ID: 1085331325

View in Genome Browser
Species Human (GRCh38)
Location 11:75654192-75654214
Sequence ATAGTTAATACATGGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085331325 Original CRISPR ATAGTTAATACATGGTAAGC AGG Intronic
900779850 1:4611126-4611148 TTAGTTAAGACAAGGTCAGCCGG - Intergenic
900863540 1:5250786-5250808 GTAGGTAATAGATGGGAAGCTGG + Intergenic
907907101 1:58792534-58792556 ATAATAAATACATGTTGAGCAGG - Intergenic
914394976 1:147257211-147257233 GTAGTTATTACATGGTTAGGTGG + Intronic
916335375 1:163665208-163665230 ATAAATAATACATAGTCAGCTGG - Intergenic
918895255 1:190335096-190335118 ATAGTTAGTACTGGGAAAGCAGG + Intronic
1063641078 10:7831178-7831200 ATAGTTTATATAGGGAAAGCAGG + Intronic
1065724422 10:28655947-28655969 ATAGTTAAGTCATTGTAAGATGG + Intergenic
1072917390 10:99546975-99546997 ATAGTTAATAAAGGGTTAGCGGG - Intergenic
1076133249 10:128028223-128028245 ATATTTAATTGATGGTAAGGAGG - Intronic
1077511953 11:2970930-2970952 AAAGTTAATCCATGGTACACTGG + Intronic
1077745297 11:4896705-4896727 ATAATTTACACATGGTAAGATGG + Intronic
1081083017 11:38766993-38767015 ATGGCTAATACATGATAAGGTGG + Intergenic
1081211545 11:40341143-40341165 ATAGTTCATACATTTTAAGTGGG - Intronic
1082283299 11:50295191-50295213 ATTGTTAATTGATGATAAGCTGG - Intergenic
1083062233 11:59886003-59886025 ATAGTTAATGCATGCTGGGCTGG - Intergenic
1085331325 11:75654192-75654214 ATAGTTAATACATGGTAAGCAGG + Intronic
1087191503 11:95258996-95259018 ATAGTAAAAACTTGGTAAGTAGG + Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1090451491 11:126810366-126810388 AAAGCTAATATATGGTAATCAGG - Intronic
1093411755 12:18876519-18876541 ATAGGTAAAACATCGAAAGCAGG - Intergenic
1093863121 12:24192076-24192098 TTAGTTAAAACTTTGTAAGCAGG + Intergenic
1093886253 12:24464801-24464823 ACAGTTATTACATAGTAAGAAGG + Intergenic
1102504324 12:113374267-113374289 AGAGTTAATTCATTGAAAGCAGG + Intronic
1105724340 13:23147085-23147107 ATAGTTAATGCATGGCAAAGGGG - Intergenic
1106661351 13:31802959-31802981 ATAGGTTAGACATGGTAACCTGG - Exonic
1107809513 13:44186895-44186917 ATGAATAATCCATGGTAAGCTGG + Intergenic
1109864893 13:68250342-68250364 ATAGTTAATACTTTGATAGCTGG + Intergenic
1111156853 13:84338714-84338736 CTAGTTTCTACATGGTAAGTAGG + Intergenic
1111254024 13:85641963-85641985 ATAGTTAATACAAGGAACACTGG - Intergenic
1111264158 13:85785128-85785150 ATAATTAAAGAATGGTAAGCTGG - Intergenic
1118550338 14:66942907-66942929 ATAAATAATTCATGGTAATCTGG - Intronic
1119214857 14:72861124-72861146 ATAGATGATAGATAGTAAGCAGG - Intronic
1119936794 14:78599442-78599464 ATAGTTAACACATAGCAATCTGG + Intronic
1121448672 14:93994317-93994339 ACAGTTAATACAAGGTAACAGGG - Intergenic
1122111684 14:99507848-99507870 ACAAGTAGTACATGGTAAGCTGG + Exonic
1122584810 14:102798096-102798118 GTAGTTAATACATGCTGAACTGG - Intronic
1123539779 15:21277024-21277046 TTAATTAATACATGTTGAGCAGG - Intergenic
1124390678 15:29253914-29253936 ATAGTTCATATATGAAAAGCAGG + Intronic
1125222807 15:37358901-37358923 AGAGTTAATACATTATAAGGAGG - Intergenic
1126607801 15:50496735-50496757 ATTGTTGATACATGGAAAACAGG - Intronic
1202948089 15_KI270727v1_random:4186-4208 TTAATTAATACATGTTGAGCAGG - Intergenic
1133744916 16:8679004-8679026 ATTTTTAATGCATGGGAAGCTGG - Intronic
1140313400 16:73870757-73870779 ATAGCTAATACAGGGAGAGCAGG - Intergenic
1144071044 17:11671460-11671482 ATAGACAAGACATGGCAAGCAGG + Intronic
