ID: 1085332487

View in Genome Browser
Species Human (GRCh38)
Location 11:75665751-75665773
Sequence GTGAACATTCTACCATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085332486_1085332487 3 Left 1085332486 11:75665725-75665747 CCGCTTGGTAGCAGCATAAAAAC 0: 1
1: 0
2: 1
3: 14
4: 132
Right 1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 128
1085332485_1085332487 4 Left 1085332485 11:75665724-75665746 CCCGCTTGGTAGCAGCATAAAAA 0: 1
1: 0
2: 1
3: 22
4: 150
Right 1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 128
1085332484_1085332487 5 Left 1085332484 11:75665723-75665745 CCCCGCTTGGTAGCAGCATAAAA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 128
1085332482_1085332487 21 Left 1085332482 11:75665707-75665729 CCTCTTTTCTTTTGCTCCCCGCT 0: 1
1: 0
2: 3
3: 28
4: 384
Right 1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 128
1085332480_1085332487 23 Left 1085332480 11:75665705-75665727 CCCCTCTTTTCTTTTGCTCCCCG 0: 1
1: 0
2: 4
3: 40
4: 398
Right 1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 128
1085332481_1085332487 22 Left 1085332481 11:75665706-75665728 CCCTCTTTTCTTTTGCTCCCCGC 0: 1
1: 0
2: 3
3: 31
4: 458
Right 1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085332487 Original CRISPR GTGAACATTCTACCATCTCA TGG Intronic
901270625 1:7950708-7950730 GTGAACAGTGTCCCCTCTCATGG - Intergenic
903378792 1:22883026-22883048 GTGATCCTTCTACCATCCCAGGG - Intronic
907918599 1:58893132-58893154 GTGCAGATTCTACCATCTTGTGG - Intergenic
911408553 1:97472130-97472152 GTGCACATTATCCCATCTTAAGG - Intronic
1064631305 10:17315458-17315480 ATGAACATTTTACTATCTCCTGG - Intergenic
1066414856 10:35212600-35212622 GCGCCCTTTCTACCATCTCACGG + Exonic
1067189086 10:44054666-44054688 GAGAACATTCTACCATCACCAGG - Intergenic
1067842715 10:49694415-49694437 GTTAACATTTTACCAGCCCATGG + Intronic
1071297142 10:84229793-84229815 GTAAACAAACTACAATCTCAGGG + Intergenic
1071348838 10:84719018-84719040 GTTTCCTTTCTACCATCTCACGG - Intergenic
1073970175 10:109038881-109038903 GTAAACATTCTCTCTTCTCATGG + Intergenic
1083822201 11:65179307-65179329 GTGATCATTTTACCCTCTCTTGG + Intronic
1085075923 11:73592129-73592151 GTGAAAAATATATCATCTCAGGG + Intronic
1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG + Intronic
1087273192 11:96133515-96133537 GTGAACATTCAGCCTTCTCTTGG + Intronic
1089201719 11:116728618-116728640 GGGAAAATGCTACAATCTCATGG - Intergenic
1090404047 11:126466702-126466724 GAGAACATTCTATCATCTGCAGG + Intronic
1090890398 11:130917937-130917959 ATTCACATTCTGCCATCTCACGG - Intergenic
1091086983 11:132730630-132730652 GTAAACATTCTAACATCCCCTGG - Intronic
1092330467 12:7582559-7582581 TTGAACAGTCTCCCTTCTCAGGG - Intergenic
1093888136 12:24486995-24487017 GTGCTCATTCTACCAGCTCATGG + Intergenic
