ID: 1085344596

View in Genome Browser
Species Human (GRCh38)
Location 11:75760049-75760071
Sequence TAGGGAGGAGGAGCTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085344596_1085344605 18 Left 1085344596 11:75760049-75760071 CCTGAGGCAGCTCCTCCTCCCTA 0: 1
1: 0
2: 2
3: 35
4: 363
Right 1085344605 11:75760090-75760112 TGCTGATCACCTCCCTGCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 251
1085344596_1085344599 -7 Left 1085344596 11:75760049-75760071 CCTGAGGCAGCTCCTCCTCCCTA 0: 1
1: 0
2: 2
3: 35
4: 363
Right 1085344599 11:75760065-75760087 CTCCCTAGCAGAGCCCACACTGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085344596 Original CRISPR TAGGGAGGAGGAGCTGCCTC AGG (reversed) Intronic
900325596 1:2107313-2107335 TCTGGAGCAGGACCTGCCTCAGG - Intronic
900380183 1:2380065-2380087 AAGGAAGGAGGAGCTGGCACAGG + Intronic
902702740 1:18183772-18183794 GAGGGAGCAGCAGCTCCCTCGGG + Intronic
902755725 1:18548094-18548116 GAGAGAGGAGGAGGTCCCTCTGG - Intergenic
903140962 1:21338979-21339001 TAAGCAGGAGGAGCAGCCCCTGG - Intronic
904171308 1:28593612-28593634 GGGGGAGGAGGTCCTGCCTCTGG + Intronic
904575262 1:31501394-31501416 CAGGGATGAGCACCTGCCTCGGG + Intergenic
905259261 1:36706068-36706090 TAGGGAGTGTGAGCTGCCTGCGG - Intergenic
905295707 1:36953217-36953239 TAGTCAGGAGGAGCTGCCCTTGG + Intronic
905316958 1:37088652-37088674 TAGGGAGGGGGCACAGCCTCAGG + Intergenic
905447905 1:38039236-38039258 TTGGAAGGAGGGGCTGCCTGGGG - Intergenic
905692752 1:39955219-39955241 TTGGGAGGAGCAGCGGCCTGCGG + Exonic
905961218 1:42044182-42044204 CATGGAGGAGGGGCTCCCTCAGG + Intergenic
906802245 1:48748505-48748527 AAAGGAGGGGGTGCTGCCTCTGG + Intronic
907046973 1:51305403-51305425 AAGGGAGGAGGAGCTTCCCAGGG - Intronic
907461159 1:54606402-54606424 TGGGGAGGAGGAGGTGGGTCTGG + Intronic
915226604 1:154416535-154416557 GAGGGAGGAGGAGCTGGGGCAGG + Intronic
915744008 1:158142284-158142306 CTAGGAGGAGGAGCTGACTCTGG - Intergenic
918449129 1:184642030-184642052 CAGGGAGGAGGGGCTGCTTATGG - Intergenic
919829801 1:201532278-201532300 GAAGGAGGAGGAGCTGACTGTGG - Intergenic
921064255 1:211611558-211611580 GAGGGAGGTGCAGCTGCCTCTGG - Intergenic
921189783 1:212699429-212699451 GAGGGCGCAGGAGCTGGCTCAGG + Intronic
922724954 1:227918361-227918383 TGGGGAGAAGGAGCACCCTCAGG - Intergenic
922729377 1:227941944-227941966 CAGGGAGGAGGTGATGCCTGTGG - Intronic
923049323 1:230379690-230379712 GAGGAAGGAGGAACTACCTCTGG - Intronic
923375874 1:233362064-233362086 CCGGGAAGAGGAGCTGACTCGGG + Exonic
923684314 1:236143152-236143174 TAGGGAGAAGGCGCCGGCTCTGG + Intronic
923748384 1:236724448-236724470 GAGGGAGCAGGAGATGCCTGAGG + Intronic
1062854331 10:772243-772265 AATGGAGGAGGGGCTGCCCCGGG + Intergenic
1062976479 10:1687349-1687371 CAGGGAGGAGAAGCCACCTCTGG - Intronic
1063977437 10:11428661-11428683 TAGGTAGCAGGTGCTACCTCTGG + Intergenic
1066224868 10:33372418-33372440 CAGGGTTGAGGAGCTGCATCTGG + Intergenic
1067180239 10:43979816-43979838 GAGGGTGGAGGAGCAGCCCCTGG + Intergenic
1067471360 10:46541055-46541077 TCGTGAGGATGAGCTGCATCTGG + Intergenic
1067750680 10:48969261-48969283 CAGGGAGCAGGGGCAGCCTCAGG + Intronic
1070626725 10:78056086-78056108 AGGGGAGGGGGAGATGCCTCTGG + Exonic
1071333635 10:84584790-84584812 CAGGAAGGAGGAGCTGGCTTGGG + Intergenic
1073628322 10:105121929-105121951 GTGGGAGGAGGGGCTGCCTTTGG + Intronic
1075798445 10:125136944-125136966 TCAGGAGCAGGAGCTGCCTTTGG + Intronic
1076343799 10:129766950-129766972 AAGGGAGCGGGAGCTACCTCGGG + Exonic
1076374052 10:129971881-129971903 GCGGGAGGAGGAGCGGGCTCTGG - Intergenic