1146623434 17:34418153-34418175 AAAGTTAATGCTTGGCAAGCGGG + Intergenic
1147777407 17:42912193-42912215 ATAATTAATAGATGGTTAGTGGG + Exonic
1149730261 17:58938381-58938403 ATAGTAATTAAATGGTAAGTTGG + Intronic
1153693932 18:7621213-7621235 ATAGCTAATAATTGGTAAACTGG + Intronic
1156514231 18:37666670-37666692 AGAGTTAATTCAAGGGAAGCAGG + Intergenic
1158051779 18:53230224-53230246 ATAGTTTATAGACAGTAAGCAGG - Intronic
1160424801 18:78772580-78772602 ACAGTTAATACAGGGTGAGGTGG + Intergenic
1164789661 19:30965308-30965330 ATATTTAATTTATGGTAAGAGGG + Intergenic
928521226 2:32091137-32091159 ATAGTAGATATTTGGTAAGCAGG + Intronic
930052186 2:47225134-47225156 ACAGTAAATACATGGCAAGCTGG + Intergenic
930548176 2:52796776-52796798 GAAGTTAATACATGGGAATCTGG + Intergenic
931953479 2:67391626-67391648 ATAGTTGATTCATGGTCAGTTGG + Intergenic
932208478 2:69906358-69906380 ATAGTCAATCCATGGTAGGATGG + Intronic
935455624 2:103264459-103264481 ATAGCTAAGAGATGGAAAGCTGG + Intergenic
935506048 2:103904594-103904616 AAAGTTAATCAATGGTAACCTGG - Intergenic
938375992 2:130807120-130807142 AAAGTTAAGAAATGGTAATCTGG - Intergenic
939297077 2:140280794-140280816 ATAGTCTATATATGGTAAGAAGG + Intronic
941396983 2:164985550-164985572 TTAATTAATACATGTTGAGCAGG - Intergenic
942106118 2:172635601-172635623 ATAGTTAATACAGGGTGCGGTGG - Intergenic
943267132 2:185746472-185746494 ATAAGTAAAACATGGTGAGCTGG + Intronic
943670851 2:190658926-190658948 AAAGAGAATAAATGGTAAGCAGG - Intronic
943861428 2:192869042-192869064 ATAATTCAGACATGGTAAGAAGG + Intergenic
946888470 2:224248496-224248518 CTAGTTCATACATTGTCAGCAGG - Intergenic
946923854 2:224606251-224606273 AGAGTTAAGACAGGGTAAGCTGG - Intergenic
947600319 2:231443991-231444013 AGATTTAATACAAGGTGAGCAGG - Intergenic
948209348 2:236180837-236180859 ATATTTAATACAAAGGAAGCAGG + Intergenic
948508252 2:238445805-238445827 ATAGTTAATGAATGGTCAGCTGG + Intronic
1169100339 20:2942072-2942094 ATAGTAAATACTGAGTAAGCGGG + Intronic
1169613242 20:7407807-7407829 ATAAATAATAAATGATAAGCAGG - Intergenic
1170960556 20:21021776-21021798 ATATTTACTCAATGGTAAGCTGG - Intergenic
1171240080 20:23560268-23560290 ATAGTTAAAACAGGCTATGCTGG + Intergenic
1174839025 20:53884371-53884393 TTAGTTAATACCTGTTCAGCTGG + Intergenic
1178972760 21:37195532-37195554 ATATTTAATTCATGGTATTCAGG + Intronic
1185096696 22:48810828-48810850 ATATTTAATATATTGTAGGCCGG + Intronic
949331789 3:2931596-2931618 AAAGTTAATACATAGTATGTGGG - Intronic
951589657 3:24249666-24249688 ATACTTAATACATTATGAGCTGG + Intronic
951613765 3:24520656-24520678 ATTGTTGATAAGTGGTAAGCAGG + Intergenic
952038821 3:29236575-29236597 ATAACTGATCCATGGTAAGCAGG + Intergenic
957988426 3:87599919-87599941 ATAACTAATACATGCTTAGCAGG + Intergenic
958782984 3:98565388-98565410 ATATTTGATACATAGAAAGCTGG - Intronic
960316369 3:116182989-116183011 ATATTTATTACATGTTATGCAGG - Intronic
960489671 3:118300163-118300185 ATAGAAAATAAATGGTAAGATGG - Intergenic
962865407 3:139444412-139444434 GAAGTTCATACATGGTGAGCAGG - Intergenic
970124484 4:12793551-12793573 ATTGTTAATACATGTTGAGAGGG + Intergenic
972710093 4:41586942-41586964 ATAATTAATATATGCTATGCTGG + Intronic
976360688 4:84174592-84174614 ATGCTTAATACATGGTACTCAGG + Intergenic
977089162 4:92649243-92649265 ATAGCTTATAGATGGTAAACTGG - Intronic
977379087 4:96247426-96247448 AAAGTTAAGACATGGTAATTAGG - Intergenic
979043152 4:115825653-115825675 ATACTTAATAGATGGAAAGAAGG + Intergenic
