ID: 1085344973

View in Genome Browser
Species Human (GRCh38)
Location 11:75762849-75762871
Sequence TACCCACAGCACCCAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 2, 2: 7, 3: 107, 4: 568}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085344968_1085344973 6 Left 1085344968 11:75762820-75762842 CCCAGAATGCCCCTAAGGAGCAA 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568
1085344970_1085344973 -3 Left 1085344970 11:75762829-75762851 CCCCTAAGGAGCAAGAACTGTAC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568
1085344969_1085344973 5 Left 1085344969 11:75762821-75762843 CCAGAATGCCCCTAAGGAGCAAG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568
1085344967_1085344973 7 Left 1085344967 11:75762819-75762841 CCCCAGAATGCCCCTAAGGAGCA 0: 1
1: 0
2: 2
3: 15
4: 150
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568
1085344966_1085344973 8 Left 1085344966 11:75762818-75762840 CCCCCAGAATGCCCCTAAGGAGC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568
1085344972_1085344973 -5 Left 1085344972 11:75762831-75762853 CCTAAGGAGCAAGAACTGTACCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568
1085344971_1085344973 -4 Left 1085344971 11:75762830-75762852 CCCTAAGGAGCAAGAACTGTACC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG 0: 1
1: 2
2: 7
3: 107
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085344973 Original CRISPR TACCCACAGCACCCAGCACA AGG Intronic
900186021 1:1333648-1333670 GCCCCAAAGCAGCCAGCACAAGG - Exonic
900223398 1:1521497-1521519 TCCCCACCCCGCCCAGCACACGG + Intronic
900953850 1:5874905-5874927 CCCCCACAACACACAGCACACGG - Exonic
900965848 1:5957963-5957985 CATCCTCAGCACCCAGCCCAGGG + Intronic
901029763 1:6300294-6300316 TGCCCTCAGCATCCAGCTCACGG - Intronic
901154783 1:7128290-7128312 GACTCACAGGACCCAGCACATGG - Intronic
901258214 1:7850252-7850274 GAGCCACCGCACCCAGCAAAAGG + Intronic
901844540 1:11973533-11973555 TCTCCACAGCACCCAGCCCAGGG - Intronic
902043078 1:13506408-13506430 TCACCACAACTCCCAGCACATGG + Intronic
902086287 1:13865405-13865427 GAGCCACCGCACCCAGCCCAAGG - Intergenic
902118332 1:14140334-14140356 TATCTAAGGCACCCAGCACAAGG + Intergenic
902615174 1:17619640-17619662 AACCAACAGCACAGAGCACACGG - Intronic
902658206 1:17883918-17883940 TATCCCCAGCACCCAGCCCCAGG - Intergenic
902711619 1:18243767-18243789 TCCCAGCAGCACCCAACACAAGG - Intronic
902838768 1:19062439-19062461 CACCCACAGCACCTGGCACAGGG - Intergenic
903366954 1:22811045-22811067 TACCCAGGTCACGCAGCACATGG - Intronic
903604707 1:24567214-24567236 TCCTGCCAGCACCCAGCACAAGG - Intronic
903661059 1:24978928-24978950 TGTCCCCAGCTCCCAGCACAGGG + Intergenic
903661081 1:24979137-24979159 TATCCTTAGCACCAAGCACAGGG - Intergenic
903739387 1:25549802-25549824 TCCCCACAGAAACCAGCACCTGG - Intronic
903759166 1:25685721-25685743 CTCCCACAGCAACCAGCACAGGG - Intronic
904224944 1:29009161-29009183 TAACCACAGTGCCTAGCACATGG + Intronic
904366738 1:30015934-30015956 TCCCCACACCACCCAGCTCATGG + Intergenic
904450880 1:30610706-30610728 CAGCCACAGCAGCCAGGACAGGG + Intergenic
904987651 1:34565136-34565158 TACCCACATCACCCATGGCAGGG + Intergenic
905284945 1:36873175-36873197 TTCCCACCACCCCCAGCACAGGG + Intronic
905582224 1:39090902-39090924 TAGCCACAGCAACCAGAAAAAGG - Intronic
905720783 1:40199258-40199280 TCCCTACAGCACTAAGCACAAGG - Intronic
905875266 1:41428061-41428083 TCACCCCAGCATCCAGCACAGGG + Intergenic
905877739 1:41443709-41443731 GAGCCACCGCACCCAGCCCAAGG + Intergenic
905923619 1:41734726-41734748 GACCCACAGCAGCCAGCCCCGGG + Intronic
906033373 1:42736790-42736812 TGTCCCCAGGACCCAGCACAGGG + Intronic
906243729 1:44258535-44258557 TATCTCTAGCACCCAGCACAGGG - Intronic
906617053 1:47240727-47240749 CATCCCCAGCAGCCAGCACAGGG - Intergenic
906787070 1:48625400-48625422 TATCCCCAACACCCAGCACAGGG - Intronic
907249980 1:53131614-53131636 TGTCTGCAGCACCCAGCACAGGG + Intronic
907331196 1:53672800-53672822 GCCCCACAGCACCCAGCTCAGGG + Intronic
907519796 1:55015691-55015713 TTCCCCCAGTACCTAGCACAGGG - Intergenic
907701197 1:56789779-56789801 ATCCCCCAGCACCAAGCACAGGG + Intronic
907774722 1:57502549-57502571 TAGACACAGCACCCATCTCATGG - Intronic
908174319 1:61539251-61539273 TGTCTACAGCACTCAGCACAAGG + Intergenic
908776817 1:67648655-67648677 TATCCCCAGCCCCCAGCACAGGG - Intergenic
909927256 1:81452444-81452466 TATCCTCAGCATCCAGCCCATGG + Intronic
909950668 1:81716394-81716416 TACCCAAAGCATCTAGTACAGGG + Intronic
910601545 1:89038002-89038024 TACCCTCAGCATCCAGCCCAGGG - Intergenic
911331935 1:96534514-96534536 AGCACACAGCACGCAGCACACGG - Intergenic
911726483 1:101246554-101246576 GATCCACAGCACAGAGCACAGGG - Intergenic
911764878 1:101661916-101661938 TTCCCACAGACCCCAGCACCAGG - Intergenic
912469648 1:109897657-109897679 TATCCCCAGCACTCAGAACAGGG + Intergenic
912489321 1:110053071-110053093 TACCCAGAGCTCCAGGCACAGGG + Intronic
912661200 1:111532503-111532525 GAGCCACTGCACCCAGCCCAGGG - Intronic
912993926 1:114514543-114514565 TAATAACAGCACCCAGCACATGG + Intergenic
914394673 1:147253780-147253802 GAGCCACTGCACCCAGCCCATGG + Intronic
914918439 1:151832080-151832102 TATTCACAGCACCCACCACAGGG + Intergenic
915217282 1:154348751-154348773 GACCCACAGCACCCGGGACCAGG - Intronic
915590414 1:156867262-156867284 TTCCCAGGGCACCCTGCACAGGG + Intronic
915669424 1:157476435-157476457 TATCCCCAGCTCCCACCACATGG - Intergenic
915866316 1:159503111-159503133 AACCCTCAGCACCTAGGACAAGG - Intergenic
916284059 1:163084772-163084794 TTACCCCAGCCCCCAGCACAAGG - Intergenic
917362281 1:174190018-174190040 TAGCCACTGCACCCAGCCAAGGG - Intronic
918084589 1:181234942-181234964 TAACCACAGTACCCACCCCAGGG + Intergenic
918415106 1:184298409-184298431 TTCCCACAGCACACAGGACACGG + Intergenic
918575075 1:186048143-186048165 TACCTACACTACCTAGCACAAGG + Intronic
919471540 1:197985345-197985367 TACCCACTCCACCCAGCCCCTGG - Intergenic