1076739746 10:132477395-132477417 CAGGAAGGAGGAGCAGCCTCTGG - Intergenic
1077101967 11:826359-826381 TTGGAAGGAGGAGCTGCTTGAGG - Intronic
1077483797 11:2829767-2829789 TAGGGTTGAAGGGCTGCCTCTGG + Intronic
1077563255 11:3279362-3279384 TGGGGAGGAGGAGGAGCATCAGG - Intergenic
1077569148 11:3325178-3325200 TGGGGAGGAGGAGGAGCATCAGG - Intergenic
1078340026 11:10492043-10492065 TAGTGAGGATGAGCTGACTAAGG + Intronic
1078477417 11:11643065-11643087 CAAGGTTGAGGAGCTGCCTCTGG + Intergenic
1079110649 11:17603273-17603295 TAGGGAGGAAGTGCTGTCTTTGG - Intronic
1079353375 11:19712224-19712246 TTGCGTGGAGGAGCTGTCTCGGG + Intronic
1080242348 11:30140950-30140972 TAGGGGAGAGGAGATGTCTCTGG + Intergenic
1081664312 11:44907606-44907628 GAGGAAGGATGAGCTGGCTCAGG - Intronic
1082260624 11:50074207-50074229 GAGGCAGGAGGAGCTGGGTCTGG + Intergenic
1082774872 11:57237147-57237169 CACTCAGGAGGAGCTGCCTCTGG + Exonic
1083313563 11:61799829-61799851 TAGAGAGGAAAAGCTGCCTCTGG - Exonic
1084247947 11:67873092-67873114 TAGGGAGGCTGAGGTGGCTCCGG - Intergenic
1084493354 11:69489971-69489993 CAGGGTGCAGGAGCTGACTCAGG - Intergenic
1084633463 11:70373053-70373075 GAAGGAGGAGGAGCTGCTTAGGG + Intronic
1085344596 11:75760049-75760071 TAGGGAGGAGGAGCTGCCTCAGG - Intronic
1086888057 11:92225978-92226000 GAGTGCGGAGGAGCTGTCTCCGG + Intergenic
1087177800 11:95111108-95111130 GAGGGAGGAGGAGCTGTTTGTGG - Intronic
1089317394 11:117601272-117601294 CAGGGTTGAGGAGTTGCCTCTGG - Intronic
1089610106 11:119664286-119664308 CCGGGAGGAGGAGCAGCATCTGG + Exonic
1090299936 11:125626345-125626367 TTGGGAGGAGGCGCTGCCGCAGG + Intronic
1090604323 11:128405769-128405791 TAAGGAGGTGCTGCTGCCTCAGG - Intergenic
1090966819 11:131605862-131605884 TGGGGTGGTGAAGCTGCCTCAGG - Intronic
1091232612 11:133998456-133998478 GAGGGAGGTAGAGCTGCCCCTGG + Intergenic
1092307945 12:7321004-7321026 TGGGGAGGAGGAGGTGCTACTGG - Intronic
1093346010 12:18038844-18038866 TAGGGAGGAGGTGATGATTCTGG - Intergenic
1094537204 12:31332429-31332451 TAGTGATGAGGAGCTGCCTTTGG - Intergenic
1095172314 12:39050158-39050180 AAGGGAGGAAGATCTGCCTCAGG - Intergenic
1096430243 12:51537324-51537346 CAGGGAGGAGGAGCGGCACCTGG - Intergenic
1097281591 12:57847889-57847911 TAGGGAGGAGGGGCGGAGTCGGG - Intergenic
1101881992 12:108631992-108632014 AGGGGAGAAGCAGCTGCCTCTGG - Exonic
1102078862 12:110081725-110081747 TGGGGAGGAGGAGGTGTTTCTGG - Intergenic
1103007742 12:117435550-117435572 TAGGGAGGAGGATCTGGCTCAGG - Intronic
1103463969 12:121127283-121127305 TGGGGAGGAGGAGGCGTCTCTGG + Intergenic
1103904707 12:124321410-124321432 CAGGGAGGAGGGGCATCCTCAGG - Intergenic
1104644439 12:130486852-130486874 GGGAGAGGAGGAGCTGTCTCGGG - Intronic
1104895376 12:132161263-132161285 AAGGGAGGAGGAGCTGAGTGGGG - Intergenic
1104895397 12:132161353-132161375 GAGGGAGGAGGAGCTGAGTGGGG - Intergenic
1104895460 12:132161601-132161623 GAGGGAGGAGGAGCTGAGTGAGG - Intergenic
1104981953 12:132577177-132577199 TGGGGAGGAGCAGCAGCCCCAGG - Intronic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1109586465 13:64411108-64411130 TGTGGAGGTGGGGCTGCCTCCGG + Intergenic
1112048067 13:95617315-95617337 TATGGAGAAGGAGTAGCCTCTGG + Intronic
1113946997 13:114049993-114050015 GATGGAGAAGGAGGTGCCTCAGG + Intronic
1117582005 14:57160741-57160763 TATGGAGGAAGAGGTGGCTCTGG + Intergenic
1118984581 14:70742558-70742580 CTGGGAGGAGGAGCTGACGCGGG - Exonic
1119205032 14:72787849-72787871 AAGAGAGGAGAGGCTGCCTCTGG + Intronic
1121313852 14:92949651-92949673 ACGGGAGGAGCTGCTGCCTCAGG + Intronic
1121593111 14:95135428-95135450 TAGGGAGGAGGGGGTGCTGCTGG - Intronic
