ID: 1085339522

View in Genome Browser
Species Human (GRCh38)
Location 11:75722136-75722158
Sequence GACCCAGGAGTGGGCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 2, 2: 1, 3: 32, 4: 368}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085339522_1085339530 26 Left 1085339522 11:75722136-75722158 CCTGCAGGGCCCACTCCTGGGTC 0: 1
1: 2
2: 1
3: 32
4: 368
Right 1085339530 11:75722185-75722207 CTGAGTTCTGGGAGCAGTCATGG 0: 1
1: 0
2: 1
3: 34
4: 354
1085339522_1085339526 -2 Left 1085339522 11:75722136-75722158 CCTGCAGGGCCCACTCCTGGGTC 0: 1
1: 2
2: 1
3: 32
4: 368
Right 1085339526 11:75722157-75722179 TCTTGTCAGCAAAGAAACTTAGG 0: 1
1: 0
2: 0
3: 28
4: 259
1085339522_1085339528 14 Left 1085339522 11:75722136-75722158 CCTGCAGGGCCCACTCCTGGGTC 0: 1
1: 2
2: 1
3: 32
4: 368
Right 1085339528 11:75722173-75722195 ACTTAGGGCTTGCTGAGTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 154
1085339522_1085339527 -1 Left 1085339522 11:75722136-75722158 CCTGCAGGGCCCACTCCTGGGTC 0: 1
1: 2
2: 1
3: 32
4: 368
Right 1085339527 11:75722158-75722180 CTTGTCAGCAAAGAAACTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 163
1085339522_1085339529 15 Left 1085339522 11:75722136-75722158 CCTGCAGGGCCCACTCCTGGGTC 0: 1
1: 2
2: 1
3: 32
4: 368
Right 1085339529 11:75722174-75722196 CTTAGGGCTTGCTGAGTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085339522 Original CRISPR GACCCAGGAGTGGGCCCTGC AGG (reversed) Intronic
900402318 1:2477632-2477654 GTCCCAGGAGAGGGGGCTGCAGG - Intronic
900532685 1:3162475-3162497 GGGGCAGGAGTGGGCTCTGCTGG - Intronic
901002333 1:6154962-6154984 GGCAGAGGGGTGGGCCCTGCCGG - Intronic
901044181 1:6385713-6385735 GACACAGGCTTGGGCTCTGCTGG - Exonic
901496569 1:9625871-9625893 CACCCAGGAGGGCGACCTGCTGG + Intergenic
901684693 1:10937419-10937441 GAACCAGGACTGAGGCCTGCTGG + Intergenic
901933965 1:12615596-12615618 GACCCAGGACTTGGGCCAGCTGG + Intronic
905434175 1:37945796-37945818 GTCCCAGGAGGCGGCTCTGCCGG + Exonic
905894059 1:41533915-41533937 GACCCAGGAGCAGACACTGCAGG - Intronic
906193554 1:43914668-43914690 GAACCAGGATTGGGCACAGCTGG - Intronic
906286067 1:44588686-44588708 GGCCCAGCAGTCGGCCCAGCTGG - Intronic
908002887 1:59698364-59698386 GACCAAGGGGTGGGAACTGCGGG - Intronic
908267732 1:62395450-62395472 GGCCCTGGAGTAGGACCTGCAGG - Intergenic
911094341 1:94043405-94043427 GTCCCAGGAGGAGGCCCAGCTGG - Exonic
913385684 1:118255909-118255931 GACCAGGGAGAGGGCCCTGGGGG + Intergenic
915471931 1:156130784-156130806 GGGCCATGGGTGGGCCCTGCAGG - Intronic
915588526 1:156858051-156858073 GACACAGGACAGGGCCCTGGAGG + Intronic
918434798 1:184500354-184500376 GATTCAGGAATGGGGCCTGCAGG + Intronic
919731535 1:200916343-200916365 GGCCCTGGAGCGGTCCCTGCAGG - Intergenic
919856484 1:201709653-201709675 GCCCCAGCAGTGGCCCCTGGTGG - Intronic
920282365 1:204853841-204853863 GACCCAGGGGTGTGCCTAGCTGG - Intronic
920792534 1:209106674-209106696 GCCCGCTGAGTGGGCCCTGCAGG + Intergenic
922364160 1:224848344-224848366 TACCCAGCAGTGGGACCTGCTGG - Intergenic
922792129 1:228316447-228316469 GAGCCAGGAGGGGGACCTGTTGG + Intronic
922818660 1:228469634-228469656 GCCCCAGGAGTCGCCCCTGATGG - Intergenic
923344825 1:233041527-233041549 GACCAAGAAGTGGGTCCTGTAGG - Intronic
923624044 1:235599679-235599701 AAGGCAGGACTGGGCCCTGCTGG - Intronic
1062829072 10:593431-593453 GACCCGGGTGTGGGGTCTGCTGG - Intronic
1065189830 10:23199024-23199046 GTCCCAGGAGCGGGCTCGGCAGG - Intergenic
1066267271 10:33788540-33788562 AACACAGGAGTGGTCCCTGTTGG - Intergenic
1066302641 10:34110405-34110427 GAGACAGGAGTGGCTCCTGCCGG - Exonic
1070548695 10:77473769-77473791 GGCCCAGAAGAGAGCCCTGCAGG - Intronic
1070611612 10:77937235-77937257 GAGGCAGAAGTGGGCCCTGGGGG - Intergenic
