ID: 1085333197

View in Genome Browser
Species Human (GRCh38)
Location 11:75669448-75669470
Sequence CTGCTGGAATTGGTCAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085333191_1085333197 4 Left 1085333191 11:75669421-75669443 CCAGAATAGATGCTTTGAAAAGG No data
Right 1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG No data
1085333189_1085333197 22 Left 1085333189 11:75669403-75669425 CCTAGTGAAATGTCTGTCCCAGA No data
Right 1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG No data
1085333190_1085333197 5 Left 1085333190 11:75669420-75669442 CCCAGAATAGATGCTTTGAAAAG No data
Right 1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085333197 Original CRISPR CTGCTGGAATTGGTCAAAAC CGG Intergenic
No off target data available for this crispr