1122785766 14:104162683-104162705 GAGGGTGGAGGAGCTGGCTCTGG + Intronic
1122903587 14:104792035-104792057 TATGGAGGAGGTGCTGCCCGAGG - Intronic
1123068331 14:105629106-105629128 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123072340 14:105647911-105647933 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123092350 14:105747430-105747452 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123097926 14:105775131-105775153 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1202859404 14_GL000225v1_random:72229-72251 TGGCGAGGTGGAGCTGCCCCAGG + Intergenic
1123944936 15:25234461-25234483 TAGGGAGCATGGGCTGCCTCAGG - Intergenic
1123981909 15:25612491-25612513 CAGGAAGGAGGAGAAGCCTCAGG - Intergenic
1124231790 15:27952397-27952419 TGCGGAGGATGAGGTGCCTCGGG - Intronic
1126110655 15:45172885-45172907 GAGGGCAGAGGTGCTGCCTCTGG - Intronic
1126820521 15:52499129-52499151 GATGGAGGAGAAGCTGCTTCAGG - Intronic
1128427751 15:67559403-67559425 TAGAGAGGAGAAGCAGCCTCAGG - Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1129723275 15:77889291-77889313 AAGGAGGGAGGGGCTGCCTCTGG - Intergenic
1130108357 15:80945571-80945593 AAGGGAGCTGGGGCTGCCTCAGG - Intronic
1130699478 15:86164274-86164296 TAGGGAGGAGGAAATGACACTGG + Intronic
1131116607 15:89799905-89799927 GGGAGAGGAGGAGCTGCCTGTGG - Intronic
1132905991 16:2283095-2283117 GAAGGAGGTGGAGCTGCCCCAGG + Intronic
1132971840 16:2693031-2693053 TCGGGAGGAGGATCTGCGTGGGG - Intronic
1133002402 16:2857994-2858016 GAGGAGGGAGGAGCAGCCTCCGG + Intronic
1133076454 16:3284115-3284137 CAGGGTGCAGGAGCTGCATCCGG + Exonic
1133229203 16:4358494-4358516 AAGGGAGTCGGAGCTGCCGCTGG + Intronic
1133528639 16:6631759-6631781 TAGGGAGGAGGAGCAGCCACCGG + Intronic
1135822053 16:25692993-25693015 TGGGGAGAAGAAGCTGCCACAGG + Exonic
1136419221 16:30122095-30122117 GAGAGAGCAGGAGCTGGCTCTGG + Intronic
1136749128 16:32617035-32617057 GAGGGAGGAGGGGCTCCCTAGGG - Intergenic
1137785526 16:51134649-51134671 TGGCGAGGAGGGGCTGCCCCGGG - Intergenic
1138035517 16:53602042-53602064 TGAGGAGTAGGAGATGCCTCTGG + Exonic
1138095550 16:54208509-54208531 TGGGGAGGAGGAGGTGTCTTGGG + Intergenic
1138474719 16:57263968-57263990 TCCGGAGCAGGACCTGCCTCTGG + Intronic
1140759703 16:78099817-78099839 CAGTGAGGACGAGCTGCCTCCGG + Exonic
1141202307 16:81907753-81907775 TATGGAGGAGGAAGTGCCCCAGG + Exonic
1141438903 16:84016688-84016710 TCTGGAGGAGGAGCTGCTTGGGG - Exonic
1142240688 16:88943479-88943501 TAGGGAGGAGGGGCTGCGGTGGG - Intronic
1142246334 16:88971824-88971846 CAGGCAGGAAGAGCGGCCTCAGG - Intronic
1142400131 16:89854300-89854322 TCGGGAGGACGAGCCGCATCTGG + Exonic
1203051261 16_KI270728v1_random:876249-876271 GAGGGAGGAGGGGCTCCCTAGGG - Intergenic
1142607735 17:1091331-1091353 GAGGGAGAAGGAGCACCCTCCGG + Intronic
1142811520 17:2397690-2397712 TGAGGAAGAGGAGCTGCCCCTGG + Intronic
1142878761 17:2868343-2868365 AAGGGCAGAGGAGCGGCCTCAGG + Intronic
1143367475 17:6417592-6417614 TAGGATGGAGGGGCTGCCTGAGG - Intronic
1143726037 17:8847259-8847281 TAGGCTGGAGGAGGTGCATCTGG - Intronic
1143740445 17:8949007-8949029 CAGGAAGGAGGAGCTGCCCTGGG + Intronic
1144624127 17:16836079-16836101 TTGGGAGTTGGAGCTGGCTCCGG - Intergenic
1144762242 17:17713900-17713922 TTGGGAGCAGGAGCTTGCTCTGG + Intronic
1144772858 17:17769562-17769584 TAGGGACGAGGAGATCCCGCTGG + Intronic
1144882299 17:18436640-18436662 TTGGGAGTTGGAGCTGGCTCCGG + Intergenic
1144955701 17:19017853-19017875 CAGGCAGAAGGAGCAGCCTCTGG + Intronic
1145000767 17:19302963-19302985 CAGGGAGGAAGAGTTCCCTCTGG + Intronic
1145149935 17:20507746-20507768 TTGGGAGTTGGAGCTGGCTCCGG - Intergenic