1070737727 10:78875897-78875919 GACCCAGGACTGAGCTCTGGTGG - Intergenic
1071100558 10:82031976-82031998 GACCAAGCAGTGGGCCATTCAGG + Intronic
1071566316 10:86673119-86673141 GACACAAGAATGGGCCTTGCTGG + Intronic
1071972338 10:90921070-90921092 ATCCCTGGAGTTGGCCCTGCTGG + Exonic
1072462342 10:95631194-95631216 GAGCCAAGAGTGGCCCCTCCAGG + Intronic
1072612539 10:97028254-97028276 GAGGCAGGAGTGAGCCCTGCTGG - Intronic
1073336454 10:102714094-102714116 GACCCGAGGGTGGGCCCTGGAGG - Intronic
1074046775 10:109846750-109846772 CCCCCAGACGTGGGCCCTGCTGG + Intergenic
1074527798 10:114276983-114277005 GACCCAGGACTGAGCCCTGAGGG - Intronic
1074767207 10:116708092-116708114 GCCCCAGGAATGGGCCCCCCGGG + Intronic
1075080548 10:119380763-119380785 GACCCAGGAGAAGGCCAGGCAGG - Intronic
1075112024 10:119596014-119596036 GGCCCGGGGGTGGGCCCCGCGGG - Intronic
1075382384 10:122029868-122029890 CAGCCAGTAGTGGGGCCTGCAGG - Intronic
1076729460 10:132431185-132431207 GCCCCAGGACTGGACCCAGCTGG + Intergenic
1076844229 10:133061079-133061101 AAGCCAGGTGAGGGCCCTGCAGG + Intergenic
1076883171 10:133249345-133249367 GAAGGACGAGTGGGCCCTGCTGG + Intergenic
1077269280 11:1667467-1667489 GACCCAAGGTAGGGCCCTGCGGG - Intergenic
1077435487 11:2536833-2536855 GACCCAGGTGTGGGCAGGGCTGG + Intronic
1078134389 11:8640226-8640248 GAGCCAGGAGGAGACCCTGCAGG - Exonic
1081405777 11:42695948-42695970 CACCCAGTAGTGGGCCTTGGTGG - Intergenic
1083681240 11:64352780-64352802 GGCACAGGAGGTGGCCCTGCTGG + Exonic
1083765709 11:64840491-64840513 GACACAGGAGAGGGCCCTTGGGG - Intronic
1084033113 11:66492559-66492581 GACCCAGGCCTGGGCCCTACTGG - Intronic
1084263177 11:67991622-67991644 GGGCCAGGCCTGGGCCCTGCGGG + Exonic
1084410523 11:69003808-69003830 AACCCAGGATGGGGCCCTTCTGG + Intergenic
1084493016 11:69488550-69488572 AACCCTGGAGAAGGCCCTGCTGG + Intergenic
1085339522 11:75722136-75722158 GACCCAGGAGTGGGCCCTGCAGG - Intronic
1088888226 11:114024362-114024384 GCACCAGGAGTGGGCCCTGCAGG - Intergenic
1089012080 11:115139643-115139665 CACCCAGGAGTGGGGCCAGCAGG - Intergenic
1089261670 11:117227971-117227993 GAGTAAGGAGTGGCCCCTGCAGG - Intronic
1089279005 11:117359498-117359520 GATGCAGAAATGGGCCCTGCTGG + Intronic
1089493741 11:118898531-118898553 GGCCCATGAGGGAGCCCTGCGGG + Exonic
1089565736 11:119370656-119370678 GACCCTGGAGAGGCCTCTGCTGG + Intronic
1090226253 11:125073860-125073882 GACCCAGGGCTGTGCCCTGTAGG - Intronic
1091176386 11:133562095-133562117 GACACAGGAGGGGCCGCTGCTGG - Intergenic
1091220573 11:133927852-133927874 GACCCGGGAGTGGATCCTGGAGG - Intronic
1091357945 11:134952353-134952375 TCCCCAGAAGTGGGACCTGCTGG + Intergenic
1091761802 12:3092513-3092535 CACCCAGGAGTGGGCTCTGAAGG + Intronic
1092015393 12:5154289-5154311 CAGCCAGGAGAGGGCTCTGCCGG - Intergenic
1092543082 12:9432350-9432372 AGCCCAGGTGAGGGCCCTGCAGG - Intergenic
1094509937 12:31090088-31090110 AGCCCAGGTGAGGGCCCTGCAGG + Exonic
1095752926 12:45730198-45730220 GACCCCGGAGTGGGCGCTTGGGG + Intronic
1100464727 12:94834867-94834889 GACCCTGGAGGGTGCACTGCAGG - Intergenic
1100809568 12:98325051-98325073 GACCCACATGTGGGACCTGCAGG + Intergenic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1106249315 13:27971840-27971862 CAGCCAGGAGAGGGCCCAGCTGG + Intergenic
1106409973 13:29504826-29504848 GAACCATGAGGGGGTCCTGCAGG + Exonic
1106808720 13:33337962-33337984 GACCCTGCAGTCAGCCCTGCCGG + Intronic
1108706575 13:52993899-52993921 GACCCAGGGGTGGGGGCTGGGGG + Intergenic
1109936147 13:69287308-69287330 GCCCCAGGAGTGGAACATGCTGG - Intergenic
1110413070 13:75224232-75224254 CACCCAGGAGTAGGGCCAGCTGG + Intergenic
1110460937 13:75745118-75745140 GAGCCTGGAGTGGGCCCTGGTGG + Intronic
1110544623 13:76742792-76742814 GACCAAGTAGTGGGTCCTGTAGG - Intergenic
