATGGGTCAGG - Intronic
962152723 3:132909964-132909986 GGAAAGAAAAAGAATGTGTCTGG + Intergenic
962960700 3:140308839-140308861 GGGAGGCAGCAGAATGGGGGAGG - Intronic
963561889 3:146876094-146876116 GGGAAGAAGCAGCAGGGGCAGGG + Intergenic
963709468 3:148730313-148730335 GAGAAGAAACACAATGGCTCAGG - Intronic
964461888 3:156941258-156941280 GGGAATAAGCACAAGGGGTCTGG - Intronic
964490438 3:157230297-157230319 GGTAAGTAGCAGAAGGGTTCTGG + Intergenic
964543562 3:157807097-157807119 GGGAGGATGGAGAATGGTTCCGG - Intergenic
965321994 3:167262013-167262035 AGGAAGAAGCAGAAAGGCCCTGG - Intronic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
968494203 4:906552-906574 GGGTAGGAGCAGGATGGGTTGGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
968963339 4:3756744-3756766 GGGAAAAGGCAGAAGGGGCCAGG + Intergenic
969926955 4:10594100-10594122 GGGAAGCAGAAGAGTGGGTGTGG - Intronic
970118949 4:12731284-12731306 GGGGAGAGGGAGAATGGGTTGGG - Intergenic
970203688 4:13634299-13634321 GGGAAAAAGGAGGATGTGTCTGG + Intergenic
971232259 4:24809229-24809251 GGGAAGAAGAAGGATAGTTCGGG + Intronic
971305150 4:25473370-25473392 GGGAAGAAGAAGAAGGGGAAGGG + Intergenic
972325260 4:38009284-38009306 GGGAAAAAACACAATGTGTCCGG + Intronic
973836782 4:54817933-54817955 GGGAAGTAGCAGAGTAGGGCTGG - Intergenic
973899186 4:55450136-55450158 GAGAAGAGGCAGAAGGGGTTGGG + Exonic
974546512 4:63315470-63315492 TGGAAGAAGCAGGATGGAACAGG - Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976856384 4:89609750-89609772 AGGAAGCAGCAGAAAGGCTCTGG + Intergenic
977733125 4:100379471-100379493 AGAAAGCAGCAGAATGGCTCTGG + Intergenic
977950830 4:102968739-102968761 GGGAAGCAGCACAAGGGGTCGGG + Intronic
977994381 4:103484615-103484637 GCCAGGAAGCAGAAGGGGTCAGG + Intergenic
978349043 4:107801936-107801958 GGAAGAAAGCAGCATGGGTCAGG + Intergenic
978726794 4:111978132-111978154 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
979794998 4:124834830-124834852 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
980113663 4:128658773-128658795 GGGAAGAAGAGGAGTGGGGCAGG + Intergenic
980971170 4:139568598-139568620 AGAAAGAAGCAGCAAGGGTCAGG + Intronic
982189073 4:152834980-152835002 GGGCAGCAGCATACTGGGTCTGG + Intronic
984867524 4:184294772-184294794 GGGAAGCACCAGGATCGGTCAGG - Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
986520053 5:8605582-8605604 GGGCAGTAGCAGGATGGGGCAGG - Intergenic
987774401 5:22345805-22345827 GTCAAAAAGGAGAATGGGTCCGG + Intronic
989626838 5:43437809-43437831 TTAAAGAAGCAGGATGGGTCTGG + Intergenic
990336189 5:54774996-54775018 GGGAAGAAGCAGCCAGGGTGGGG - Intergenic
990355194 5:54960102-54960124 GGAAAGAAGCAGGATTGGGCGGG + Intergenic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
995133232 5:108652815-108652837 TAAAAGAAGTAGAATGGGTCAGG - Intergenic
995349981 5:111163986-111164008 GGAAACAAACAGAATGAGTCTGG + Intergenic
996590335 5:125139592-125139614 GGGACAAAGCAGAATAGGTCTGG + Intergenic
996650898 5:125874693-125874715 GTGAGGAAGCAGAATAGGGCTGG + Intergenic
997290264 5:132727405-132727427 GGGAAAAAGGAGAGGGGGTCAGG + Intronic