919684029 1:200465043-200465065 AACTCCCAGCAACCAGCACATGG - Intergenic
919850985 1:201672486-201672508 TACATAAAGCACCCAGAACAGGG - Intronic
920039954 1:203089137-203089159 TAACCCCAGCACCTGGCACAAGG - Intergenic
920317954 1:205092712-205092734 GAGCCACTGCACCCAGCTCAAGG + Intronic
920453233 1:206076448-206076470 AAGCCACTGCACCCAGCCCAGGG + Intronic
920753022 1:208700040-208700062 CAGCCACTGCACCCAGCCCACGG - Intergenic
920852311 1:209636461-209636483 GACCCCCAACACCTAGCACATGG + Intronic
920976705 1:210792435-210792457 TATCTCCAGCACCTAGCACATGG - Intronic
923049406 1:230380380-230380402 TGCCCAGAGGGCCCAGCACAGGG - Intronic
924240951 1:242039764-242039786 TCCACACAACAACCAGCACACGG - Intergenic
924724020 1:246651029-246651051 TATCCTCAGCACCAAACACAGGG - Intronic
1062821503 10:537587-537609 TGCCCAGGGCACCCAGGACACGG + Intronic
1062870729 10:901197-901219 GAGCCACCGCACCCAGCAGAAGG + Intronic
1063173973 10:3535209-3535231 CACCCACGGCACACAGCACCCGG - Intergenic
1063575825 10:7261138-7261160 TATGCACAGTACCCAGCACAAGG + Intronic
1063591708 10:7401389-7401411 AACCCACAGCTTCCAGCACACGG + Intronic
1064002268 10:11673544-11673566 TAGCCTCAGCACACAGCACAGGG - Intergenic
1064002456 10:11674858-11674880 TAGCCTCAGCACACAGCAAAGGG - Intergenic
1064065932 10:12181575-12181597 TCCCCACAACACCCTACACAGGG - Intronic
1064125065 10:12652295-12652317 GAGCCACAGCACCCAGCCCTAGG - Intronic
1064694227 10:17949636-17949658 GAGCCACTGCACCCAGCCCAGGG - Intergenic
1065132961 10:22641272-22641294 TACCCACAGCCTGCAGAACAGGG + Intronic
1065496375 10:26332834-26332856 TACCCACAGGACCCTTCAAAAGG - Intergenic
1066088474 10:31994568-31994590 TATCCCCAGCACCTAGCATAGGG + Intergenic
1067082875 10:43221526-43221548 TACCCAGGGCAACCAGCACAGGG + Intronic
1067207975 10:44235802-44235824 TACGTAAATCACCCAGCACATGG - Intergenic
1067666914 10:48286897-48286919 TACCCCCTGCACCTAGAACAGGG + Intergenic
1067750524 10:48968479-48968501 CTCCCACTTCACCCAGCACAGGG + Intronic
1067775940 10:49164925-49164947 GACCCCCAGCACCTAGCCCATGG + Intronic
1068614255 10:59095350-59095372 TATCCATAGCACCTAGCACAGGG - Intergenic
1069562261 10:69439199-69439221 GTCCCATAGCAACCAGCACATGG + Intergenic
1069719975 10:70543781-70543803 TACACACAGCTCCCAGCACGGGG - Intronic
1069954496 10:72041737-72041759 TGCCTCCAACACCCAGCACAGGG + Intergenic
1070284541 10:75073454-75073476 TCCCCACAGCACCAGGAACAGGG + Intergenic
1070784025 10:79152909-79152931 TTGCCACAGCACCCAGTACCAGG - Intronic
1070826376 10:79392591-79392613 TCTCCACAACACCCAGCCCAAGG + Intronic
1071507900 10:86243802-86243824 CACCCGCAGCCCCCAGCACAAGG + Intronic
1071779946 10:88833196-88833218 TCAACACAGCACTCAGCACATGG + Intronic
1072677179 10:97476602-97476624 TACCCTCAGTGCCCAGAACAGGG + Intronic
1072759678 10:98046060-98046082 TTAGCACTGCACCCAGCACATGG - Intergenic
1072816662 10:98516298-98516320 CAGCCTCAGCACCCAGCACAGGG + Intronic
1072987841 10:100157396-100157418 TACCCAAATGACCCAGGACAAGG + Intronic
1073157173 10:101356281-101356303 GAGCCACAGCGCCCAGCAGAGGG + Intronic
1073475006 10:103747036-103747058 TATCCTCAGGGCCCAGCACAAGG + Intronic
1074669840 10:115777686-115777708 GTCCCACAGCATCTAGCACAGGG - Intronic
1074912847 10:117927443-117927465 AACCCACAGCTTCCATCACAGGG - Intergenic
1075014999 10:118903983-118904005 GATCCTGAGCACCCAGCACAGGG - Intergenic
1075193078 10:120329329-120329351 TTACCACACCACCCAGCACGTGG + Intergenic
1075342821 10:121661139-121661161 TGTACACAGCACCCAGCACATGG - Intergenic
1075652625 10:124139185-124139207 TATCCCCAGCACCCAGCAGAGGG - Intergenic
1075727806 10:124619471-124619493 CACCCACAACATCCAGCTCAGGG + Exonic
1075909600 10:126112771-126112793 TATCCCCAGCACCCTACACAGGG - Intronic
1076405136 10:130206640-130206662 TACCCAGGCCACACAGCACAAGG - Intergenic
1076605063 10:131683890-131683912 CACCTGCAGCTCCCAGCACACGG - Intergenic
1076984874 11:228228-228250 CATCCACAGAACCCAGCAAAGGG + Intronic
1077487376 11:2845297-2845319 TCCCCACAGCTCCCACCCCAAGG - Intronic
1078484329 11:11707611-11707633 TAGCCACCGCGCCCAGCAGAGGG + Intergenic
1078564517 11:12403077-12403099 TCCCCACAGGGGCCAGCACAGGG + Intronic
1078840977 11:15075205-15075227 TTCCCCAAGCGCCCAGCACAGGG + Intronic
1080396875 11:31898321-31898343 CCCCCACAGCACCCAGCACAGGG + Intronic
1080960587 11:37154111-37154133 TACCAACAGAACCCTCCACAAGG - Intergenic
1081064089 11:38518372-38518394 TACCCTCACCACCCACCACATGG - Intergenic
1081612961 11:44574153-44574175 TGCCAAGAGCACCCAGCTCAAGG - Intronic
1081983073 11:47282117-47282139 GAGCCACCGCACCCAGCCCAGGG + Intronic
1082797071 11:57385942-57385964 TCCTCACAGCACTCACCACAGGG + Intergenic
1082799786 11:57406169-57406191 TAGCCCCAGCACCCAGGACAGGG + Intronic
1082800293 11:57409467-57409489 GACCCACAGAACCCAGAAGAAGG + Intronic
1082986641 11:59174951-59174973 TGTCCGCAGCACCCAGCACAGGG - Intronic
1083211947 11:61193758-61193780 GCCCCCCAGCACCCAGCAGATGG - Intergenic
1083327532 11:61880369-61880391 CATCCACTTCACCCAGCACAAGG + Intronic
1083638105 11:64131117-64131139 GACCCGCAGCTCCCTGCACAGGG - Intronic
1083688433 11:64391647-64391669 TCCCCACTGCCCCCAGCAGAGGG + Intergenic
1084417837 11:69043690-69043712 GACCCCCTTCACCCAGCACAGGG + Intergenic
1084433775 11:69126267-69126289 GGCCCAAAGCACCCAGCCCAAGG - Intergenic
1084729166 11:71062238-71062260 GAGCCACTGCACCCAGCCCAAGG + Intronic
1084855602 11:71983658-71983680 TATCCCCAGCACTCAGCACAGGG - Intronic
1084961842 11:72720986-72721008 TGCCCTCAGGAGCCAGCACAGGG - Intronic
1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG + Intronic
1085515317 11:77108199-77108221 GATCTCCAGCACCCAGCACAGGG - Intronic
1085672049 11:78476243-78476265 TGCTCACAGCAACCAGTACACGG - Intronic
1085748767 11:79140429-79140451 GACCCACAGCACAAAACACATGG - Intronic
1085757826 11:79216262-79216284 CAACCCAAGCACCCAGCACAGGG + Intronic
1085816144 11:79739330-79739352 TGTCCTCAGCCCCCAGCACAGGG + Intergenic