1111161459 13:84399745-84399767 GACCCTGTAGTTGGCCTTGCAGG + Intergenic
1113802752 13:113094984-113095006 CACCCACGAGTGGGCTCTACAGG - Intronic
1115651359 14:35404602-35404624 CCCCCAGGAGTGGGCCATGGAGG - Exonic
1116121326 14:40724869-40724891 AACAGAGGAGTGGCCCCTGCTGG - Intergenic
1116308727 14:43293234-43293256 GAACCAGGAGTGGGCCAGGTGGG + Intergenic
1117981795 14:61348969-61348991 GACACAGAAGTGTTCCCTGCTGG + Intronic
1118814525 14:69300652-69300674 GACCTAGGAGGAGGGCCTGCAGG - Intronic
1121137176 14:91509799-91509821 GTCCCTGGAGCGGGCCATGCAGG - Exonic
1121417172 14:93787724-93787746 GCCCCAGGAGCGGGCGCCGCTGG - Exonic
1121557650 14:94850507-94850529 GACCCAGGAGTGGTCCTTTCTGG + Intergenic
1122046492 14:99027642-99027664 TGCCCAGGTGTGGTCCCTGCAGG - Intergenic
1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG + Intergenic
1123192293 14:106583006-106583028 GACACAGGAGTGATCCCTGATGG + Intergenic
1124096643 15:26654635-26654657 TACCCAGGAGTGGGGACTACAGG - Intronic
1124653362 15:31488561-31488583 CTCCCAGGTGTGGGGCCTGCAGG - Intronic
1126105594 15:45144975-45144997 CATCCAGGAGTGGGAGCTGCGGG + Exonic
1126996635 15:54452224-54452246 GACCCAAGAATTGGCCCTCCTGG - Intronic
1128580880 15:68808824-68808846 AACCCAGCACTGGGCACTGCTGG + Intronic
1128838793 15:70832744-70832766 GACCCAGGAGTGCGCCATCGTGG - Exonic
1129269887 15:74413994-74414016 TTCCCTGGAGTAGGCCCTGCTGG - Intronic
1129615850 15:77098308-77098330 TACCCAGGGGTGGGCTCTGGTGG + Intergenic
1130678398 15:85974368-85974390 AACCCAGGAGGGGTCCCTGGAGG + Intergenic
1130745672 15:86651237-86651259 GACTCTGATGTGGGCCCTGCAGG + Intronic
1131449563 15:92528054-92528076 GACCCAGGAGCTGGCCCAGGAGG - Intergenic
1132522754 16:399003-399025 GACCCGGGAGCGGACCCTGGTGG + Exonic
1132548250 16:543524-543546 GACCCAGGGGAGGGCCAGGCAGG - Intronic
1132584810 16:701483-701505 GGCCCAGGCATGGGCGCTGCGGG + Intronic
1132699805 16:1217520-1217542 GGCCCGGGGGAGGGCCCTGCAGG - Intronic
1135626731 16:24002092-24002114 GACCCAGGACAGAGCCCAGCAGG - Intronic
1136580642 16:31149099-31149121 GACCCAGGAGGGGGCGATGAGGG + Exonic
1136608592 16:31352844-31352866 GACCCAGGAGTGGGCCATGCTGG - Intergenic
1137855356 16:51789466-51789488 GACCCAGGATTGGGTTTTGCTGG - Intergenic
1138686885 16:58733899-58733921 GTCCCCGCACTGGGCCCTGCAGG - Intronic
1139300783 16:65943577-65943599 GACCCAGGAGAGGGCATGGCTGG - Intergenic
1139328787 16:66171744-66171766 AACCCAGTACTGGGCTCTGCAGG + Intergenic
1140128595 16:72137903-72137925 GACCCAGGAGTGGGCACTGCAGG + Intronic
1140850703 16:78932510-78932532 AACCTTGAAGTGGGCCCTGCCGG + Intronic
1141630328 16:85284145-85284167 GGCCCAGGAGAAGGCCCGGCGGG + Intergenic
1141638813 16:85329517-85329539 GACCCAGGCCTGGGGCCAGCGGG - Intergenic
1141905915 16:87027121-87027143 CACTCAGGCGAGGGCCCTGCGGG + Intergenic
1142020711 16:87780432-87780454 GACCCAGCAGTGGTCACCGCTGG + Intergenic
1142149347 16:88505864-88505886 GCCCCATGGGGGGGCCCTGCCGG - Intronic
1142250375 16:88989224-88989246 GACCCACGCCTGGGCCATGCGGG - Intergenic
1142349048 16:89571398-89571420 GACCCAGGAGTGGGGACAGTGGG + Intergenic
1142666244 17:1465527-1465549 ACCCCAGGAGTGGGCCAGGCCGG - Exonic
1143019792 17:3911463-3911485 GCCCCAGGCGTGAGGCCTGCCGG + Intronic
1143425364 17:6831861-6831883 GACCCAGGAGTGTGGCGTGTGGG + Intergenic
1144309806 17:14002350-14002372 GACGCAAGAGTGGGCCATGAAGG + Intergenic
1144777438 17:17791875-17791897 GACCCAGGATTCTGCTCTGCAGG + Intronic
1144957855 17:19028474-19028496 GAGGCAGGAGTGGGCCCTGAAGG + Intronic
1144977303 17:19146046-19146068 GAGGCAGGAGTGGGCCCTGAAGG - Intronic
1145793525 17:27642838-27642860 GACCCTGGTGTGGGCCCAGGGGG - Intronic
1145808334 17:27750384-27750406 GACCCTGGTGTGGGCCCAGGGGG - Intergenic