997512899 5:134465581-134465603 GGGAAGGGGCAGGAGGGGTCTGG + Intergenic
997518531 5:134507230-134507252 GGGAGGAAGCTGAAGGGGGCAGG + Intergenic
997702864 5:135916606-135916628 AGGAAGAGGCACAATGGCTCTGG + Intergenic
998401605 5:141851491-141851513 GGGAAGACACAGACTGGGTCAGG + Intergenic
999039936 5:148397751-148397773 GGTAAGAGGGAGAAAGGGTCAGG - Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
1001299515 5:170523797-170523819 GGGTAGGAGGAGAATGGCTCAGG - Intronic
1002882566 6:1265860-1265882 GGGAAGAAGGAGCAAGGGTACGG + Intergenic
1003191000 6:3874374-3874396 AGATAGAAGCAGAAGGGGTCGGG - Intergenic
1003774657 6:9346928-9346950 GAGAAGCAGCAGAGTTGGTCAGG + Intergenic
1004935690 6:20506021-20506043 GGCAAGAAGAAGAATGGCTCAGG - Intergenic
1005888844 6:30119717-30119739 GGGAAGAAGCTGAAAAGGCCTGG + Intergenic
1006797936 6:36742932-36742954 GGGAAGAAGCCAGATGGGCCTGG - Intronic
1007060249 6:38933254-38933276 GGGAATAAGAAGAGTGGGTGTGG - Intronic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007705725 6:43790060-43790082 GGGAAGAAGAAAAGTGGGACAGG + Intergenic
1009198120 6:60711560-60711582 GGGAGGTAGCAGAATGGGAATGG + Intergenic
1009479621 6:64140574-64140596 GGGAAGGAGCAGAATGAGTTTGG + Intronic
1009894382 6:69728917-69728939 GGGAACAAGTAGAATTGCTCTGG - Intronic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012414736 6:99001133-99001155 GGGAAGAACCATTTTGGGTCGGG + Intergenic
1012793645 6:103733869-103733891 GGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1013551328 6:111210614-111210636 AGGAAGAAGCCGAATGTGTGTGG + Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014094528 6:117445694-117445716 GGGAAGGACCAGAAGGAGTCTGG - Intronic
1014571146 6:123009622-123009644 GGGAAGAGGCAGGATGGGGAGGG - Intronic
1015258817 6:131210983-131211005 GGGAATAAGCTGAATGGATAGGG + Intronic
1015294518 6:131575468-131575490 GTAAAGAAGCAAAATGTGTCAGG + Intronic
1015513576 6:134062916-134062938 GGGAAAAAACAGAATAGCTCAGG - Intergenic
1015732198 6:136360754-136360776 GTGAAGAAGCAGAGAGGGTCCGG - Exonic
1016516158 6:144895032-144895054 GGAAAGAAGCAGAAGCGGTGGGG - Intergenic
1016761908 6:147747109-147747131 AGGAAGTAGTTGAATGGGTCAGG + Intergenic
1018910861 6:168100352-168100374 GGGGAGAGGCGGCATGGGTCGGG + Intergenic
1019109501 6:169698593-169698615 GGGAAGAAGCAGAAAGAGCTTGG - Intronic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1024923380 7:54585652-54585674 GGGAAGAATCAGTATGGGATGGG - Intergenic
1025088428 7:56042352-56042374 GGAAAGAAGCAGAAGGGAGCCGG + Intronic
1026230893 7:68483071-68483093 GGGAAGAAGCTTAATAGGGCTGG + Intergenic
1026525808 7:71152574-71152596 GGGAAGAAGAAAAGTGGATCAGG - Intronic
1026641501 7:72130115-72130137 GGCAAGAAGCAGAAGGGGAGCGG - Intronic
1026842697 7:73679339-73679361 GGGAAAAAGCAGTTTGGCTCAGG + Intergenic
1028183057 7:87748145-87748167 GGGAAGCAGCAGAAAGGCCCTGG - Intronic
1028961707 7:96756151-96756173 GGGAAGAAGCAGAATTGCACAGG + Intergenic
1029148427 7:98463320-98463342 GGGAAGAAGCAGACCTTGTCAGG + Intergenic
1029186701 7:98744230-98744252 AGGAGGAAGCAGAAAGGTTCAGG - Intergenic
1029424183 7:100486299-100486321 GGGAGGAAGAAGGATGGGCCAGG + Intronic