1086000342 11:81976198-81976220 TAAGCACAGCACCTAGCACATGG + Intergenic
1086737338 11:90322611-90322633 TACCCCCAGAACCTAGCACTGGG + Intergenic
1086913419 11:92499111-92499133 TATCAACAGCACCCAGCACAAGG - Intronic
1086961245 11:92981805-92981827 GACCGCCAGCACCCAGTACACGG + Exonic
1087091709 11:94280530-94280552 AAACCAGTGCACCCAGCACATGG + Intergenic
1087179429 11:95127157-95127179 TTCCCCCAGAACCCAGCCCAAGG - Intronic
1087821772 11:102720442-102720464 TACACACAGCTCCTAGCATATGG + Intronic
1088530025 11:110798589-110798611 TCCCCACAGCACCTGGCACAGGG - Intergenic
1089033391 11:115357683-115357705 TGAGCACAGCACCCAGCATATGG + Intronic
1089778960 11:120859709-120859731 TACCGATAGCCCACAGCACATGG + Intronic
1090613443 11:128492864-128492886 CAGCCCCAGCTCCCAGCACATGG + Intronic
1090666272 11:128916878-128916900 CCCTCACAGCTCCCAGCACAGGG + Exonic
1091170953 11:133519128-133519150 AGCCCAGACCACCCAGCACAAGG - Intronic
1091456289 12:610505-610527 TCCCCACAGCGGCCAGCCCAGGG + Intronic
1091905787 12:4188225-4188247 GAACCATAGCACCCAGCCCATGG - Intergenic
1092757268 12:11775390-11775412 TAACCCCAGCACTCATCACAAGG - Intronic
1092866558 12:12766959-12766981 GAGCCACTGCACCCAGCCCAGGG - Intronic
1096227409 12:49875312-49875334 TGCCCGCATCACCCAGCCCAGGG + Intronic
1096601778 12:52734745-52734767 TAGCCCCAGCACCAAGCACAGGG + Intergenic
1096620195 12:52859736-52859758 TCCCCATAGCCCCCAGCACCAGG - Intergenic
1096649188 12:53053543-53053565 TACCCACAGCACTCCGTTCAAGG - Intronic
1096751529 12:53761819-53761841 TTCCCACAGGGTCCAGCACATGG + Intergenic
1097895688 12:64822957-64822979 CACCCACAGCACCCAGGTTATGG - Intronic
1098370445 12:69754066-69754088 TCCTCACAGCAACCAGGACAAGG + Intronic
1098523330 12:71458752-71458774 TACCCTCAGCATCTAGCACAAGG - Intronic
1098555942 12:71819160-71819182 GAGCCACTGCACCCAGCTCATGG - Intergenic
1098611361 12:72462449-72462471 TACCAACACCACCCAGGAAAGGG - Intronic
1099520935 12:83661273-83661295 TACCCACAGCACCTGGCGCTGGG - Intergenic
1100036727 12:90260579-90260601 TAACCACAGCACCCTTCTCAGGG + Intergenic
1100224114 12:92539129-92539151 ATCCCAAAGCACCCAGTACAAGG + Intergenic
1100483007 12:94997399-94997421 TTAGCACAGCACCTAGCACATGG + Intronic
1101722176 12:107359689-107359711 TCTGCACAGCACCCAGCACATGG - Intronic
1102470777 12:113158771-113158793 TGCCCCCAGTGCCCAGCACAGGG + Exonic
1104337090 12:127909310-127909332 TATCCACAGAAGCCAGCACATGG + Intergenic
1104414266 12:128584892-128584914 TCCCCAGAGCACACAGCAGAAGG + Intronic
1104969774 12:132525967-132525989 TGCCCGCTGCACCCTGCACAAGG + Intronic
1105944100 13:25175188-25175210 AAGCCACCGCACCCAGCACTGGG + Intergenic
1106053433 13:26214282-26214304 TAACAACAGGAGCCAGCACAGGG - Exonic
1106299875 13:28453831-28453853 TAGCCCCAGGACCCAGCACAGGG - Intronic
1107462827 13:40620622-40620644 TACTGACAGCAGCCAGCACAGGG + Intronic
1107555399 13:41513254-41513276 TATCCCCAACACCTAGCACAGGG - Intergenic
1107802629 13:44123570-44123592 TTCCCACATCCCCCAGCACATGG + Intergenic
1108597648 13:51963308-51963330 TACTCACAATACCCAGCTCACGG - Intronic
1108712414 13:53046612-53046634 TAACCCCAGTACCCAGAACAGGG - Intronic
1109167798 13:59057307-59057329 GAGCCACTGCACCCAGCCCAGGG + Intergenic
1109414053 13:62012169-62012191 TACCCAAAGGACCCTGCCCACGG + Intergenic
1111385629 13:87522777-87522799 TACACACAGCACAAAGCATAGGG - Intergenic
1111804074 13:93017027-93017049 TACCCAAAACACCAAACACAAGG + Intergenic
1112482652 13:99791269-99791291 AACACACACCACCCACCACAGGG + Intronic
1113190747 13:107742798-107742820 TACTCACAACCCCCAGCAGAGGG + Intronic
1114377697 14:22166195-22166217 TAGCCACAGATCCCAGCAAAAGG + Intergenic
1114406798 14:22464355-22464377 TACCCACACCATGCTGCACATGG + Intergenic
1116700397 14:48234213-48234235 TACTCACAGCAGCCAACATATGG - Intergenic
1117747016 14:58879967-58879989 GCCCCACAGCACCTAACACAGGG + Intergenic
1117827147 14:59715539-59715561 GAGCCACAGCACCCAGCCTAAGG - Intronic
1119695250 14:76708389-76708411 TAGCCCCAGCACCCAGCACAGGG + Intergenic
1119795870 14:77396531-77396553 GAGCCACCGCACCCAGCCCAAGG + Intronic
1121233060 14:92372443-92372465 CACCCACCACACCCAGCCCAGGG - Intronic
1121248465 14:92482100-92482122 TACATAAAACACCCAGCACACGG - Intronic
1121827976 14:97026364-97026386 GACCCACAGCACTCAGCCCAGGG - Intergenic
1122055240 14:99093665-99093687 CATCCCCAGCACCCACCACAGGG - Intergenic
1122695925 14:103552051-103552073 TTCCAACAGCACCGAGGACATGG + Intergenic
1123450668 15:20357457-20357479 TCCCCCCAACACCCACCACAGGG + Intergenic
1124199617 15:27667289-27667311 TAACAACAGCAACCAGCACAAGG + Intergenic
1124615229 15:31236746-31236768 TACCCCCAACCCCCAGCATAAGG + Intergenic
1124863622 15:33467887-33467909 TAACCACATCACAGAGCACAAGG - Intronic
1126420468 15:48466983-48467005 CATGCAGAGCACCCAGCACAGGG - Intronic
1127485663 15:59415400-59415422 GAGCCACCGCACCCAGCAAAAGG + Intronic
1128051927 15:64672294-64672316 GAGCCACCGCACCCAGCCCAAGG + Intronic
1128131372 15:65229305-65229327 TACCCCCAGCACCTAGCTCAGGG - Intergenic
1128270898 15:66308534-66308556 CCCCCAGAGCACCCAGCCCAGGG + Intronic
1128675716 15:69607091-69607113 CACCCACAGCCCCCAGAATAAGG - Intergenic
1129237802 15:74234238-74234260 TACCCACAGGAGACAGCACTTGG - Intergenic
1129281982 15:74492551-74492573 GAGCCACCGCACCCAGCCCATGG + Intergenic
1130149091 15:81297770-81297792 TCCCCCCAGCATCTAGCACAGGG - Intronic
1130816827 15:87445032-87445054 TACAGACAGCACCCGGCAGAGGG + Intergenic
1130840984 15:87701164-87701186 CACGCACAGAACCCAGCACAGGG + Intergenic
1131050123 15:89342188-89342210 CATCCCCAGCACCTAGCACAGGG + Intergenic
1131510971 15:93049250-93049272 TACCCCGAGCCCCCAGCACCAGG - Intronic
1131532992 15:93210306-93210328 TATCCTCAGCTCCCAGCACAGGG - Intergenic
1131535791 15:93236673-93236695 TATCCCCAGCACCTAGCACAAGG - Intergenic
1131989566 15:98080231-98080253 TACCCACATGACCCTGCACAAGG - Intergenic
1132287018 15:100670808-100670830 TACCCAGTGCTCCCAGCACGGGG - Intergenic