1145939968 17:28738088-28738110 CACCTAGGGGTGGGGCCTGCAGG - Exonic
1146005769 17:29159703-29159725 CTGCCAGGAGTGGGGCCTGCAGG - Intronic
1146208142 17:30922210-30922232 GACCCAGACGTGGCACCTGCGGG + Intronic
1146724818 17:35148368-35148390 GACCAAGGACAAGGCCCTGCTGG + Exonic
1147155670 17:38543474-38543496 GACCCAGGCGTTGGGGCTGCTGG + Intronic
1147567081 17:41544379-41544401 ACCCCAGGCCTGGGCCCTGCAGG + Intergenic
1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG + Intergenic
1148603247 17:48909217-48909239 GACCGATGGGTGGGGCCTGCGGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151655280 17:75492922-75492944 GCCCCAGGAGTGAAGCCTGCAGG - Exonic
1151830019 17:76544130-76544152 GATCCAGGAGCAGACCCTGCAGG + Intronic
1152165711 17:78703942-78703964 TACCCAGGGGTGGACACTGCTGG + Intronic
1152605615 17:81288213-81288235 GACCCACGTGTGGACCGTGCAGG + Intronic
1152645907 17:81468402-81468424 GATTCAGCAGTGTGCCCTGCAGG - Intergenic
1152939450 17:83160516-83160538 CACCCAGGAGTGAGGCCTGAGGG - Intergenic
1154496967 18:14968788-14968810 TCCCCAGAAGTGGGACCTGCTGG - Intergenic
1154502490 18:15003719-15003741 GTCCCCGGGCTGGGCCCTGCAGG - Intergenic
1155060467 18:22223821-22223843 GACTCAGGTGCCGGCCCTGCTGG + Intergenic
1155403756 18:25465578-25465600 GCCCTCGGAGTGGCCCCTGCGGG - Intergenic
1157244604 18:46042034-46042056 GCCCCAGGCCTGGGTCCTGCTGG - Intronic
1157433662 18:47651238-47651260 GGGCCAGGTGTGGGCCCTGCAGG + Intergenic
1158649731 18:59274101-59274123 GGCCCTGGGGTGGGCGCTGCGGG - Intergenic
1159264985 18:66069152-66069174 GACCCAGGATTGGTCACTGAAGG + Intergenic
1160714954 19:572365-572387 GAAACGGGAGTGGGGCCTGCGGG - Intronic
1160861636 19:1239676-1239698 GACCCTGGAGTGGGGACTGGAGG + Intergenic
1160919735 19:1513807-1513829 ATCCCAGCAGTGGGCCCGGCAGG + Intergenic
1161029432 19:2050932-2050954 GGCCGAGGAGGGGACCCTGCGGG + Exonic
1161231367 19:3176623-3176645 GACCCAGGATAAGTCCCTGCTGG - Intronic
1161243890 19:3238327-3238349 AACCCTGGTTTGGGCCCTGCGGG - Intronic
1161381732 19:3969022-3969044 GACCGAGGTTTGGGCCCAGCTGG + Intronic
1161681648 19:5682618-5682640 GAGCCTGGATTGGGTCCTGCTGG + Intronic
1161698570 19:5783454-5783476 GGTCAAGGAGGGGGCCCTGCTGG - Exonic
1163052490 19:14695045-14695067 CATCCAGGAGTGGGCATTGCTGG + Exonic
1163236894 19:16035192-16035214 GGCCTTGGAGTGGGCCCAGCAGG - Intergenic
1163480926 19:17555842-17555864 GAGCCCGGAGTCGCCCCTGCAGG + Exonic
1163674504 19:18648700-18648722 TTCCCAGGACTGGGACCTGCTGG - Intronic
1164503699 19:28840677-28840699 GTGCCAGGATTGGGCCATGCAGG - Intergenic
1164577353 19:29413305-29413327 GGCCCATGAGTGAGCCCTGCCGG + Intergenic
1164840497 19:31389215-31389237 GACCCAGCCCTGGCCCCTGCTGG - Intergenic
1165166706 19:33862155-33862177 GACCTGGGAGTGGGCCCGGGGGG + Intergenic
1165718700 19:38063637-38063659 GCCACAGGAGTGAGCCCTGGAGG + Intronic
1166331724 19:42081610-42081632 CACCCAGAAGTGGGCCTGGCAGG + Intergenic
1166345373 19:42162166-42162188 GACTCAAGTGTGGGCCCTGCTGG - Intronic
1166733742 19:45072434-45072456 GGCCCAGGAGCGGGGCCTCCGGG + Exonic
1167011771 19:46813399-46813421 GACCCGGGAGTGGGGACGGCCGG + Intergenic
1167381291 19:49139772-49139794 GACCCAGGCCTTGGCACTGCAGG + Exonic
1168115916 19:54221329-54221351 GGGCCAGGACAGGGCCCTGCAGG + Exonic
1168118899 19:54241077-54241099 GGGCCAGGACAGGGCCCTGCAGG + Exonic
1168622261 19:57888880-57888902 GGCCCAGGAGTGGGTCACGCTGG + Exonic
925176099 2:1784991-1785013 TACCCAGGAGGGGACCCTGTTGG - Intergenic
925362029 2:3286394-3286416 GCCCCAGGAGTGGGCCCAGAAGG + Intronic
926250436 2:11152844-11152866 GAGCCAGGTTTGGGCCATGCAGG - Intergenic
926459345 2:13109691-13109713 GACCTATGAGTGGGCCTAGCAGG - Intergenic
927520047 2:23693116-23693138 CACCCAGGAAGGGGGCCTGCAGG + Intronic