1146526845 17:33574066-33574088 CAGGGAGGAGGAGCTCTCTAAGG + Intronic
1146793173 17:35764376-35764398 CAGGGAGGAGGGGCTGCCCCAGG + Intronic
1147326835 17:39673709-39673731 TTGGGGGGAGGAGATGCTTCAGG - Intronic
1147422324 17:40328072-40328094 TAGGGAGGGGAGGCTGCCCCAGG - Intronic
1147472689 17:40677802-40677824 TAGAGAGGAGTAGCTCACTCAGG + Intergenic
1147512382 17:41081983-41082005 TATGGAGGAGAATTTGCCTCAGG + Intergenic
1147514554 17:41103155-41103177 TATGGAGGAGAATTTGCCTCAGG + Intronic
1147570447 17:41567451-41567473 TATGGAGGAGGAAGTGGCTCTGG - Exonic
1148080289 17:44964184-44964206 TAGGGAGGCAGAGCTGAATCTGG - Intronic
1148189153 17:45666781-45666803 TCTGGAGGAGGGGCTGCCACAGG - Intergenic
1148208026 17:45791727-45791749 TGGGGAGGAGGAGCAGCCCTGGG - Intronic
1148216809 17:45837767-45837789 GAGGGCGGAGGGGCTGCTTCAGG + Intergenic
1148842416 17:50507788-50507810 ATGAGAGCAGGAGCTGCCTCAGG - Intergenic
1149626302 17:58083212-58083234 TGGGGAGGAGGAGCTGGAGCGGG - Intergenic
1150346408 17:64407753-64407775 AAGGGAGGATGAGCTGCCCTGGG + Intronic
1151486610 17:74404814-74404836 TGGGGAGGAGGTGGGGCCTCAGG - Intergenic
1152742081 17:82022836-82022858 GAGGGAGCAGGAGCTGGATCCGG - Exonic
1153875086 18:9363024-9363046 TAGGAAGGAGGAGCAGCGGCAGG - Intronic
1155434829 18:25801497-25801519 CATGGAGGAGGGGCTGTCTCAGG + Intergenic
1155439052 18:25842379-25842401 TAGGGAGGAGGTGCTGAAGCCGG - Intergenic
1156376915 18:36523054-36523076 TAGGGAGTACTAGCTGCCTGTGG - Intronic
1156478141 18:37419548-37419570 ATGGGGAGAGGAGCTGCCTCAGG + Intronic
1157135694 18:45052498-45052520 TAGGGCAGAAGAGTTGCCTCTGG + Intronic
1159455209 18:68652729-68652751 TAGTGAGGAGGAGCTACGTGGGG - Intergenic
1160408016 18:78656097-78656119 CGGGGAGGTGGTGCTGCCTCTGG + Intergenic
1161404702 19:4084754-4084776 TCGGGAGGTGGGGCTGCCTTGGG + Intergenic
1161517446 19:4704256-4704278 TCGGGAGGAGGAGCTGCTGAGGG - Exonic
1161988180 19:7669227-7669249 GAGGGAGTAGGATCTGCCCCTGG - Intronic
1162794988 19:13082353-13082375 TGGGGAGGAGGAGGTGCTCCTGG - Intronic
1162910145 19:13843773-13843795 TCAGGAGGAGGCCCTGCCTCGGG + Intergenic
1162932199 19:13962817-13962839 GAGCGAGGACGAGCTGCCGCAGG - Exonic
1162995722 19:14333763-14333785 GATGGAGGAGGAGCGGCATCCGG - Intergenic
1163641230 19:18463265-18463287 CAGGGAGGAGGAGCAACCTGAGG + Intronic
1163739909 19:19005106-19005128 TAGGGGTGAGGAGCCTCCTCGGG - Intronic
1164514585 19:28922898-28922920 CAAGGCGGAGGAGCGGCCTCTGG - Intergenic
1165913379 19:39243734-39243756 TAGGGAGGAGGGGATGGGTCAGG + Intronic
1165917576 19:39269889-39269911 TAGGGAGGAGGGGATGGGTCAGG - Intronic
1166168507 19:41009587-41009609 TAGGGAGGAGGAACTGAGACAGG + Intronic
1166674670 19:44732667-44732689 CAGGAAGGAGCAGCTTCCTCAGG + Intergenic
1166971870 19:46574307-46574329 GAGGGAAGAGGAGGTGCCTGGGG - Intronic
1167245981 19:48373455-48373477 GAGGAAGGAGGAGCAGCTTCAGG + Intronic
1167262451 19:48466877-48466899 TGGGGAGGAGGAGGTAGCTCTGG + Intronic
1167314706 19:48756646-48756668 GAGGGAGGAGGGGCTGGGTCTGG + Intronic
1167426989 19:49434472-49434494 GAGGGAGGAGGAGGAGACTCTGG - Intronic
1167630371 19:50622576-50622598 GAGGGAGGAGGGGCTGCGCCTGG - Intronic
1168056642 19:53868270-53868292 GAGGGAGGAGGAGCTGGGCCTGG + Intronic
1168310152 19:55456022-55456044 GAGGGAGGAGGAGCTGGGCCTGG + Intronic
1168638871 19:58017434-58017456 TGGTGAGCAGGGGCTGCCTCAGG + Intergenic
925078307 2:1038456-1038478 AAGGAAGGCGGAGCTTCCTCGGG - Intronic
925353003 2:3215359-3215381 CAGGGCAGAGGAGCTGCCACCGG + Intronic
926577550 2:14598736-14598758 TAGCGAGAAAGAGGTGCCTCAGG - Intergenic
927150028 2:20190181-20190203 TAGGGACACGGAGCTGCCTGGGG + Intergenic