1132386978 15:101407677-101407699 TTCCCACAGAAACCACCACAAGG + Intronic
1132512268 16:349623-349645 GACCCACAGCACCCAGCACAAGG + Intronic
1132576603 16:667170-667192 CAGGCACAGCGCCCAGCACAGGG + Intronic
1132890141 16:2199715-2199737 GAGCCACAGCAGCCAGCCCATGG - Intergenic
1133264414 16:4574843-4574865 TACCCTCAGCACCCAGGACCCGG - Intronic
1133787717 16:8986095-8986117 TGCCCACAATACCCAGGACAGGG - Intergenic
1135892057 16:26366114-26366136 CCCCCATAGAACCCAGCACAGGG - Intergenic
1136032841 16:27516071-27516093 TACCACCAGCACCTAGCACAGGG + Intronic
1136274205 16:29168716-29168738 TGTCCCCAGCTCCCAGCACATGG - Intergenic
1136287003 16:29250299-29250321 TCCCTACAGCACCCAGCACCTGG + Intergenic
1136504690 16:30695429-30695451 CTCCCACTGCACACAGCACAGGG + Intergenic
1136604935 16:31327088-31327110 TCCCACCAGCACTCAGCACAAGG - Intronic
1136610336 16:31362080-31362102 TCCCCACAGCCCCCAGAACGGGG - Exonic
1137906982 16:52333251-52333273 CTTCCCCAGCACCCAGCACATGG + Intergenic
1138077395 16:54056339-54056361 TATTCCCAGCACCCAGCACAGGG + Intronic
1138108412 16:54304291-54304313 TGTCCCCAGCGCCCAGCACATGG - Intergenic
1138479413 16:57292085-57292107 TTCCCACAGCACCAAGCATAGGG - Intergenic
1138490927 16:57376220-57376242 ACCTCACAGCACCCAGCACAGGG + Intronic
1138607795 16:58099860-58099882 CACCCACAGCCCCAAGCCCACGG + Intergenic
1138684536 16:58713352-58713374 GAGCCACCGCACCCAGCTCAGGG - Intronic
1139323469 16:66133984-66134006 TATCCTCAGAACCCAGCACGGGG - Intergenic
1139330060 16:66181201-66181223 TAACCCCAGCTCCCAGAACATGG - Intergenic
1139488068 16:67270547-67270569 TATCCCCAACACCTAGCACAGGG - Intronic
1139489208 16:67277778-67277800 TACTTTCAGCATCCAGCACAGGG - Exonic
1139602249 16:67993750-67993772 CACCCACACAACCCAGCACCAGG - Exonic
1140248198 16:73270475-73270497 CGCCCACAGCACCCAGCCCAGGG + Intergenic
1140485527 16:75290227-75290249 CAGCCACAGCACCCAGCCCATGG + Intergenic
1140601971 16:76487316-76487338 TATCTCCAGCACACAGCACAAGG - Intronic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1142078481 16:88134363-88134385 TGTCCCCAGCTCCCAGCACATGG - Intergenic
1142092609 16:88222930-88222952 TCCCTACAGCACCCAGCACCTGG + Intergenic
1142600483 17:1051323-1051345 TACCCGCAGTACCAAGAACAGGG + Intronic
1143409546 17:6700587-6700609 CCCGCACAGCTCCCAGCACAGGG - Intronic
1143525577 17:7470111-7470133 GAGCCACTGCACCCAGCCCATGG - Intronic
1143919977 17:10323374-10323396 TTCCCATAGCACCAAGCACAGGG - Intronic
1144769179 17:17749818-17749840 TATCCCCAGCACCCAGCATAGGG + Intronic
1145262746 17:21364597-21364619 TCCCCAAAGCACCCAGGAGAGGG - Intergenic
1145262946 17:21365523-21365545 TCCCCAAAGCACCCAGGAGAGGG - Intergenic
1145778416 17:27545546-27545568 CCAGCACAGCACCCAGCACATGG - Intronic
1145940200 17:28739364-28739386 TCATCTCAGCACCCAGCACAGGG - Intronic
1146550883 17:33779599-33779621 TCCCCACAACCCCCAGCCCAAGG - Intronic
1147863740 17:43539558-43539580 ATGCCCCAGCACCCAGCACAGGG + Intronic
1148007018 17:44441130-44441152 GAGCCACTGCACCCAGCCCAGGG + Intronic
1148145964 17:45365014-45365036 CTCCCACAGCACCAAGCACAGGG - Intergenic
1148377649 17:47163414-47163436 GAGCCACAGCACCCAGCCAAGGG - Intronic
1148496713 17:48057216-48057238 TACCCCCAGCAGCCAGAATAAGG - Intronic
1148747928 17:49928662-49928684 TACCCTAAGCTCCCAGCACTTGG - Intergenic
1148872339 17:50666052-50666074 TCTCCACAGCACCAAGCTCAGGG + Intronic
1149010667 17:51853407-51853429 TACCCAGAACTCCCTGCACATGG - Intronic
1149774382 17:59345802-59345824 TCAGCACAGCACCCAGCACATGG - Intronic
1150138790 17:62711636-62711658 TCCCCACAACATCCAGCTCAAGG - Intronic
1150195588 17:63294815-63294837 TATCCGCAGCACCCAGAAAATGG - Intronic
1151156225 17:72124330-72124352 GACCCACAGCCCCCAGCACTGGG + Exonic
1151517161 17:74604097-74604119 CACCAACAGCACCCAGCCCACGG + Intergenic
1151544214 17:74782454-74782476 TATCCTCAGCTCCAAGCACAGGG + Intronic
1151586515 17:75012186-75012208 TATCCCCAGCACCCAGAACATGG - Intergenic
1152043817 17:77922971-77922993 TACAGTCAGCTCCCAGCACAAGG - Intergenic
1152141562 17:78540292-78540314 TACCCCCAGCACTCAGCAGTAGG + Intronic
1152196154 17:78919548-78919570 GAGCCACCGCACCCAGCAGATGG - Intronic
1152343189 17:79736659-79736681 TCCCCTCAGCAGACAGCACAGGG + Intronic
1152911968 17:83010122-83010144 TGCCCACAGCACCCCACACCAGG - Intronic
1154197380 18:12276589-12276611 TGCCCCCAGCACCCACAACAGGG - Intronic
1154208721 18:12360649-12360671 GACCCAGAGGGCCCAGCACAGGG + Intronic
1155074330 18:22341760-22341782 TTCCCATAGCACCCTGTACATGG - Intergenic
1155628667 18:27865190-27865212 GAGCCACTGCACCCAGCCCAAGG + Intergenic
1157326754 18:46674678-46674700 TCCTCACAGCACACAGCATAAGG - Intronic
1157327307 18:46678494-46678516 CTCCCAGAGCACCCAGCACGTGG + Intronic
1157522793 18:48356870-48356892 CCCCCACAGCACCCACCACCTGG + Intronic
1157548067 18:48561537-48561559 AGCCCCCAGCAGCCAGCACAGGG - Intronic
1157749276 18:50163583-50163605 TTCCCACAGTATCCAGCACCTGG - Intronic
1158045014 18:53145395-53145417 GAGCCACCGCACCCAGCCCAGGG + Intronic
1158250594 18:55483078-55483100 CACCCTCAGTACCCAGCACGGGG + Intronic
1158481913 18:57829515-57829537 GAGCCACCGCACCCAGCAAAAGG + Intergenic
1158512802 18:58106451-58106473 AACCCACAGTACCTAGCACTCGG - Intronic
1159023417 18:63161682-63161704 TACCCCCAAGTCCCAGCACAGGG + Intronic
1159090370 18:63841724-63841746 TAGGCACAGGTCCCAGCACAGGG + Intergenic
1159763419 18:72456396-72456418 AACTCAAAGCACCCAGCACTGGG - Intergenic
1160969715 19:1762186-1762208 GACCCCCAGCAGCCAGCACGAGG - Intronic
1161221235 19:3119146-3119168 TCCCCACTGCACACAGCCCAAGG - Intronic
1161232999 19:3184546-3184568 TGTCCCCAGCACCCACCACACGG + Intergenic
1161258853 19:3324565-3324587 TCCCCACAGCAGCCACCAGAGGG + Intergenic
1161431240 19:4233525-4233547 TTCCCACAGCAGCCACCAGAGGG + Intronic
1161541059 19:4851794-4851816 TCCCCACAGCAGCCACCAGAGGG - Intronic
1161621377 19:5299104-5299126 TCCCCACAGCACCCACTACATGG + Intronic
1161836360 19:6649859-6649881 TACCCACATAACCCAGGATAAGG - Intergenic