1029439662 7:100579980-100580002 GGGCAGGTGCAGAAAGGGTCAGG + Intronic
1030443880 7:109624752-109624774 TGGATGGAGCAGAATGGGTTGGG - Intergenic
1030485343 7:110159200-110159222 TGGAAGAAGAAGAATGGTCCTGG - Intergenic
1030889880 7:114986413-114986435 GGGATTAAGCAGAATTGGGCAGG + Intronic
1031214842 7:118877207-118877229 GGGAAGAAGGAGAAGGGGAGGGG + Intergenic
1031398184 7:121298850-121298872 GGGATGAACCAGAATTTGTCGGG + Intergenic
1033872859 7:145777917-145777939 GGGAAGAGGGAAAATGGGTAGGG - Intergenic
1033874547 7:145798475-145798497 TGGAAAAAGCAGACTGAGTCTGG - Intergenic
1034275748 7:149823131-149823153 GGGAAGGATCAGGATGGGTTGGG - Intergenic
1034359279 7:150479954-150479976 GGGAAGAAGCCAAATTGGGCAGG + Intergenic
1034868919 7:154665530-154665552 GGGAAAATACAGAATGAGTCAGG - Intronic
1035017256 7:155777488-155777510 GGAAAGAAGCAGAATGAGAAAGG + Exonic
1035093820 7:156335723-156335745 GTGAAGCAGCAGAATGTGTGAGG - Intergenic
1035105855 7:156441066-156441088 ATGAAGCAGGAGAATGGGTCTGG - Intergenic
1037127581 8:15369522-15369544 GGTAATAAGCAGAATGTTTCTGG - Intergenic
1038900995 8:31843705-31843727 GGGAAGAAGCAGAGTGACTGGGG - Intronic
1039290142 8:36085871-36085893 TGGAAGAATCAGAATGTGTGTGG + Intergenic
1040105913 8:43541885-43541907 GGGAAGAGGCAGAATGGAAAAGG - Intergenic
1040711629 8:50195606-50195628 AGGAAGAAGCAGAAAGGCCCTGG - Intronic
1040890394 8:52311103-52311125 GGGAAGAAGCAGATAGGGAAGGG + Intronic
1041260739 8:56018941-56018963 GGGAAGCACCAGGGTGGGTCAGG + Intergenic
1041435525 8:57836332-57836354 AGGAAGCATCAGGATGGGTCAGG + Intergenic
1042567695 8:70129230-70129252 GGGAAGGGGAAAAATGGGTCAGG + Intronic
1042730740 8:71931408-71931430 GGCAAGAAGAAGAAAGGGGCAGG + Intronic
1042797132 8:72676845-72676867 GGGAAGGAACAGAATGTGTATGG - Intronic
1043978959 8:86615850-86615872 GGGAGGAAGGAGAATGGGTTTGG + Intronic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1045951231 8:107853989-107854011 GGGAAGGAGCAGAATGTGGCAGG - Intergenic
1046465398 8:114595788-114595810 GGGATGAAGGAGAATGGGATTGG - Intergenic
1047039230 8:120974296-120974318 GGAAAAAAGGAGAATGGGCCAGG + Intergenic
1047338565 8:123958383-123958405 GGGAGGGAGGAGCATGGGTCAGG + Intronic
1048543866 8:135367752-135367774 GGGAAGCAGCAGGGTTGGTCAGG - Intergenic
1048950334 8:139491573-139491595 GGGAAGAAGCAGGATGGAAAAGG + Intergenic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1052069126 9:24059691-24059713 GGGAAGAAGCAAAAGGGATGAGG - Intergenic
1052081933 9:24216894-24216916 GTGAGTAAGGAGAATGGGTCAGG + Intergenic
1052864768 9:33458238-33458260 GGGAAGAAGGAGAAGGGGTTAGG + Intergenic
1053790821 9:41685249-41685271 AGGAATGAGCACAATGGGTCTGG + Intergenic
1053795839 9:41726230-41726252 GGGAACATGGAGAATGTGTCAGG - Intergenic
1054149341 9:61588643-61588665 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054154336 9:61629523-61629545 AGGAATGAGCACAATGGGTCTGG - Intergenic
1054179168 9:61896943-61896965 AGGAATGAGCACAATGGGTCTGG + Intergenic
1054184246 9:61938301-61938323 GGGAACATGGAGAATGTGTCAGG - Intergenic
1054469101 9:65519754-65519776 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054474118 9:65560643-65560665 AGGAATGAGCACAATGGGTCTGG - Intergenic