927207724 2:20620641-20620663 CAGGGAGGAGGAGTGGCCTGAGG - Intronic
927694572 2:25231177-25231199 GGGGGAGGAGGGGCTGCCTCAGG - Exonic
927872715 2:26633785-26633807 GAGGCAGGAGGGGCTGCCTGCGG + Intronic
928229960 2:29489747-29489769 TAGGGATGAAGAGCTGTCTCAGG + Intronic
928676313 2:33655005-33655027 CAGGGAGGAGAAGGTGCCTGGGG - Intergenic
931243300 2:60471619-60471641 TGGGGAAAAGGAGCTGCCCCTGG + Intronic
933494715 2:83034750-83034772 TAGGGAGGAGAAGCTGTTACAGG - Intergenic
934526361 2:95054244-95054266 TAGGAAGGAGAAGCTGCCCCTGG - Intergenic
934773040 2:96920081-96920103 TAGGCAGGAGGAGCTGCAAAGGG + Intronic
935160222 2:100523569-100523591 GAGAGGTGAGGAGCTGCCTCAGG + Intergenic
935674111 2:105579722-105579744 GAGGGAGGAGGAGAGGCCTGTGG - Intergenic
936065946 2:109332295-109332317 TCAGGAGGAGGAGCTCTCTCAGG - Intronic
937149087 2:119673634-119673656 TAGGGAGGAGGAGGGGGGTCAGG - Intergenic
937247715 2:120504234-120504256 TAGGGGGCAGGAGCTGCCAAAGG - Intergenic
938117502 2:128612035-128612057 TGGGGACGTGGAGCTGCCTGAGG - Intergenic
938757983 2:134398044-134398066 GAAAGAGGAGGAGCTGCCACAGG + Intronic
940393922 2:153165898-153165920 TAGTGAGGAATAGCAGCCTCAGG + Intergenic
943780504 2:191818439-191818461 TAGCAAGGAGGATGTGCCTCTGG + Intergenic
945030019 2:205654811-205654833 CAAGGATGAGGAGCTGCATCTGG - Intergenic
945463651 2:210141448-210141470 TAGGGAGAACAAGCTTCCTCAGG - Intronic
946402722 2:219477013-219477035 GAGGGAGGAGGGGCTCCCTGGGG + Intronic
946403510 2:219481094-219481116 CAGGGAGGTGGTGCTGCCTTGGG - Intronic
947028764 2:225768917-225768939 CAGGGCGAAGGAGCTCCCTCTGG + Intergenic
947341817 2:229148512-229148534 TGGGGACGAGGAGATTCCTCCGG + Intronic
947546181 2:231011885-231011907 TACAGAGGGGGAGCTGCCTGGGG - Intronic
947632967 2:231665689-231665711 GTGGGATGGGGAGCTGCCTCTGG - Intergenic
947635131 2:231676578-231676600 AAGAAAGGAGGAGCTGGCTCAGG + Intergenic
947745319 2:232504166-232504188 TGGGGAGGCAGAGCTGCCGCGGG + Intergenic
947746202 2:232508499-232508521 TGGGGAGGAGGGGCTTCCTCAGG + Intergenic
948309289 2:236972864-236972886 CTGGGAGGAGGAGCTGCCCCCGG - Intergenic
948614482 2:239189898-239189920 CAGCGATGAGGATCTGCCTCTGG + Exonic
948805132 2:240450663-240450685 TGGGGAGGAGGTGCTGGCTTGGG + Exonic
948892140 2:240912708-240912730 GAGGGGAGAGGAGCTGTCTCTGG - Intergenic
949032345 2:241803038-241803060 GAGGGAGGAGGAGCTCCCACTGG - Intronic
1169793667 20:9438505-9438527 TTAGGAGGAGGAGCTGCTTTTGG + Intronic
1171126585 20:22607426-22607448 TAGGGTGGAGAAGCGGGCTCTGG - Intergenic
1171193363 20:23178099-23178121 AAGGTAGGAGGAGTTGCTTCTGG - Intergenic
1172447844 20:35002500-35002522 CAGGCAGGAGCGGCTGCCTCAGG + Exonic
1172482629 20:35279889-35279911 TAGGCAAAAGGATCTGCCTCGGG + Intronic
1172530370 20:35626826-35626848 TTAGGAGGAGGATCTGCTTCAGG - Intronic
1172597237 20:36157795-36157817 TAGGGAAGATGGGCTGGCTCTGG + Intronic
1172912602 20:38421134-38421156 TGGGGAGGAGGAGATGGCCCTGG - Intergenic
1172973467 20:38889774-38889796 GAGGGAGGAGGAGCTGCAGCTGG + Intronic
1173691697 20:44966128-44966150 TGGGGAGGCGGCGCTGCCCCAGG - Intergenic
1173939001 20:46894529-46894551 CAGGGAGGATGTGCTGCCCCGGG + Intergenic
1174130772 20:48342016-48342038 TGGGGAGGAGGGGCTGCCCAGGG - Intergenic
1174212636 20:48892042-48892064 TTGGGGGGAGGAGCTGCTCCTGG - Intergenic
1175519525 20:59591246-59591268 GAGGGAGGAGCAGGTGCCTTCGG - Intronic
1176073060 20:63236664-63236686 ATGTGAGGAGGGGCTGCCTCTGG + Intronic
1176101940 20:63368392-63368414 TAGGGAGGAGGGGCAGCCAGAGG - Intronic
1179959247 21:44759040-44759062 CAGTGAGGAGGGGCTGCCCCAGG - Intergenic