1162419001 19:10555200-10555222 TTCCCAGAGCACCCAACACAGGG - Intronic
1162442813 19:10703524-10703546 TGGCCACCGCACCCAGCACGTGG - Intronic
1162730983 19:12718712-12718734 TACCCTTAGCACTCAGCCCAAGG + Intronic
1163818500 19:19482614-19482636 TACCCCCAGTTCCCAGTACAGGG - Intronic
1164425430 19:28137461-28137483 CACACACAGGATCCAGCACAGGG + Intergenic
1164629396 19:29752256-29752278 TCCTCAGAGCACCTAGCACAGGG - Intergenic
1164907946 19:31982871-31982893 GAGCCACTGCGCCCAGCACAAGG + Intergenic
1165223456 19:34337006-34337028 TACCAAAAGCACCCAGCAGAGGG - Intronic
1165414440 19:35683587-35683609 TAGCCACCGCACCCAGCCCCTGG + Intergenic
1165475574 19:36028479-36028501 TGACGTCAGCACCCAGCACAGGG + Intronic
1165706848 19:37982455-37982477 TAACCGCAACACCAAGCACATGG - Intronic
1166053067 19:40272365-40272387 TCAGCACAGCACCCAGCACGTGG + Intronic
1166217255 19:41343759-41343781 CCCCCACACCACCCAGCACATGG + Intronic
1166314304 19:41980269-41980291 TACACCCAGCACCCAAAACAGGG + Intronic
1166341676 19:42141208-42141230 TAGACTCAGCACCCAGCACTGGG + Intronic
1166764022 19:45241922-45241944 TGTCCCCAGCTCCCAGCACAGGG + Intronic
1167233400 19:48298861-48298883 TGCCCACATCACCTAGCACAGGG + Intronic
1167526573 19:49988028-49988050 TGCACACAGCACTTAGCACAGGG - Intronic
1167534655 19:50041965-50041987 TCCCCCCAGCTCCCAGGACAAGG - Intronic
1167652395 19:50739648-50739670 TAACAACAGCACCCACCTCAAGG - Intergenic
1167695474 19:51013251-51013273 TGTCCCCAGCACCCAGCACTGGG + Exonic
1168256343 19:55167679-55167701 TCACCCCAGCACCCAGCACTGGG + Intergenic
925415842 2:3669676-3669698 TGCCCACTGGACCCAGAACATGG - Intronic
925458120 2:4036264-4036286 TACCAATAACACCCAGCATAAGG - Intergenic
926303827 2:11622876-11622898 TTCTCACAGCAAACAGCACAAGG + Intronic
927700666 2:25266474-25266496 TTCCCATAGCCCCTAGCACAAGG + Intronic
928134583 2:28678660-28678682 GGCCCACAGCACCAAGGACACGG + Intergenic
929118924 2:38467789-38467811 TATCCACACCACCCAGCTTAAGG + Intergenic
929867912 2:45734080-45734102 GAGCCACCGCACCCAGCCCAGGG - Intronic
930055649 2:47250231-47250253 TTCCCACAGCACCTAGCATACGG - Intergenic
930903946 2:56543204-56543226 CACCCGCAGAACCTAGCACAAGG - Intergenic
931650601 2:64465458-64465480 TACCCCCATCACCCAAGACATGG - Intergenic
931658078 2:64528331-64528353 TATCCCCAGCACCTAGAACAGGG - Intronic
932275046 2:70445315-70445337 GACCCAAAGCATCCAGAACATGG + Intergenic
932479125 2:72028109-72028131 TACCCACAAAACCCAGCCAAGGG + Intergenic
932481610 2:72042828-72042850 TACCACCAACACACAGCACATGG + Intergenic
932760997 2:74439389-74439411 CACACACTGCACCCAACACAAGG + Intronic
933830131 2:86200025-86200047 TAACTACAGCCCCCGGCACAAGG + Intronic
934524125 2:95040915-95040937 TCCCAACAGCACCGAGCACGTGG - Intronic
935111755 2:100100683-100100705 CTCCCACAGAAACCAGCACAAGG + Intronic
935346291 2:102111549-102111571 CATCCCCAGCACCTAGCACAGGG - Intronic
936123210 2:109764485-109764507 CTCCCACAGAAACCAGCACAAGG - Intergenic
936221472 2:110606984-110607006 CTCCCACAGAAACCAGCACAAGG + Intergenic
936518317 2:113196461-113196483 CTCACACAGCATCCAGCACATGG - Intronic
936524464 2:113233395-113233417 GAGCCACTGCACCCAGCCCATGG - Intronic
936628096 2:114170320-114170342 GACTCACAACACCCAGCAGAGGG - Intergenic
937123741 2:119459649-119459671 AATTCTCAGCACCCAGCACAGGG + Intronic
937479134 2:122241098-122241120 TGCCCTCTGCACCCTGCACACGG + Intergenic
937888110 2:126914243-126914265 TCCCCACTGCCCCCATCACACGG - Intergenic
939502292 2:143003058-143003080 TCCCCTCAGTACTCAGCACAGGG + Intronic
942307217 2:174620646-174620668 TTACTACAGCACCTAGCACAGGG - Intronic
942331085 2:174824892-174824914 GAGCCACTGCACCCAGCCCATGG + Intronic
943611100 2:190035540-190035562 TACTCTCAGCACACAGCCCATGG - Intronic
944858188 2:203788264-203788286 CCCCCACAGTACCTAGCACAGGG - Intergenic
944863646 2:203839636-203839658 TATCCTCAGTGCCCAGCACAGGG - Intergenic
948129120 2:235587409-235587431 TTCAAACAGCACCCAGCACATGG - Intronic
948502879 2:238407820-238407842 AGCCCTCAGCACACAGCACACGG + Intergenic
948789523 2:240370109-240370131 TCCCCACAGCCCCCACCGCAGGG - Intergenic
948904253 2:240970771-240970793 TACCCACAGCAGCCCACACCTGG + Intronic
1168768280 20:396894-396916 TACTCCCAGCACCGAGAACAGGG - Exonic
1168804803 20:666081-666103 TCCCTTCAGCAGCCAGCACAGGG + Intronic
1168837032 20:884403-884425 TATCCCCAGCACCCAGCACTGGG + Intronic
1168949590 20:1787488-1787510 TATCCGCAACACCTAGCACAAGG + Intergenic
1168973610 20:1947632-1947654 TACCCACAGCGCCCAGCTCGAGG - Intergenic
1169133217 20:3178454-3178476 TACCCACAGAACACAGCAGGAGG + Intergenic
1169143077 20:3236964-3236986 TACCCAGAGCCCTCAGGACATGG - Intronic
1169194551 20:3676165-3676187 CACCCACCCCACCCAGCCCAAGG + Intronic
1170504840 20:17014407-17014429 TAGCAACAGCATCCAGCACTCGG - Intergenic
1170799518 20:19579472-19579494 TATCCGCAGCAGTCAGCACAGGG - Intronic
1170868492 20:20182543-20182565 TATCCCCAGCACCCAAAACACGG + Intronic
1170974657 20:21150801-21150823 ACCCCACAGCACCCTGCACCTGG + Intronic
1171187116 20:23130385-23130407 TACCCAAAACACCCAGCAGAAGG - Intergenic
1171394066 20:24819705-24819727 TACTCAGGGCTCCCAGCACAAGG - Intergenic
1171400444 20:24869677-24869699 TACCCACAGTAGTCAGTACAGGG + Intergenic
1171424422 20:25040757-25040779 TACCCAAACCACCCAGCCCCAGG + Intronic
1172007031 20:31824655-31824677 GACCCCCAGTGCCCAGCACAGGG - Intronic
1172098105 20:32470436-32470458 GGCCTCCAGCACCCAGCACAGGG - Intronic
1172157406 20:32837796-32837818 GAGCCACTGCGCCCAGCACAGGG - Intronic
1172310803 20:33917009-33917031 AAACCACAGCACTCAGCAAATGG - Intergenic
1172359151 20:34300276-34300298 TCCCCACAGCAGCCAGAAGAGGG + Intronic
1172799381 20:37565323-37565345 TCTCCCCGGCACCCAGCACAAGG - Intergenic
1172807084 20:37619748-37619770 GAACCACTGCACCCAACACATGG - Intergenic
1172972521 20:38883736-38883758 TATTCCCAGCATCCAGCACAGGG + Intronic
1173428474 20:42963723-42963745 TACCCACCCTACCCTGCACAGGG + Intronic