980697015 4:136371180-136371202 ATAGTTAATATTTGCTAAGTAGG - Intergenic
982557734 4:156890045-156890067 ATATTTAATACATATTAACCTGG - Intronic
983215708 4:165000466-165000488 TCACTTAACACATGGTAAGCGGG + Intergenic
986183184 5:5413147-5413169 ATGTTTAATAAATGGTAAACTGG + Intergenic
988639070 5:33021036-33021058 ACAGTTACTACATGCCAAGCAGG + Intergenic
992299916 5:75367566-75367588 ATGTTTAACACATGGTAACCAGG + Intergenic
999109550 5:149106561-149106583 TTACTTAATGAATGGTAAGCTGG + Intergenic
1000084551 5:157878017-157878039 GTAGATAATACATTGTAACCAGG - Intergenic
1001363492 5:171112180-171112202 TTAGTTAATGCTTGGTGAGCAGG + Intronic
1001462194 5:171925810-171925832 ATTTTTAAAACATGGTCAGCAGG + Intronic
1005419734 6:25636464-25636486 ATAGTGAGTAAATGGGAAGCTGG + Intergenic
1006653422 6:35569799-35569821 ATAGTAGATACTCGGTAAGCTGG - Intergenic
1011449775 6:87480443-87480465 ATATTTAATACATTTTAACCAGG + Intronic
1012267903 6:97169033-97169055 ATTGTTAATACATGGAAAGCAGG + Intronic
1014067431 6:117144021-117144043 AGAGTTAATACATGTTATTCTGG - Intergenic
1015093978 6:129392411-129392433 CTTGTTAATACATGGTTTGCTGG - Intronic
1015455348 6:133420863-133420885 CAACTTAATACAAGGTAAGCAGG + Intronic
1016011240 6:139139439-139139461 ACAGCTAATACTTCGTAAGCTGG - Intronic
1016716286 6:147234964-147234986 ATAGGTAATACATTTTATGCTGG - Intronic
1017264695 6:152429157-152429179 AGAGTCAATACATGGGAAGCAGG - Intronic
1018584866 6:165346431-165346453 ATAATTAATACATGGCAGTCGGG - Intronic
1020603281 7:10303440-10303462 ATAGTTAGTACATAGTAATCTGG + Intergenic
1021752774 7:23820560-23820582 ATATTTAATACATTGTTAACTGG + Intronic
1022628672 7:32064610-32064632 ATTGTTAAAAGATGTTAAGCTGG - Intronic
1024391941 7:48824331-48824353 ATAGTTAATACATGCAAAGGAGG + Intergenic
1025217857 7:57074521-57074543 ATTGTTAATTGATGATAAGCTGG - Intergenic
1025628768 7:63248159-63248181 ATTGTTAATTGATGATAAGCTGG - Intergenic
1025653495 7:63495939-63495961 ATTGTTAATTGATGATAAGCTGG + Intergenic
1026640975 7:72125309-72125331 ATAGATAAAACATGGTGGGCCGG - Intronic
1027707521 7:81553103-81553125 ATAAGTAATTTATGGTAAGCTGG + Intergenic
1027708724 7:81569766-81569788 ACAGTTAATACATAGTGGGCTGG - Intergenic
1028748109 7:94350493-94350515 ATAGTTAATAGATGGCATACTGG - Intergenic
1032758361 7:134914025-134914047 ATATTTTATACTTGGTAACCTGG - Intronic
1034517637 7:151593130-151593152 ATGAGTAATACATGGAAAGCTGG + Intronic
1040459346 8:47632289-47632311 AGAGTTAACACATGGTACCCAGG + Intronic
1041109430 8:54470668-54470690 CTTAGTAATACATGGTAAGCTGG - Intergenic
1043225992 8:77730906-77730928 ATAGTAAATGCATGTTAAGCAGG - Intergenic
1043460759 8:80457804-80457826 ATAGTAAATACAAGGAAGGCAGG + Intergenic
1046470402 8:114665603-114665625 ATAGTAAATATATGGTCAGAAGG + Intergenic
1050180397 9:2916686-2916708 GTAGCCAATAAATGGTAAGCAGG - Intergenic
1051066215 9:13106653-13106675 AGAATTATTACATGCTAAGCTGG - Exonic
1054848055 9:69818009-69818031 ATAATAAATACATTGAAAGCAGG - Intergenic
1055763888 9:79640261-79640283 GTTCTTAATACATGGTAAACAGG + Intronic
1057382124 9:94577697-94577719 ATAGGTAATCCAAGGAAAGCTGG - Intronic
1059988459 9:119842110-119842132 ATAGTGAATGCACAGTAAGCAGG - Intergenic
1060923515 9:127439270-127439292 GTAGTTAATGCATGGCAAGCAGG - Intronic
1187943834 X:24407536-24407558 AATGTTGATAAATGGTAAGCTGG - Intergenic
1189599445 X:42606762-42606784 AGAGTGAATACAAGATAAGCAGG + Intergenic
1194059447 X:89179148-89179170 ATAACTAATTCATGGTAATCTGG - Intergenic