928935930 2:36678032-36678054 GGCCCAGGACTGAGCTCTGCTGG + Intergenic
929817991 2:45251163-45251185 GACTTAGGAGTTGGCTCTGCTGG + Intergenic
929879480 2:45823607-45823629 AAGCCAGGAGTGGGCCATGGTGG + Intronic
931665977 2:64609646-64609668 GCCCCAGGACTGGGCCCAGGAGG - Intergenic
933812168 2:86039660-86039682 GCACAAGGAGTGGGCCCTCCAGG - Intronic
936078024 2:109414110-109414132 CACCCAGAAGAGGGCCCTGAAGG - Intronic
936373586 2:111922535-111922557 AAGCCAGGTCTGGGCCCTGCGGG - Intronic
937219925 2:120336897-120336919 GAGGCAGGAGAGGGCACTGCAGG - Intergenic
937884067 2:126888265-126888287 GGCTCAGAATTGGGCCCTGCAGG - Intergenic
938109191 2:128552762-128552784 GCCCCAGCAGAGGGCCCAGCAGG - Intergenic
938342010 2:130541896-130541918 CACCCTGGGGTGAGCCCTGCTGG + Intronic
938347822 2:130578815-130578837 CACCCTGGGGTGAGCCCTGCTGG - Intronic
938501669 2:131833891-131833913 GTCCCTGGACTGGGCCCTGCAGG - Intergenic
938757323 2:134392847-134392869 GACCCAGGGGTGCCCCCTTCTGG - Intronic
939041637 2:137196254-137196276 GACCAAGAAGTGGGCCCTCTAGG - Intronic
942481528 2:176393357-176393379 TACCCAGCACAGGGCCCTGCTGG + Intergenic
943654079 2:190488745-190488767 AACCCAGGTGAAGGCCCTGCAGG - Exonic
946245327 2:218384108-218384130 GACCCAGGAATGGGCCATGGAGG + Intronic
948124942 2:235557714-235557736 GACCCCAGAGTGGGCACTTCAGG + Intronic
948257641 2:236579399-236579421 GACCCAGGACTGTGGCCTGGAGG + Intronic
948464593 2:238146105-238146127 GCCCCAGGAGGGGTTCCTGCAGG + Intronic
948896371 2:240929787-240929809 GAACCAGGCCTGGCCCCTGCTGG - Intronic
1168838400 20:893040-893062 GACCCAGGACTGGGCCATGGGGG - Intronic
1169360788 20:4947102-4947124 GACCCAGGAGTGCTCCCTGGAGG - Intronic
1170986984 20:21267440-21267462 GACCCTGGATTGGCCTCTGCTGG - Intergenic
1171298503 20:24039493-24039515 GCCCCTGGTGAGGGCCCTGCAGG + Intergenic
1171361876 20:24591807-24591829 GACCCAGAAGTGGGCATTGATGG - Intronic
1173923349 20:46762248-46762270 AACCAAGGAGTTGGCCCTTCTGG - Intergenic
1174106363 20:48165273-48165295 GAGGAAGGAGTGGGTCCTGCAGG + Intergenic
1174396523 20:50250342-50250364 GACCCAGGGCTGGGCGATGCTGG - Intergenic
1175335353 20:58192658-58192680 GAGTCAGCAGTCGGCCCTGCTGG + Intergenic
1175734076 20:61373185-61373207 CACCCAGGTGTGTGTCCTGCCGG + Intronic
1175762498 20:61571132-61571154 GACACAGGAAAGGACCCTGCAGG - Intronic
1175896104 20:62336157-62336179 TACCCATGAGTGTGCCCTGAAGG - Intronic
1176060750 20:63171679-63171701 GCCACAGGAGTGTGCCATGCTGG - Intergenic
1176239269 20:64068417-64068439 GACCCAGCAGGGGGCCTTGGGGG - Intronic
1176297343 21:5081125-5081147 GAGGAAGGAGTGGGCCCTGGAGG - Intergenic
1176722055 21:10401282-10401304 GCCCGAGCAGTGAGCCCTGCTGG + Intergenic
1178148820 21:29770317-29770339 GACCCAGACGTGGGCACTACTGG - Intronic
1179613929 21:42569651-42569673 GACCCGGGAGAGGGGCCTGGAGG - Intronic
1179859686 21:44180823-44180845 GAGGAAGGAGTGGGCCCTGGAGG + Intergenic
1180303245 22:11054059-11054081 GCCCGAGCAGTGAGCCCTGCTGG + Intergenic
1180711963 22:17845428-17845450 CACCTGGGAGAGGGCCCTGCAGG + Intronic
1180866313 22:19122018-19122040 GCCCCAGGCGCGGCCCCTGCAGG + Intronic
1180922128 22:19526301-19526323 GGCCCAGGAGAGGGGCCTGGTGG - Intronic
1181020681 22:20100605-20100627 GTGCCAGGAGAGGGCCCAGCGGG + Intronic
1181048624 22:20228293-20228315 GGTCCAGCACTGGGCCCTGCAGG - Intergenic
1181311518 22:21947268-21947290 GGCCCAGGTGTGGGGCCTGGAGG - Intronic
1181431417 22:22884041-22884063 GACCCAGGGGAGGGCTCTGGTGG - Intronic
1181510471 22:23386612-23386634 GCCCCAGGAGGTGGCCATGCTGG - Intergenic
1181622302 22:24099352-24099374 AACCCAGGAGGGGACACTGCAGG - Intronic
1182350402 22:29696021-29696043 GACCAAGGAGTGAGCCGTGGGGG - Exonic
1183478777 22:38051434-38051456 AACGCAGGACTGGCCCCTGCTGG + Intergenic