1173767080 20:45621905-45621927 GACTCACAGGACTCAGCACATGG - Intronic
1173855156 20:46245613-46245635 TCTCCCCAGCACCCAGCACGGGG + Intronic
1174600988 20:51724680-51724702 CACCCCCAGAACCCAGCACAGGG + Intronic
1175657723 20:60786636-60786658 TGCTCACAGCACCCAGCAGCTGG - Intergenic
1175776169 20:61654987-61655009 TCCCCACAGCAGCCAGCACTGGG - Intronic
1175823538 20:61924518-61924540 CGCCCACAGAACCCAGGACACGG - Intronic
1176123372 20:63464233-63464255 TGCCCAGAGCTCCCAGCCCAGGG - Intronic
1176168772 20:63687846-63687868 GACCCCCAGCACCCGGCTCATGG - Intronic
1176246390 20:64099237-64099259 TGCAAACAGCACACAGCACATGG - Exonic
1178499875 21:33116904-33116926 TCCCCCCACCACCCCGCACAAGG + Intergenic
1178590230 21:33903286-33903308 TAGACACAGCACCTAACACATGG - Intronic
1178770854 21:35502640-35502662 TCCCCACTCCACCCAGCAAAAGG + Intronic
1178918047 21:36720066-36720088 CACACACAGCACCCACCACGTGG + Intronic
1179798389 21:43798907-43798929 TCCCCACCGCCCCCAGCACTTGG + Intronic
1180087983 21:45516584-45516606 AACCCCCAGCAGCCTGCACATGG + Intronic
1180738155 22:18034281-18034303 TACTAACCGCACACAGCACATGG - Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181674067 22:24440627-24440649 AAACGACAGCACCCAGCAGATGG - Exonic
1181725728 22:24809667-24809689 TATCCACAGAACCTAGCCCAGGG - Intronic
1182063233 22:27412736-27412758 TACCCACCCAACCCAGCCCATGG - Intergenic
1182297763 22:29319563-29319585 CAGCCACTGCACCCAGCCCAAGG - Intronic
1182739235 22:32555045-32555067 TACCCCTAGCACCCAGCATAAGG + Intronic
1182906169 22:33938361-33938383 GAGCCACCGCACCCAGCCCAGGG + Intergenic
1183407670 22:37638472-37638494 TACTCCCAGCACCTAGCCCAGGG - Intronic
1183423521 22:37725593-37725615 TGCCCAATGCACACAGCACATGG - Exonic
1183997346 22:41645014-41645036 GAGCCACAGCCCCCAGCTCAAGG - Intronic
1185026563 22:48417498-48417520 TGCACACAGCAGCCAGCAAAGGG + Intergenic
1185229400 22:49671474-49671496 AATCCTCAGCACCCAGCCCAGGG + Intergenic
1185403883 22:50634162-50634184 GACCCACAGCAATCAGCCCACGG - Intergenic
949360836 3:3230594-3230616 CTTCCACAGCACCCAGCATATGG - Intergenic
950344476 3:12279852-12279874 TAACCTCAGCACCTAGCGCATGG - Intergenic
950432362 3:12958222-12958244 TGCCCACAGCACCCAGCACAGGG + Intronic
950638854 3:14335024-14335046 TACCCACTGCACCCAGCCCTGGG - Intergenic
951411768 3:22374482-22374504 TACCCAGAGCATACAGTACATGG + Intergenic
952494352 3:33902807-33902829 GACCCCCAGAGCCCAGCACAGGG - Intergenic
952495562 3:33913085-33913107 AATTCATAGCACCCAGCACAGGG + Intergenic
952990051 3:38823933-38823955 CACCCACAGCCCCCACCTCAGGG - Intergenic
953901643 3:46846999-46847021 TACCCTCAGGGCCCATCACAAGG - Intergenic
954039226 3:47871609-47871631 AACCCACAGCACCTAGCACGTGG - Intronic
954677930 3:52325853-52325875 TTTCCACACCACCCAGCACCAGG - Intronic
954750643 3:52811540-52811562 TGCCCACAGTACTCAGCCCAGGG + Intergenic
954877074 3:53809183-53809205 TACCCACAGGGCCCTGCCCATGG - Intronic
955519699 3:59763110-59763132 AACCCACAGTACTCAGAACAAGG + Intronic
956082153 3:65568647-65568669 AACATACAGCACCCTGCACAAGG - Intronic
958872720 3:99580076-99580098 TGCCAAAAACACCCAGCACAAGG - Intergenic
960344015 3:116510288-116510310 TACCCACATAACCCATTACAGGG - Intronic
960897368 3:122519810-122519832 TAGCCACCACACCCAGCAAAGGG + Intergenic
961455275 3:127020808-127020830 CACCCGCACCTCCCAGCACACGG - Intronic
961519930 3:127461212-127461234 CACCCATAGTCCCCAGCACAGGG - Intergenic
961530663 3:127538085-127538107 TATCCTTAGCACCCAGCACAGGG + Intergenic
962027022 3:131558392-131558414 TCCACTCAGCACCCAGCAAAGGG + Intronic
962399531 3:135046380-135046402 TATCCATATCAACCAGCACAGGG + Intronic
965447896 3:168798684-168798706 TAGGAACAGCACCTAGCACATGG - Intergenic
965626861 3:170690446-170690468 TGCCCACAGAGCCCAGAACAAGG - Intronic
965780876 3:172284750-172284772 TTACTACAGCACCCATCACAAGG + Intronic
966861219 3:184231712-184231734 CAAGCACAGCACACAGCACAGGG - Intronic
967772900 3:193354597-193354619 TACCTCCAGCACCTAGGACAGGG + Intronic
967873657 3:194251917-194251939 TCCCCACAGCACCCAGAACAAGG - Intergenic
967936751 3:194734644-194734666 GAGCCACTGCACCCAGCCCAGGG - Intergenic
967938183 3:194746099-194746121 AACCCATAGCATCCAGCACAGGG + Intergenic
968170597 3:196506586-196506608 TATCCACAGTACCTAGTACATGG + Intergenic
968578036 4:1376996-1377018 TCCCCACAGCACCCATTTCAAGG + Intronic
968705302 4:2074840-2074862 TCCCCACAGCACCCAGCCACTGG - Intronic
968734511 4:2288419-2288441 TGGCCCCAGCACCCAGCCCAGGG - Intronic
968903001 4:3439921-3439943 TGTCCCCAGCACCCAGCACCAGG - Intergenic
969318224 4:6394946-6394968 TGACCCCAGCACCCAGCTCAGGG - Intronic
969422048 4:7103233-7103255 TATCCCCAGCACCCAGCAAATGG + Intergenic
969481958 4:7451465-7451487 TATTCCCAGCACCCAGCACTGGG - Intronic
969499730 4:7545401-7545423 TGAGCTCAGCACCCAGCACATGG - Intronic
971861146 4:32107664-32107686 TACCCTCAGTACCAAGCACAGGG + Intergenic
972197811 4:36675462-36675484 TATCCACAGCATCTAGAACAGGG - Intergenic
975126119 4:70784197-70784219 GAGCCACTGCACCCAGCCCAGGG - Intronic
975633698 4:76424774-76424796 TCTCCCCAGTACCCAGCACAGGG - Intergenic
978697085 4:111595477-111595499 CAGCCACAGCACCTATCACAGGG + Intergenic
979708835 4:123753140-123753162 GACCCAAAGGACCCAGCATATGG - Intergenic
981427788 4:144623628-144623650 TTTCCTCAGTACCCAGCACAGGG - Intergenic
982420637 4:155192880-155192902 TACCCACAACAGGCAGCACTGGG - Intergenic
983207632 4:164927428-164927450 TTCCCACATCTCACAGCACAAGG + Intergenic
983211157 4:164959489-164959511 TTCCCACATCTCACAGCACAAGG - Intronic
983509821 4:168596152-168596174 AATCCACAGAACCCAGCAAAGGG - Intronic
985654771 5:1124635-1124657 AACACTCAGCGCCCAGCACAGGG + Intergenic
985857539 5:2441962-2441984 TTTCCACAGGACCAAGCACATGG + Intergenic
987327746 5:16827921-16827943 CCCCAACAGCACACAGCACAGGG + Intronic
988570832 5:32364043-32364065 TACCTACAGCAATCACCACAGGG + Exonic
988727714 5:33940708-33940730 TCACCTCAGCACCCTGCACAGGG - Intergenic