1180042054 21:45285515-45285537 AACGGAGGAGGTGCTGCCACAGG + Intronic
1182422305 22:30254451-30254473 CAGGCAGGAGGGGCTGCCTGGGG - Intergenic
1182930577 22:34170168-34170190 TAGGGAGGAGGAGATGCAAAGGG + Intergenic
1183258360 22:36777663-36777685 TAGCTACGTGGAGCTGCCTCGGG - Intergenic
1183783874 22:40018048-40018070 TAGAAAGGTGGAGCTGCCTCAGG + Intronic
1183991710 22:41601268-41601290 TAGGGAGGAGGAGTGGGCGCTGG + Intronic
1184391884 22:44207533-44207555 CAGGGAGGAGCAGCAGCCTGGGG - Exonic
1184410908 22:44325832-44325854 TCGGGAAGAGGAGCAGCCTGAGG - Intergenic
1184516450 22:44965562-44965584 CAGGGAGGAGAGGCTGCATCTGG - Intronic
1184654520 22:45934405-45934427 TAGGGAGGCTGAGCTGGCTCTGG + Intronic
1184751894 22:46491060-46491082 CGGGGTGGAGAAGCTGCCTCAGG - Intronic
1184799987 22:46753233-46753255 TAGGGGGGAGGGGCTGCCTTTGG + Intergenic
1185066618 22:48635471-48635493 CACGGAGGAGGAGCTGCTGCTGG - Intronic
949552346 3:5121859-5121881 TAGGCAGGACGTGCAGCCTCGGG - Intergenic
949796210 3:7854105-7854127 TAGGGAGGAGAAGCTGCTGAAGG + Intergenic
950040890 3:9918367-9918389 TTTGGAGGAGCAGCTGACTCAGG + Exonic
950331232 3:12157801-12157823 AAGGGAGGAGGAGCCCCTTCAGG + Intronic
950649031 3:14395880-14395902 GAGGGAGGTGGAGGTCCCTCTGG + Intergenic
950653849 3:14424535-14424557 GAGGGGAGAGGAGCTGCCTGGGG + Intronic
950756013 3:15173299-15173321 TAGGAAGCATGAGATGCCTCAGG - Intergenic
950958216 3:17077867-17077889 CAGAGAGGAGCAGCTACCTCGGG - Intronic
952303930 3:32128799-32128821 TGGGGAGCAGGAGCAGCCTAAGG - Intronic
953245191 3:41184687-41184709 TAGAGAGCAGGAGCCACCTCTGG + Intergenic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
953790302 3:45942383-45942405 CAGGGACCAGGAGCAGCCTCAGG - Intronic
953877390 3:46674083-46674105 TAGGGGAGAGGAGGTCCCTCAGG - Intronic
954306225 3:49726855-49726877 TAGGAAGGAAGAGGTGCCCCTGG - Exonic
955525107 3:59811968-59811990 TAGGTAGGATGAGCTGCCACGGG - Intronic
955661489 3:61304316-61304338 TTGGCAGGAGCTGCTGCCTCTGG + Intergenic
956253660 3:67261272-67261294 CTGGGAGGAGGAGCTGGCCCAGG - Intergenic
956879302 3:73493705-73493727 TAGTGATGAAGAGGTGCCTCAGG + Intronic
960803630 3:121562394-121562416 AAGAAAGGAGGAGCTGCCTGAGG + Intergenic
961054234 3:123774341-123774363 GGGGGAGGAGTAACTGCCTCCGG - Intronic
961365244 3:126395321-126395343 CAGTCAGGAGGGGCTGCCTCTGG - Intronic
961389038 3:126541619-126541641 TTGGGAGCAGGAGCTGCGCCGGG - Intronic
961393666 3:126571295-126571317 CAGCGGGGAGGAGCTGCCTGAGG + Intergenic
962317647 3:134368749-134368771 TTGGGAGTAAGGGCTGCCTCTGG + Intronic
963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG + Exonic
967003847 3:185364343-185364365 TCGGGTTGAGGAGCTGCCCCAGG - Intronic
967993500 3:195149554-195149576 CAGGGAGTGGGGGCTGCCTCGGG + Intronic
968285373 3:197505527-197505549 AAGGGCGGAGGAGCTGCCGATGG - Intergenic
968526131 4:1058377-1058399 CAGGGAGGAGACGCTGCCTGTGG + Intronic
968545344 4:1195158-1195180 CCAGGAGGAGGAGCTGCCTGGGG - Intronic
968758416 4:2428476-2428498 GATGGAGGAAGAGCTGCCGCTGG - Intronic
968785739 4:2621112-2621134 CACTGATGAGGAGCTGCCTCAGG + Intronic
968953889 4:3708498-3708520 CAGGGGGCCGGAGCTGCCTCTGG + Intergenic
969376794 4:6768397-6768419 GAGGGAGAAGGAGCTGGCTGGGG + Intergenic
969454654 4:7294494-7294516 CATGGAGGAGGAGCTCCCTGGGG - Intronic
969454662 4:7294517-7294539 CATGGAGGAGGAGCTCCCTGGGG - Intronic
969511763 4:7622141-7622163 AGGGGAGAAGGAGGTGCCTCAGG - Intronic
969626177 4:8306803-8306825 TGGGGAGGAGAAGCTTCCCCAGG - Exonic
970484206 4:16507989-16508011 TAAGGGGGAGGATCAGCCTCTGG - Intronic
973807498 4:54540130-54540152 AAGGGAGTAGGAGCTACCTACGG - Intergenic