1183519862 22:38290619-38290641 GACCCGGAAGTGGGTCTTGCTGG - Intergenic
1183706395 22:39477274-39477296 GACCCAGGAGAGGAGTCTGCAGG + Intronic
1184244945 22:43231141-43231163 CACCCAGGAGATGGCGCTGCCGG - Intronic
1184315133 22:43682073-43682095 GAGCCAGGAGTGGGCAGGGCTGG - Intronic
1184765342 22:46569307-46569329 GACCCACAGGAGGGCCCTGCCGG + Intergenic
1184796685 22:46737356-46737378 CACCCTGGAGAGAGCCCTGCAGG - Intronic
1184871311 22:47240200-47240222 GAACCGGGAGTGGGCACTGAGGG - Intergenic
1185042248 22:48511088-48511110 GACCCAGAACTGGTCTCTGCTGG + Intronic
1185271205 22:49929919-49929941 GAGCCAGGACTGGGGTCTGCAGG + Intergenic
949959725 3:9302170-9302192 TACCCAGCAGTGGGCCCTGGGGG - Intronic
950449807 3:13059201-13059223 GCCCCTGGGGTGGGGCCTGCTGG - Intronic
950487868 3:13283296-13283318 GACCCAGGGGCGGTCCCAGCAGG - Intergenic
950547366 3:13646401-13646423 GACCCAGGTGTGGGCCCCACAGG - Intergenic
950641871 3:14353668-14353690 AACCCAGGCGGGGGCCCTGCTGG - Intergenic
952875600 3:37941804-37941826 GACCCAGCAGTCTCCCCTGCCGG - Intronic
953842875 3:46403844-46403866 CACTGAGGAGTGGGCACTGCAGG + Intergenic
954105543 3:48407879-48407901 TACCCTGGAGGTGGCCCTGCGGG + Intronic
954413572 3:50381865-50381887 GACCCATGAGTGTCCCCTGTAGG - Intronic
954997129 3:54891932-54891954 CACCCAGGAGTGGGCCCTCTGGG + Intronic
957078615 3:75619558-75619580 GGGCCAGGCCTGGGCCCTGCGGG + Intergenic
958632477 3:96701071-96701093 AACAGAGGAGTGGCCCCTGCTGG + Intergenic
958826956 3:99041870-99041892 GACCAGGGAGTGAGACCTGCTGG + Intergenic
961457406 3:127031070-127031092 GTCCCAGGGGTGGGCCAGGCCGG - Intronic
961645461 3:128390582-128390604 CATGCTGGAGTGGGCCCTGCAGG + Intronic
962393916 3:134998181-134998203 GACCCAGAAGTGGTGCATGCAGG - Intronic
962827773 3:139112385-139112407 CACCCAGGTGTGGGGCCTGCTGG - Intronic
962893717 3:139695378-139695400 TTCCCAGGAGAGTGCCCTGCAGG + Intergenic
966182045 3:177197081-177197103 GACCCTGGAGTGGGGGCGGCCGG - Intronic
966595509 3:181721771-181721793 GAACCAGGAGTGGGCAGTGAGGG - Intergenic
967229603 3:187324897-187324919 GACCAAGGACAGGGCCCTGTGGG + Intergenic
967942247 3:194775221-194775243 GACACATGAGTGAGCCCAGCTGG + Intergenic
968599510 4:1502430-1502452 CCCCCAGGAGTGGGGGCTGCTGG - Intergenic
968748284 4:2372414-2372436 GACCCAGCACTGGAACCTGCTGG - Intronic
968902142 4:3436813-3436835 TTCCCAGGAGGGGGTCCTGCTGG - Intronic
968985046 4:3870364-3870386 GACCCAGGACAGGGCTTTGCAGG + Intergenic
969165208 4:5303192-5303214 TACCCAGGAGGGGGCATTGCTGG + Intronic
969285790 4:6200918-6200940 GAGCCTGGAGTGGGGCTTGCAGG + Intergenic
969525972 4:7704296-7704318 GACCGGGGAGTGGGCACTGGTGG + Intronic
970033299 4:11702195-11702217 GGCCCAGGACTGGGCCTGGCAGG - Intergenic
970129807 4:12854987-12855009 GACCCAGGAGTTGTCCATGTAGG - Intergenic
970609065 4:17708987-17709009 GGTCCAGGAGTCAGCCCTGCAGG - Exonic
975740641 4:77425893-77425915 AACCCAGGAACAGGCCCTGCAGG - Intronic
976197061 4:82543124-82543146 GAACCAGGATTGGGCCCAGGGGG + Intronic
979183092 4:117755131-117755153 GAGACAGGATTGGGTCCTGCAGG + Intergenic
980729194 4:136805016-136805038 GACACAGGAGTGAGTTCTGCAGG - Intergenic
981073521 4:140569032-140569054 GACCCGGGCGTGGGACCTGCCGG + Intergenic
984160296 4:176244620-176244642 GACCCAGGGGTTGGGCCTGGTGG + Intronic
984694127 4:182762597-182762619 GATCCAGGAGTGAGAGCTGCTGG - Intronic
984769153 4:183422607-183422629 GACAGAGGAGTGGGGCTTGCAGG - Intergenic
984874496 4:184355175-184355197 TAGGCAGGAGTGGCCCCTGCAGG + Intergenic
985638919 5:1054116-1054138 GACCCAGTAGTGGCCACTGAGGG - Intronic
985844677 5:2335328-2335350 GACTGAGGCGTGGGCCCCGCGGG - Intergenic
986283639 5:6344186-6344208 AACCCAGAAGTGGACCCTACAGG - Intergenic