1097465138 12:59913408-59913430 GTCTACTTTCTCCCATCTCAGGG - Intergenic
1097899808 12:64861324-64861346 CTGAACATTCTATGATGTCAAGG - Intronic
1104569838 12:129915597-129915619 GTGAACATTCAATAAACTCAAGG + Intergenic
1106434161 13:29708898-29708920 ATGAGCACTCTACCCTCTCAGGG - Intergenic
1108026706 13:46185465-46185487 GTGGACATTCTACAATGGCAAGG - Intronic
1108441521 13:50457910-50457932 GCAATCAATCTACCATCTCAAGG + Intronic
1110366197 13:74688545-74688567 GTGAACATTCCTCCATCTATAGG - Intergenic
1113083139 13:106537939-106537961 GTCAACATTCTACTATTTAATGG + Intergenic
1117795880 14:59394145-59394167 ATGACCATTCTAGCATCTCATGG + Intergenic
1118071077 14:62247280-62247302 ATGAACATTCTAATAGCTCAAGG + Intergenic
1120491962 14:85189753-85189775 GTGAACACTGTACCATTTAAAGG + Intergenic
1120492142 14:85191387-85191409 GTGAACACTGTACCATTTAAAGG - Intergenic
1120606484 14:86584508-86584530 GTATACATTCTACAATATCAAGG - Intergenic
1121637673 14:95464795-95464817 GGAAACAATCTACCATGTCAGGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1126805720 15:52346696-52346718 GGGAAGATTCTACAATGTCACGG + Intronic
1127946351 15:63758228-63758250 GTGTACCTTCTACCAACTGATGG + Exonic
1128128268 15:65208840-65208862 ATTAACATTCAACCATCTGAGGG - Intronic
1130022583 15:80243472-80243494 GTGAAGACTCTACCATTGCAAGG - Intergenic
1130311818 15:82762911-82762933 GTGAATATTCTACCTTCTTCAGG + Intronic
1133702247 16:8319678-8319700 GTGAGCAGCCTACCTTCTCAGGG - Intergenic
1138433226 16:56982641-56982663 ATAAATATTCTACCATTTCAAGG - Intronic
1141332608 16:83125823-83125845 GTCAACATACTACCATCCTAGGG - Intronic
1141602854 16:85136956-85136978 GGGAACATTCTTCATTCTCAGGG + Intergenic
1149969365 17:61201239-61201261 GTAATCATACTTCCATCTCATGG + Intronic
1150819503 17:68423968-68423990 GTGACCATTCTACTCTGTCAGGG - Intronic
1157181542 18:45502567-45502589 TTGATCACTCTAGCATCTCATGG - Intronic
1160062265 18:75542830-75542852 CTGAACATTCTATCATCATAAGG - Intergenic
1160235759 18:77085467-77085489 GTGAACATTGAATGATCTCATGG + Intronic
1160324438 18:77930385-77930407 GTGAATATTCTAGGAGCTCATGG + Intergenic
1163626081 19:18390555-18390577 GTGAGCCTGCTCCCATCTCAGGG - Intergenic
1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG + Intergenic
1165894181 19:39131618-39131640 GGGAACACTCTCCCATCCCAGGG + Intronic
927101818 2:19793621-19793643 GTGATCTTTCTACTATATCAGGG + Intergenic
929459804 2:42095028-42095050 ATGAACCTTCTACCAGCTAAGGG - Intergenic
934013513 2:87852654-87852676 CTAAACATGCTCCCATCTCAAGG + Intergenic
935217517 2:100986221-100986243 CTGATCTTTCTACCATCCCACGG - Intronic
935787992 2:106566534-106566556 GGGAAAAATCTACCAGCTCAAGG - Intergenic
936629949 2:114191496-114191518 GTTAACATTTTACCCACTCACGG + Intergenic
936697135 2:114964608-114964630 GTTAACATTCTTCCACCTCATGG - Intronic