975609919 4:76193495-76193517 TACTGAGGCGGAGCTGCCTAAGG + Intronic
975628060 4:76369587-76369609 AAGGGAGAAGGAGCTGAGTCTGG - Exonic
976599880 4:86928326-86928348 TATGGGGGAGGTGCTGCCACTGG + Intronic
979775089 4:124580759-124580781 TATGGAGAAGGAGTGGCCTCAGG - Intergenic
981009571 4:139911638-139911660 TAGGTAGGAGGTGCAGCCTTTGG + Intronic
981871929 4:149497207-149497229 CTGGGAGGAGGAGGAGCCTCAGG + Intergenic
983991052 4:174120303-174120325 AAGGGAGGAGAAGCTGCGTTAGG - Intergenic
984965957 4:185139955-185139977 TCGGGAGCATGAGCTGCCTGTGG - Intergenic
988264256 5:28928595-28928617 TAGGGCTGAGGAGCTGCCAGGGG + Intergenic
991720940 5:69493628-69493650 CAGGGGGGCGGAACTGCCTCCGG + Intronic
992857760 5:80880686-80880708 TCAGGAGGAGGAATTGCCTCTGG + Intergenic
993413845 5:87601828-87601850 TTGTGAGGAGGAGCAGCCTCAGG - Intergenic
994048087 5:95331598-95331620 GAGGAAGCAGAAGCTGCCTCGGG - Intergenic
994812420 5:104538508-104538530 TAGGTAAAAGAAGCTGCCTCTGG + Intergenic
997940468 5:138152809-138152831 TCGGGAGATGGAGATGCCTCAGG - Intronic
998036973 5:138925830-138925852 TTGGGGGGAGGAGCGGCCCCAGG + Intronic
998368577 5:141646754-141646776 TGGAGAGAAGGAGCAGCCTCAGG - Intronic
999261177 5:150239818-150239840 TTGGGAGGAGGATGGGCCTCGGG + Intronic
999278722 5:150350162-150350184 CAGGGAGAAGGAGCTGCTCCAGG - Intergenic
999339590 5:150758673-150758695 TGGAAAGGAGGAGCAGCCTCGGG - Intronic
1001237928 5:170045636-170045658 TAGAGAGGACGACCTTCCTCTGG - Intronic
1001809235 5:174614606-174614628 TGGCAAGGAGAAGCTGCCTCTGG - Intergenic
1002603938 5:180370914-180370936 TGGGGAGGGGCAGCTGCTTCTGG + Intergenic
1002897413 6:1387885-1387907 TAGGGAGAAGGAGCCGGCTCAGG + Intergenic
1003879287 6:10465713-10465735 GAGGGAGCAGGAGCTGCTTGAGG + Intergenic
1004426865 6:15512694-15512716 GAGGGAGTGGCAGCTGCCTCTGG + Intronic
1006183466 6:32167479-32167501 TAGAAAGGAAGAGATGCCTCAGG - Intronic
1007418049 6:41703447-41703469 GACGGAGGAGGAGCAGCCCCAGG - Intronic
1007751802 6:44075718-44075740 CTGGGAGCAGGAGCTGCCTTTGG - Intergenic
1007772176 6:44200927-44200949 CAGGGAGGAGGAGGTGGCCCAGG - Intergenic
1007924745 6:45642079-45642101 TGGGGAGGGGGAGCTGCGGCCGG + Intronic
1009971270 6:70627937-70627959 TCGGGGGTAGGAGCTCCCTCTGG - Intergenic
1012880591 6:104783265-104783287 AAGGGAGGAAGAGCTGGCTCTGG - Intronic
1013355012 6:109339012-109339034 TAGGTAGCAGCAGGTGCCTCTGG + Intergenic
1014975686 6:127879751-127879773 AAGGATGGAGAAGCTGCCTCTGG + Intronic
1017002237 6:150004745-150004767 TAGGGCTGCGGAGCTGCATCAGG + Intergenic
1017667189 6:156731665-156731687 TAGGCAGGAGGCACTGCCTAGGG - Intergenic
1018673838 6:166202044-166202066 CAGGGAGGGTGAGCTGCCTGGGG - Intergenic
1019174183 6:170151694-170151716 CAGGCGGGAGGAGCTGTCTCAGG - Intergenic
1019342708 7:516111-516133 TAGGGAAAAGGATCTGGCTCTGG - Intronic
1019543695 7:1562732-1562754 TTAGGAGGATGAGCTGCCTGTGG - Intergenic
1019550156 7:1598185-1598207 GAGGGAGCAGGGGCTGGCTCAGG - Intergenic
1022536522 7:31101976-31101998 GGGGGAGGAGGAGCAGCCTGAGG - Intronic
1022896072 7:34751505-34751527 TATGGAGGAGGAGCTGGGGCTGG - Intronic
1024526025 7:50350074-50350096 TAGGGAGGTGGGGCAGCCCCGGG + Intronic
1029629247 7:101740055-101740077 GAGAGAGGAGGAGCTTCCCCAGG - Intergenic
1031829420 7:126608327-126608349 TACGGAGGAGGAACTTCATCAGG - Intronic
1033683426 7:143618921-143618943 TTGGGAGCAGGAGCTGCCTGAGG - Intergenic
1033701187 7:143838717-143838739 TTGGGAGCAGGAGCTGCCTGAGG + Intergenic
1034465072 7:151223080-151223102 TAGCAAGGATTAGCTGCCTCCGG - Intronic
1034696089 7:153055108-153055130 TGGGGAGGAGGAGCTGGCAGAGG + Intergenic