986365143 5:7021904-7021926 AACAGAGGAGTGGCCCCTGCTGG - Intergenic
987308267 5:16658698-16658720 GAGCCATGAGCGGGCCCAGCAGG + Intergenic
988984456 5:36603176-36603198 GAGCCAGTAGTGGTTCCTGCTGG - Intergenic
989155389 5:38340025-38340047 GGCCAAGCAGTGAGCCCTGCAGG - Intronic
993872451 5:93268303-93268325 GATCCTGGAGTGGACACTGCGGG + Intergenic
996405019 5:123095532-123095554 GACCCGGGAGTGCCGCCTGCTGG - Intronic
996413736 5:123187038-123187060 GACCAGGGAGCGGGGCCTGCAGG - Intronic
998129731 5:139645626-139645648 GACCCTGGAGTGTGCTCTCCTGG - Intergenic
998158699 5:139800823-139800845 GATGCAGGCGGGGGCCCTGCTGG - Intronic
1002919967 6:1561095-1561117 GACCCAGGAGAGAGACCTTCTGG + Intergenic
1005315514 6:24599426-24599448 CACCCTGCAGTGGGCCATGCAGG + Intronic
1006301438 6:33195451-33195473 CACCCTGGAGAGGGACCTGCAGG + Exonic
1006445578 6:34077943-34077965 GGCCCAGCAGTGGCCACTGCTGG - Intronic
1006829355 6:36959360-36959382 CACGCAGGTGTGGGCCCGGCGGG + Exonic
1006909527 6:37555078-37555100 CTAGCAGGAGTGGGCCCTGCAGG - Intergenic
1007582458 6:42967569-42967591 GACAGAGGAGTGGGCACTGAGGG + Intronic
1007607166 6:43125382-43125404 GCCCCAGGAGTGGGTGCTGGAGG + Intronic
1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG + Intronic
1011747557 6:90420813-90420835 GACCCAGGCGTGGGCCTTCGGGG - Intergenic
1016866935 6:148776891-148776913 GACCCAAGAGTGCACCCAGCAGG - Intronic
1017951316 6:159137374-159137396 GACACAGAAGTGGGCCCCACAGG + Intergenic
1018640154 6:165897927-165897949 CACCCAGGAGTAGAACCTGCGGG + Intronic
1018643630 6:165928401-165928423 GATCCTGGAGTGGGTCCAGCAGG - Intronic
1018669952 6:166169273-166169295 GACCCCGGAGCGAGCCCGGCTGG - Intergenic
1018901160 6:168052427-168052449 GATGCAGGAGTGTGCCCTGTGGG - Intergenic
1019181516 6:170190100-170190122 GGCCCAGGTGTGGGCCAAGCAGG - Intergenic
1021329679 7:19320461-19320483 GACCAGGAAGTGGGTCCTGCAGG - Intergenic
1021364601 7:19761068-19761090 GCCCAGGGAGTGGGACCTGCAGG - Intronic
1021855292 7:24849229-24849251 AGCACAGCAGTGGGCCCTGCAGG + Intronic
1021874143 7:25032848-25032870 GAACCAGGAACGGCCCCTGCAGG + Intergenic
1022504070 7:30899761-30899783 GTCTCAGGAGTGGTCACTGCTGG - Intergenic
1022763225 7:33380332-33380354 GGCCAAGGAGAGGGCACTGCTGG - Intronic
1022989622 7:35694918-35694940 GACCCGGGGCTGGGCCGTGCCGG - Exonic
1023674324 7:42614656-42614678 GAGCCGGGAGTTGGCCCAGCAGG - Intergenic
1023744594 7:43311274-43311296 GAATTAGGAGTGGTCCCTGCTGG - Intronic
1023845044 7:44115802-44115824 GATCCTGGAGTGGACCCTGCGGG - Exonic
1023992405 7:45136315-45136337 GACCCAGGAGAGGGAGCTGTTGG - Intergenic
1024280155 7:47711865-47711887 GAGTCAGGGTTGGGCCCTGCAGG + Intronic
1026770126 7:73191063-73191085 CACACAGCAGTGGACCCTGCTGG - Intergenic
1026878463 7:73893496-73893518 GGCCCAGCAGTGGGACCGGCTGG - Intergenic
1027010993 7:74744450-74744472 CACACAGCAGTGGACCCTGCTGG - Intronic
1027077048 7:75201590-75201612 CACACAGCAGTGGACCCTGCTGG + Intergenic
1028479418 7:91288424-91288446 AACTCAGGAGTGCCCCCTGCTGG - Intergenic
1028966349 7:96805960-96805982 GTCCTAGGAGTGGCCCATGCAGG - Intergenic
1031865329 7:127032441-127032463 GTCCCAGGAGTGTGACCTGATGG - Intronic
1032403161 7:131637835-131637857 TACCCTGCTGTGGGCCCTGCAGG + Intergenic
1032871925 7:135994965-135994987 TACCAAGGATTGGGTCCTGCTGG + Intergenic
1033215238 7:139488822-139488844 GTTCCAGGAGGTGGCCCTGCAGG + Intergenic
1033252133 7:139769339-139769361 CAGCCAGGGGTGGGCCATGCTGG - Intronic
1033325664 7:140375981-140376003 GACCCATGATTAAGCCCTGCTGG + Intronic
1034431313 7:151042586-151042608 GCCCCAGGAGAGGGCTCTGGTGG + Intronic
1034441720 7:151089020-151089042 GGCCCAGGAGTGGGAACAGCAGG - Intronic
1035094715 7:156344226-156344248 AACCCAGGACTGGGCCAGGCTGG + Intergenic