1054654260 9:67650194-67650216 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054658370 9:67683878-67683900 AGGAATGAGCACAATGGGTCTGG - Intergenic
1055130276 9:72766888-72766910 AGGCAGAAGCCTAATGGGTCTGG + Intronic
1055347079 9:75350502-75350524 AGGAAGCAGCAGAAAGGCTCTGG - Intergenic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1055905912 9:81292938-81292960 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
1056237736 9:84612139-84612161 GGGAGGAAGCACCATGAGTCAGG + Intergenic
1056793284 9:89639862-89639884 GGGGGGAAGGAGGATGGGTCTGG + Intergenic
1057302826 9:93896463-93896485 GGGAAGGAACAGAATGGGCAGGG - Intergenic
1058770330 9:108224896-108224918 GGAAAGAAGCCAAATGGGGCAGG - Intergenic
1059399286 9:114058906-114058928 GGGCAGAAGCAGGTGGGGTCAGG - Intergenic
1059625954 9:116066296-116066318 AGAAAGAAGCAGAATTGGGCAGG - Intergenic
1185526557 X:784874-784896 CAGAGGAAGCTGAATGGGTCAGG - Intergenic
1187354401 X:18553256-18553278 GGGAAGATGCAGAAATGGTTAGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187764711 X:22628411-22628433 GAGAAGAAACAGAAGGGTTCAGG - Intergenic
1188137311 X:26505225-26505247 TGGAAGAAGCAGAGTGGGTGGGG - Intergenic
1188606892 X:32042395-32042417 GGCAAGAAGGAGAATGAGTGAGG + Intronic
1190035323 X:47018203-47018225 GGGAAGAAGGAGATGGGGTGAGG - Intronic
1190480794 X:50874823-50874845 GCTAAGAAGCAGAATGGGCTTGG + Intergenic
1190711682 X:53076200-53076222 AGGAAGAAACAGAAAGGGTAGGG - Intronic
1190737055 X:53262561-53262583 TGGAAGGAGCAGACTGGGCCAGG + Intronic
1190988868 X:55525053-55525075 AGGAGAGAGCAGAATGGGTCAGG - Intergenic
1191965338 X:66751298-66751320 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
1195006853 X:100693570-100693592 GGGAAGAAGCAGGATTAGTTAGG - Intronic
1195314870 X:103667679-103667701 GGGAGGAAGCAGAATAGGAAGGG + Intergenic
1195585433 X:106559915-106559937 GGAAAAAAGCAGAATTGGGCAGG - Intergenic
1196371366 X:114983115-114983137 GGGAAGGAGCAGAAAGGGAAGGG + Intergenic
1196463142 X:115949558-115949580 GGGAAGAAGAACACTGGGGCTGG + Intergenic
1196907351 X:120450672-120450694 GGCAAGAAGGAAAATGGGTCTGG + Intronic
1197037751 X:121897583-121897605 GGGAGAAAGCAGAATTGGGCAGG + Intergenic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1197780878 X:130158639-130158661 GGGAAGAAGAAGAATTGTCCTGG + Intronic
1197993893 X:132351466-132351488 AGGAAGTAGTAGAATGGGACAGG + Intergenic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1201185886 Y:11402533-11402555 GGGAAGCAGCAAAAGTGGTCGGG + Intergenic
1201765673 Y:17571543-17571565 GGGAAGAAGCACCATGGCTCGGG + Intergenic
1201835879 Y:18334446-18334468 GGGAAGAAGCACCATGGCTCGGG - Intergenic
1202058227 Y:20857987-20858009 GTGAGGAAGCACAAGGGGTCAGG - Intergenic
1202168873 Y:22020040-22020062 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202222488 Y:22566328-22566350 GGGAATCAGGAGAATGGGCCTGG + Intergenic
1202320627 Y:23629332-23629354 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202550140 Y:26040724-26040746 GGGAATCAGGAGAATGGGCCTGG + Intergenic