989013404 5:36900633-36900655 CAAGCACAGCACCCAGCATATGG + Intronic
989176688 5:38534570-38534592 AGCCCACATAACCCAGCACAAGG + Intronic
989597819 5:43172922-43172944 TACCTTCATCACCTAGCACATGG + Intronic
989603415 5:43221188-43221210 GAGCCACAGCACCCAGCCTAAGG - Intronic
990209900 5:53471189-53471211 GAGCCACTGCACCCAGCACCTGG + Intergenic
990815288 5:59778083-59778105 GACCCACAGAACCTAGCACATGG - Intronic
992481715 5:77158181-77158203 TACATACAGCACCCAGTACCAGG - Intergenic
992666605 5:79015584-79015606 TATCCCCAACACCCAGCTCAGGG - Intronic
993099665 5:83521780-83521802 TACCCACATTACCCAGCTTATGG + Exonic
993532733 5:89044143-89044165 TCCCCACACCCTCCAGCACATGG + Intergenic
993698682 5:91092928-91092950 CACACAAAGCACTCAGCACAAGG - Intronic
995503451 5:112833606-112833628 GAGCCACCACACCCAGCACATGG + Intronic
995557375 5:113343641-113343663 TACTCTCAGCACCGTGCACATGG + Intronic
995765560 5:115613063-115613085 TCAGCACAGCACCTAGCACAAGG + Intronic
996776974 5:127143192-127143214 TCCCCACAGCCACCAGGACACGG + Intergenic
996803524 5:127429533-127429555 TCACCATAGCACCTAGCACATGG - Intronic
997423639 5:133788114-133788136 TATCCCCAGCGCCCAGCCCAGGG + Intergenic
997666829 5:135636234-135636256 TCCCCACAGTGTCCAGCACACGG - Intergenic
997669351 5:135657745-135657767 CACCCACAGCAACCTGCTCATGG - Intergenic
998059616 5:139109666-139109688 TACACAAAGCACCTAGCACAAGG + Intronic
998127392 5:139633917-139633939 TACCCTGGGCAACCAGCACATGG + Intergenic
998141972 5:139705122-139705144 CACCCTCAGCACCCATCACATGG + Intergenic
998795438 5:145813213-145813235 TAGCCACTGCACCCAGAATAGGG - Intronic
998894182 5:146780691-146780713 CACCAACAGCAAACAGCACAGGG - Intronic
999707425 5:154286233-154286255 TATCCTCAGCACCTAGCACAAGG + Intronic
999730256 5:154472020-154472042 TGCCCACAGTGCCTAGCACATGG + Intergenic
1000186226 5:158860850-158860872 CACCTCCAGCACCCTGCACAAGG + Intronic
1000230353 5:159310190-159310212 CCCCCACAGCACCCAGTAGATGG + Intergenic
1000267532 5:159652080-159652102 TATCCACAGCCCTTAGCACAGGG + Intergenic
1000369354 5:160519914-160519936 TACCCTAAGCACACAGCAGAAGG - Intergenic
1000419351 5:161020836-161020858 GAGCCACAGCACCCAACCCAAGG - Intergenic
1000614232 5:163410186-163410208 GACCCACAGCACCCAGCTGCAGG - Intergenic
1000918315 5:167108463-167108485 TCCCCACAAAAGCCAGCACAGGG + Intergenic
1001039435 5:168322562-168322584 TATCCTCAGCACCTAGCACAAGG + Intronic
1001065874 5:168534761-168534783 TCCCCCCAGCTCCCAGCACAGGG - Intergenic
1001082295 5:168676243-168676265 GATCCACAGCACCCAGGACGAGG - Intronic
1001705443 5:173738013-173738035 TACCCTCAGTTGCCAGCACAGGG + Intergenic
1001710628 5:173775194-173775216 TATCCACAGTGCCCAGCTCAGGG + Intergenic
1001745615 5:174090154-174090176 GACTCACAGCACTCAGCATATGG + Intronic
1001771595 5:174301129-174301151 TACCCTCAGCACTTAGCTCAGGG + Intergenic
1002027019 5:176402616-176402638 TCCATACAGCACCCAGCACCGGG + Intronic
1002110407 5:176905934-176905956 TACACACAGAACACAGGACAAGG + Intronic
1002169039 5:177365162-177365184 TATCCACAGCATCTAGAACATGG - Intronic
1003537808 6:6991071-6991093 TAGCCACTGCACCCAGCTCTTGG - Intergenic
1003610068 6:7604702-7604724 TACCCATGCCACCAAGCACAGGG - Intronic
1003891790 6:10570217-10570239 TAGCCACGGCACCCAGCATGTGG + Intronic
1004427618 6:15517023-15517045 TAGCCCCAGCACCCACCACCCGG - Intronic
1004503111 6:16226803-16226825 TACCCAGAGCATCCCGCACTGGG + Intergenic
1004560455 6:16744492-16744514 TACCCACTGCTCCCAGGACAGGG + Intronic
1004945496 6:20607977-20607999 GAGCCACTGCACCCAGCCCAAGG + Intronic
1005026106 6:21464551-21464573 GAGCCACAGCGCCCAGCCCAGGG - Intergenic
1005491779 6:26353971-26353993 TACCCGAAGTACCCAGCCCACGG + Intergenic
1006270514 6:32962689-32962711 TACCCACAGTAGCCAAGACATGG + Intronic
1006425734 6:33961841-33961863 AACCCCCAGCACCTAGCACCAGG - Intergenic
1006948985 6:37805856-37805878 GAGCCACTGCACCCAGCCCAGGG + Intergenic
1007082810 6:39120637-39120659 GAGCCACTGCACCCAGCCCAAGG + Intergenic
1007413553 6:41678992-41679014 TATCCCCAGCACCCAGCACAGGG + Intergenic
1007476740 6:42124304-42124326 CACCCACAGCACACAGAACAAGG + Intronic
1007656187 6:43452294-43452316 GAGCCACAGTACCCAGCCCAAGG - Intronic
1008282625 6:49614484-49614506 TAGCCACTGCGCCCAGCCCAGGG + Intronic
1009606693 6:65878801-65878823 ACCCCACAGAATCCAGCACATGG - Intergenic
1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG + Intergenic
1012561965 6:100593261-100593283 TACTGACAGCATCCAGCACATGG + Intronic
1012901530 6:105012181-105012203 GAGCCACCGCACCCAGCCCAAGG - Intronic
1013034426 6:106366731-106366753 TATGTAAAGCACCCAGCACAGGG + Intergenic
1013199128 6:107875146-107875168 AAGCCACTGCACCCAGCCCAAGG + Intronic
1013482280 6:110563059-110563081 TACCAACAACACCAAGGACAGGG - Intergenic
1015833948 6:137399150-137399172 TCCCGACAGCCCACAGCACAAGG + Intergenic
1015913415 6:138190748-138190770 CACACAAACCACCCAGCACATGG - Intronic
1017671380 6:156772428-156772450 TGCCCACAGCACCTAGCACAGGG + Intergenic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1018299683 6:162388292-162388314 TTCCCAAGACACCCAGCACAAGG + Intronic
1019091753 6:169541442-169541464 CAAGCACAGCACACAGCACAGGG + Intronic
1019197988 6:170293164-170293186 CACCCCCAGCCCCCAGCACAGGG - Intergenic
1019464994 7:1183002-1183024 GAACCACAGCACTCAGCACCCGG + Intergenic
1019656176 7:2197349-2197371 TATCCCCAGCACCCAGCACCAGG + Intronic
1019676557 7:2316880-2316902 TATTCTCAGCACCCAGCACAGGG - Intronic
1020028210 7:4914564-4914586 TACCCTCAGATACCAGCACAGGG + Intronic
1020096386 7:5371629-5371651 CCCACTCAGCACCCAGCACAAGG + Intronic
1020332949 7:7038794-7038816 TACCCACATTACTCAGCTCATGG - Intergenic
1021702536 7:23334049-23334071 GAACCACAGCACCCGGCTCATGG - Intronic
1022639829 7:32171127-32171149 TACCCACAGTTCCCAGGAGAGGG - Intronic
1023262532 7:38372567-38372589 TATCAAGAGCACACAGCACAAGG + Intergenic
1023347659 7:39287871-39287893 TATACGCAGCACCCAGCCCAGGG + Intronic