1035090383 7:156305427-156305449 CAGGGAGGTGGAGGGGCCTCAGG + Intergenic
1035338125 7:158143209-158143231 TCGGGAGGAAGAGCTGTGTCTGG + Intronic
1035640928 8:1184692-1184714 TAGGGAGCAGGAGGAGGCTCAGG + Intergenic
1036647744 8:10622767-10622789 CCGGGAGGAGGAGGTGCCTGGGG + Exonic
1040582500 8:48708875-48708897 GGGGGAAGAGGAGCTGCCCCGGG + Intergenic
1041902440 8:62996863-62996885 TACAGAGGAGGAGCTGCCCAAGG - Intronic
1047759394 8:127942953-127942975 GAGGGAGCAGGACCTGCCTCAGG + Intergenic
1048891657 8:138953823-138953845 TAGAGCTGAGGAGCTGCCCCTGG + Intergenic
1048949019 8:139477733-139477755 AAAGGAGGAGGAACAGCCTCAGG - Intergenic
1049106423 8:140616642-140616664 TACAGAGGAGGAGCTGACACAGG + Intronic
1049310498 8:141931409-141931431 TAAGGAGGAGGGGGTGCCTAGGG + Intergenic
1049343825 8:142128035-142128057 CAGGAAGGAGGAGCAGCCTGGGG - Intergenic
1049795967 8:144497383-144497405 GAGGGAAGAGGACCTGCTTCAGG - Exonic
1053004424 9:34594465-34594487 GAGGGAGGAGGAGCGGGCTCCGG + Intergenic
1053275500 9:36780394-36780416 GAGTGAGGAGGAGCTGTCTTCGG - Intergenic
1053575565 9:39355577-39355599 TAGGGAGGGGGAGGTGCAGCAGG - Intergenic
1054718120 9:68577749-68577771 CAGGGAGGAGGAGCTGTCACAGG + Intergenic
1056153372 9:83810558-83810580 TTGGGAGAATGAGATGCCTCTGG + Intronic
1056357264 9:85813854-85813876 TTGGGAGAATGAGATGCCTCTGG - Intergenic
1057191398 9:93089851-93089873 TAGGGAGGAGGTGCGGATTCTGG - Intergenic
1057294861 9:93828922-93828944 AATGGAGAAGGAGCTGCCTGAGG + Intergenic
1057704276 9:97386593-97386615 TAGGGAGCTGCAGCTGCCTCAGG - Intergenic
1057704541 9:97387771-97387793 TAGGGAGCTGCAGCTGCCCCAGG - Intergenic
1057797492 9:98169324-98169346 TGGGGAGGAGGCACTCCCTCAGG - Intronic
1060412436 9:123408710-123408732 CACGGAGTAGCAGCTGCCTCAGG - Intronic
1061247189 9:129406525-129406547 CAGGGAGGTGGGGCTGCCTCGGG - Intergenic
1061485296 9:130917541-130917563 GAGGGAGGCGGAGATGCCTCTGG + Intronic
1062202328 9:135310057-135310079 CAGGGAGGAAGAGCTGCAGCGGG + Intergenic
1062269969 9:135703874-135703896 CGGGGAGGAGGAGCTGTCCCGGG - Intronic
1062340294 9:136091061-136091083 CAGGGAGGAGAGGCTGGCTCCGG - Intronic
1062362356 9:136193873-136193895 TAGGGAGGGGGCGCGGCCGCCGG - Intergenic
1062383660 9:136299649-136299671 GAGGGGGCAGGAGCTGCTTCTGG - Intronic
1062568853 9:137175326-137175348 CATTGAGGAGGAGCGGCCTCAGG - Exonic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1186720372 X:12297358-12297380 TAAGGTTGAGGGGCTGCCTCTGG + Intronic
1187382930 X:18821827-18821849 TAGGGAGGAGCTGCTGTCTAAGG + Intronic
1189884656 X:45529027-45529049 CAGGGTATAGGAGCTGCCTCTGG - Intergenic
1192256482 X:69465051-69465073 TAGGGAGAAGGAGTTTCCCCAGG + Intergenic
1193051993 X:77111584-77111606 CAGTGAGGAGGAGCTGGTTCAGG - Intergenic
1194393318 X:93347449-93347471 CAGGGAGGAGGAGTGGCATCAGG + Intergenic
1194451142 X:94045982-94046004 TTGGGGGGATGAGCTCCCTCTGG + Intergenic
1195006767 X:100692829-100692851 TAGAGAGGAGGAGCAGCCCAAGG - Intronic
1195722666 X:107881220-107881242 TAGAGAGCAGGAGCTCCCACTGG + Intronic
1195803442 X:108736617-108736639 TCGGGAGGCGGAGCCACCTCCGG + Intergenic
1197207003 X:123799141-123799163 CAGGGAGGAGGAGTGGCTTCAGG + Intergenic
1197209135 X:123815066-123815088 CAGGGAGGAGGAGTGGCTTCAGG - Intergenic
1198491534 X:137146243-137146265 TAGGTAGGTTCAGCTGCCTCTGG - Intergenic
1198518660 X:137431163-137431185 GAGGGAGCAGGGGATGCCTCAGG - Intergenic
1199527221 X:148806043-148806065 AAGAGAGGAGAAGGTGCCTCGGG + Intronic
1201336911 Y:12891492-12891514 TAGGTATCAGGAGCTTCCTCTGG - Intergenic
1202090466 Y:21183383-21183405 TGAGGAGAGGGAGCTGCCTCTGG - Intergenic