939213164 2:139204459-139204481 GTGAAAGTTTTTCCATCTCATGG + Intergenic
939329934 2:140744567-140744589 ATCAACATGCTTCCATCTCAGGG + Intronic
941036714 2:160576713-160576735 GTGCATATTATTCCATCTCATGG - Intergenic
944526462 2:200624752-200624774 GAGAACATCCTATCATTTCATGG - Intronic
948001487 2:234571476-234571498 GTGAAAATTTTACTATCTCAAGG - Intergenic
1172276806 20:33684556-33684578 GGGAAGATTCTAACATCTCTAGG + Intronic
1173112112 20:40201767-40201789 ATGAATAATCTAACATCTCAGGG + Intergenic
1175849598 20:62082271-62082293 GTCCACATTCTACCATTTCCTGG + Intergenic
1176699525 21:10027087-10027109 GAGAACAATCTTGCATCTCAGGG + Intergenic
1178778015 21:35571074-35571096 GTGGATATTTTAACATCTCAAGG + Intronic
1181453053 22:23036862-23036884 GTGCACATTTTGCCTTCTCAAGG - Intergenic
1181955727 22:26586780-26586802 GTGAACTACCTACCTTCTCAAGG + Intronic
950904147 3:16522328-16522350 GTGGACATTCTCCCATCAAAAGG + Intergenic
956829626 3:73033006-73033028 ATGGAAATTCTACCATCTTACGG + Intronic
957119065 3:76065332-76065354 GAGAACAATTTACAATCTCAAGG + Intronic
963608403 3:147434415-147434437 GTTAAGAATCTACTATCTCAAGG + Intronic
963867177 3:150374973-150374995 GTGATCATGCTGCCCTCTCAGGG + Intergenic
965339580 3:167471189-167471211 GTGATCATTTTCCCATGTCATGG - Intronic
969695977 4:8735127-8735149 ATGTGCATTCTACCATCCCAGGG + Intergenic
971192695 4:24442791-24442813 GTGAACATTTAATCATGTCAGGG - Intergenic
972078609 4:35119966-35119988 GTTGACATTATACCATTTCAGGG + Intergenic
972078683 4:35121093-35121115 GTTGACATTATACCATTTCAGGG - Intergenic
972875922 4:43359882-43359904 GTGAAAATTCTTCGATATCAAGG - Intergenic
973116736 4:46469974-46469996 GTGAACATTCTATGATCCTATGG - Intronic
975395092 4:73865534-73865556 GTGAACATTTTACAATATCATGG + Intergenic
977307174 4:95339394-95339416 GTAAACAGTCTACCACTTCAGGG - Intronic
980065013 4:128177632-128177654 TTAAATATTCTTCCATCTCATGG - Intronic
980507766 4:133744909-133744931 GTTAAGATTCTATCCTCTCAGGG - Intergenic
980655374 4:135776094-135776116 GTGATCAGTCTGGCATCTCATGG + Intergenic
984443167 4:179799187-179799209 CTGTACATTCTACAATTTCAAGG + Intergenic
1002569756 5:180133439-180133461 GTGATCATTCTTCCCTCACAGGG - Intronic
1004611361 6:17243296-17243318 GGGTACATTCTATAATCTCAAGG + Intergenic
1006702486 6:35987237-35987259 GTTAAAATGCTACAATCTCATGG - Intronic
1007657967 6:43463931-43463953 GTTAACATTATACCTTATCATGG - Intergenic
1007842135 6:44725272-44725294 ATGGTCATTCTGCCATCTCACGG + Intergenic
1008015559 6:46515332-46515354 ATGAGCATTCTGCCTTCTCATGG - Intergenic
1008170571 6:48200715-48200737 GTAAAAATTCAAACATCTCAAGG - Intergenic
1011140703 6:84152532-84152554 TTTAACATTTTACCTTCTCATGG + Exonic
1011920182 6:92564830-92564852 GAAAATATTCTTCCATCTCATGG - Intergenic