1035204943 7:157289237-157289259 GGCCCAGGAGTGGTCAGTGCTGG + Intergenic
1035333583 7:158112083-158112105 GACCCAGGTGTGGGCAGGGCTGG - Intronic
1035382479 7:158448610-158448632 GGCCCAGGAGTGGGAGCTGCAGG - Intronic
1035575429 8:701417-701439 TACCCACGGGTGTGCCCTGCTGG + Intronic
1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG + Intronic
1035754777 8:2023053-2023075 GAACCACGTGTGGGCCCAGCCGG + Intergenic
1036209308 8:6829075-6829097 GAGGCAGGACTGGGCCCTCCAGG + Intronic
1036691988 8:10949949-10949971 GAGCCAGGAGAGGGCCATGTTGG - Intronic
1038883435 8:31639351-31639373 GACCCGCGAGTGGGTCCTCCTGG - Intergenic
1041786212 8:61637232-61637254 GACCCAAGACTGGGACCTGTGGG - Intronic
1044819301 8:96145096-96145118 TCCCCAGGAGCGGGCCCTGCTGG - Exonic
1048469956 8:134696763-134696785 GACCTAGGAGGGACCCCTGCTGG - Intronic
1049046396 8:140155321-140155343 GACCCATGAGTGGAAGCTGCGGG + Intronic
1049411852 8:142477092-142477114 GACGCTGTAGTGGGGCCTGCAGG + Exonic
1049557956 8:143292826-143292848 GTGACAGGAGTGGGCCCAGCTGG + Intronic
1049576995 8:143394091-143394113 GTCCCAGGAGTGAGGCTTGCGGG - Intergenic
1049709829 8:144058457-144058479 GGCCCAGGAGTGGGCAGTGGGGG + Intronic
1049841724 8:144777562-144777584 TTCCCAGGAGTAGGACCTGCAGG - Exonic
1050223367 9:3422246-3422268 GACTCTGGAGTCAGCCCTGCTGG - Intronic
1051663275 9:19445104-19445126 GACCCAGGAGTGGTCCCCTCCGG + Intronic
1052831724 9:33221328-33221350 GGCCCAGACCTGGGCCCTGCTGG - Intronic
1055887850 9:81085784-81085806 ACCCCAGGAGTGGCCCCTGTGGG - Intergenic
1056581421 9:87889956-87889978 AGCCCAGGACTGTGCCCTGCGGG - Intergenic
1057075420 9:92135887-92135909 GACCCTGGTGAGGGCCCTGCAGG + Intergenic
1058504072 9:105651592-105651614 GTCCCAGGTTTGGGCCCTGGCGG + Intergenic
1059417144 9:114169116-114169138 GAGCCAGGAGTGGGGACGGCAGG - Exonic
1059426182 9:114222336-114222358 GAGCCAGGAGCAGGCCCTGCAGG + Intronic
1060230292 9:121820854-121820876 CACCCCAGAGTGGGCTCTGCAGG + Intergenic
1060347253 9:122828118-122828140 GGCCCAGGAATGGGCCAAGCGGG + Intronic
1060652144 9:125337446-125337468 GACCCATGAGTGACCCCAGCTGG + Exonic
1060874753 9:127074770-127074792 GAGCCAGGACTGGGCCCAGATGG + Intronic
1061373628 9:130211750-130211772 GGCACAGGAGTGGGCGGTGCAGG + Intronic
1061706459 9:132457052-132457074 GACCCATGACTGGCCCCTACTGG + Intronic
1061853443 9:133429121-133429143 GGCGCAGGAGTGGGCGCAGCGGG - Intronic
1062102033 9:134733436-134733458 AACCCAGGGGTGGGACCTGCCGG + Intronic
1062564000 9:137155861-137155883 CACCCAGGCCTGGGGCCTGCAGG - Intronic
1185606272 X:1368760-1368782 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185606313 X:1368992-1369014 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185606397 X:1369462-1369484 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185606438 X:1369694-1369716 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185606521 X:1370161-1370183 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185606649 X:1370857-1370879 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185607249 X:1374123-1374145 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185607290 X:1374355-1374377 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185607373 X:1374822-1374844 GATCCAGGTGTGGGCAGTGCTGG - Intronic
1185873643 X:3684683-3684705 GACCCAGGTGTGGGCAGGGCTGG + Intronic
1187496567 X:19801001-19801023 TGACCAGGAGTGGGCTCTGCTGG - Intronic
1190110049 X:47583474-47583496 GACACAGGTGCAGGCCCTGCTGG - Exonic
1192183638 X:68931369-68931391 GACACTGGAGTGGGCCCAGGAGG - Intergenic
1196882562 X:120211987-120212009 GACCCAGGAGCATGCCCTTCTGG - Intergenic
1197703518 X:129617304-129617326 CTCCCAGGACTGGGCCCTGTTGG + Intergenic
1199592481 X:149480168-149480190 GACCCAGTAGTAGGCACTGACGG + Intergenic