1014900124 6:126953031-126953053 GTGAATTTTCTACCATTTAATGG - Intergenic
1015648728 6:135428549-135428571 GTGAAAATTCTACCATTTTATGG - Intronic
1019969568 7:4529302-4529324 ATGGCCATTCTACCATCTCTAGG + Intergenic
1023169457 7:37376519-37376541 GTGAACCGACTACCACCTCAGGG + Intronic
1023553187 7:41390775-41390797 GTGAGCATTATATCTTCTCAGGG - Intergenic
1025252948 7:57364152-57364174 GTCAACATATTACAATCTCATGG - Intergenic
1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG + Intergenic
1030861191 7:114631743-114631765 TTGTACTTTCTACCATTTCATGG + Intronic
1031521602 7:122773231-122773253 GTGAACATGTTTCCATATCATGG + Intronic
1032353069 7:131184041-131184063 GTGTCCATTCTCCCACCTCAAGG - Intronic
1032866515 7:135930816-135930838 GACAACATCCTACCATCTGAGGG + Intronic
1033765481 7:144485383-144485405 GTAAACATTTAACCATCTAATGG + Intronic
1034740431 7:153468404-153468426 GTGACCATTCTACCATATCCTGG + Intergenic
1035707865 8:1690908-1690930 GTGACCCTTTTACCATCTCCAGG + Intronic
1039190320 8:34966294-34966316 CTGAGCTCTCTACCATCTCAGGG - Intergenic
1043380305 8:79695429-79695451 ATGAATATTCTTCCATCTCCTGG - Intergenic
1043673576 8:82920283-82920305 GTGAGTATTCAACCATCTCAAGG + Intergenic
1050153059 9:2636606-2636628 AAGTCCATTCTACCATCTCAGGG + Intronic
1052107739 9:24540375-24540397 TTTAATATTCAACCATCTCAAGG + Intergenic
1053599378 9:39594726-39594748 GTGACCATTCCAATATCTCATGG + Intergenic
1053857084 9:42348912-42348934 GTGACCATTCCAATATCTCATGG + Intergenic
1054254145 9:62747660-62747682 GTGACCATTCCAATATCTCATGG - Intergenic
1054568209 9:66781830-66781852 GTGACCATTCCAATATCTCATGG - Intergenic
1055261874 9:74446715-74446737 CTGAACACTCAACTATCTCAAGG - Intergenic
1057887449 9:98840787-98840809 TTGAAAATTCTAGAATCTCAGGG - Intronic
1060370111 9:123061051-123061073 GTTAACAAACTACCACCTCAGGG + Intronic
1191706396 X:64098609-64098631 GGGAAGATTGTACAATCTCAAGG - Intergenic
1192438495 X:71157248-71157270 GTGATCATCCTCCCACCTCAAGG + Intronic
1194545828 X:95232285-95232307 GTGAGCAGCCTACCTTCTCAAGG + Intergenic
1195640499 X:107169528-107169550 GTGCACATTTTACCCTCACAAGG - Intronic
1198284025 X:135172038-135172060 GTGAAAAATCTACCCTCACAGGG - Intergenic
1198286385 X:135195545-135195567 GTGAAAATACTACCCTCACAGGG - Intergenic
1199130960 X:144185815-144185837 CTAAACATGCTCCCATCTCAAGG - Intergenic
1200824613 Y:7625093-7625115 TTGAACATTCTACCAGCCCCAGG - Intergenic
1200879817 Y:8201342-8201364 TTGAACATTCTACCAGTTCCTGG - Intergenic
1201054630 Y:9976271-9976293 TTGAACATTCTACCAGCCCCTGG + Intergenic
1202191754 Y:22253180-22253202 TTGAACATTCTACCAGCCCCTGG - Intergenic
1202235442 Y:22705994-22706016 TTGAACATTCTACCAGCCCCAGG + Intergenic
1202307717 Y:23490174-23490196 TTGAACATTCTACCAGCCCCAGG - Intergenic
1202563084 Y:26180412-26180434 TTGAACATTCTACCAGCCCCAGG + Intergenic