1023535743 7:41207386-41207408 TACTCACAGGTCCCAGAACAGGG - Intergenic
1023845276 7:44116831-44116853 CAGCCACAGCACCCAGAGCAGGG - Exonic
1023912897 7:44568022-44568044 CATCCCCAGCACCAAGCACAGGG + Intronic
1024217014 7:47256391-47256413 CACCCACAGCACCGAGGAGAGGG + Intergenic
1025809618 7:64867344-64867366 GAGCCACAGCGCCCAGCCCATGG + Intergenic
1026184951 7:68075261-68075283 TACCCACACCATCCAGAGCATGG + Intergenic
1026279131 7:68906049-68906071 GAGCCACCGCACCCAGCCCAAGG + Intergenic
1026503690 7:70964265-70964287 TACCCACAGTAGCAAGGACATGG + Intergenic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1028686358 7:93592575-93592597 TAAACACAGCATCTAGCACATGG - Intronic
1028798820 7:94937361-94937383 TATCCTCAGCACTGAGCACACGG + Intronic
1029512974 7:101008379-101008401 GAGCCACAGCACCCGGCCCAGGG + Intronic
1029748369 7:102529261-102529283 GAGCCACTGCACCCAGCCCAAGG + Intergenic
1029766316 7:102628348-102628370 GAGCCACTGCACCCAGCCCAAGG + Intronic
1030687509 7:112502462-112502484 TATCCCCAGCACTCTGCACAGGG - Intergenic
1033284298 7:140027142-140027164 GACACACAGCTCCCAGCACATGG + Intronic
1033364564 7:140661806-140661828 TACCGATAGCCCCCAGCACGGGG - Intronic
1033425446 7:141239631-141239653 ATCCCACGGCACCCACCACAGGG + Intronic
1033534871 7:142302918-142302940 TACCCCCAGCACCAAGGACTGGG + Intergenic
1033536997 7:142321361-142321383 TACCAACAGACCCCAGGACAGGG + Intergenic
1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG + Intergenic
1034385443 7:150737156-150737178 TGCCCTCAGCACCCATCACCGGG - Intronic
1035855569 8:2972909-2972931 TATCCACAGGTCCCATCACACGG - Intronic
1036778690 8:11631041-11631063 TATCCCCAGCTCCCAGCACCAGG + Intergenic
1037821126 8:22135026-22135048 CACCCCCAGCGCCCAGCACAGGG - Intergenic
1038316432 8:26488539-26488561 AACCCACAGAACCTAGCACAGGG + Intronic
1038502784 8:28059735-28059757 GAGCCACTGCACCCAGCCCAGGG - Intronic
1039565114 8:38545799-38545821 GAGCCACTGCACCCAGCATAGGG + Intergenic
1039769021 8:40664105-40664127 CACCCACAGTACCCAAAACAAGG - Intronic
1039804278 8:40985182-40985204 TGAGCACAGCAGCCAGCACACGG - Intergenic
1040275993 8:46013911-46013933 CACTCACCGGACCCAGCACAGGG + Intergenic
1041261335 8:56022825-56022847 TAGTCCCAGCACCCAGCACAGGG - Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042376200 8:68055712-68055734 TATCCACAACCCCCAGCACATGG + Intronic
1044237412 8:89847068-89847090 TATCCACAGAACCCACCACAAGG + Intergenic
1045035193 8:98170976-98170998 TATCCCCAGCACCTGGCACAGGG + Intergenic
1047247423 8:123157623-123157645 TGAACGCAGCACCCAGCACAGGG - Intergenic
1047306315 8:123655745-123655767 TACTCCTAGCACCCAGCACAGGG + Intergenic
1047755582 8:127915877-127915899 TACCCATGGCACACAGCACTTGG - Intergenic
1048285050 8:133135038-133135060 TTTCTCCAGCACCCAGCACAGGG - Intergenic
1048379702 8:133854400-133854422 TCCCCATAGCTCCCTGCACAGGG - Intergenic
1048619662 8:136118016-136118038 CACAGAAAGCACCCAGCACAAGG - Intergenic
1048630703 8:136239227-136239249 TACCGACAGGACCCAGCACGAGG - Intergenic
1048865837 8:138760900-138760922 GAGCCACAGCACAGAGCACAGGG + Intronic
1048982772 8:139711950-139711972 CCAGCACAGCACCCAGCACAGGG + Intergenic
1049495632 8:142930550-142930572 GACCCACCGCGCCCAGCCCAAGG + Intergenic
1049546641 8:143234883-143234905 TACCCACAGCCCCCTCAACATGG + Intergenic
1049704597 8:144035336-144035358 TACCAATAGCACCCAGCTCACGG + Intronic
1050369890 9:4910030-4910052 TTCCCACACCACAGAGCACAGGG + Intergenic
1050609625 9:7337927-7337949 AAACCACAGCATCCAGCAAAAGG + Intergenic
1051136239 9:13925038-13925060 GAGCCACAGCATCCAGCCCAAGG + Intergenic
1051280136 9:15434688-15434710 GAGCCACAGCACCCAGCCTATGG + Intronic
1051543341 9:18246037-18246059 TACCCACAGCAGCCGGTAGAGGG - Intergenic
1052990687 9:34517870-34517892 GACCCACAGCTCCCAGCTCAGGG - Intronic
1052999205 9:34568265-34568287 TGCCCACAGCCCACAGGACAAGG - Intronic
1053023178 9:34709566-34709588 TCCCCACAGAAACCAGCCCAGGG - Exonic
1053151447 9:35746153-35746175 TACCCTCAGGTCCAAGCACAGGG + Intronic
1053201177 9:36152463-36152485 GAGCCACCGCACCCAGCCCATGG - Intronic
1053229772 9:36398110-36398132 TAGTCACAGCATCCAGCATATGG - Intronic
1053312912 9:37030572-37030594 TGCCCCCAGCGCCTAGCACAGGG - Intronic
1054767115 9:69051364-69051386 GAGCCACTGCACCCAGCCCATGG + Intronic
1056708367 9:88970339-88970361 TACCCACAGCAGACAGCACCTGG - Intergenic
1057286882 9:93763983-93764005 TATCCACAGCGTGCAGCACAGGG - Intergenic
1057287010 9:93764806-93764828 TATCCACAGCGTGCAGCACAGGG + Intergenic
1057787360 9:98096912-98096934 GAGCCACTGCACCCAGCCCAGGG - Intronic
1057798891 9:98177281-98177303 CATCCACAGAGCCCAGCACAGGG - Intronic
1058310658 9:103497410-103497432 GACCCACAGGAACCAGCAGATGG - Intergenic
1059492155 9:114676930-114676952 TATCCTCAGCACTCAGCCCAGGG + Intergenic
1059585296 9:115599480-115599502 TACCCTCAGTGCCTAGCACAGGG - Intergenic
1060029807 9:120204627-120204649 TCCCCACAGCACCTGGCACAAGG + Intergenic
1060150530 9:121285463-121285485 TATCCCCAGCACTCAGCACAAGG + Intronic
1060371578 9:123078360-123078382 TAACCATAGTACCAAGCACATGG - Intronic
1060516363 9:124268356-124268378 CACCCCCAGTACCCAGCACCAGG - Intronic
1060527876 9:124330690-124330712 TATCCCCAGCACACAGCCCAGGG - Intronic
1060662304 9:125411450-125411472 AACCCAGTTCACCCAGCACATGG - Intergenic
1060680197 9:125555671-125555693 TATCCTGAGCACCCAGCACAGGG - Intronic
1060774636 9:126364009-126364031 TACCCCCAGTACCCAGCACAGGG + Intronic
1061053977 9:128212086-128212108 CACATAAAGCACCCAGCACATGG + Intronic
1061481685 9:130900581-130900603 GACACACAGAACCCAGAACAAGG - Intergenic
1061637190 9:131919653-131919675 TGCACACAGTGCCCAGCACAGGG + Intronic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1061963970 9:134003014-134003036 TCCTCCCAGCACCCAGAACAGGG + Intergenic
1062100399 9:134725038-134725060 GACCCAGAGCACTCAGCACCTGG + Intronic
1062456169 9:136640221-136640243 TAGCCACCGCACCCAGCCCTGGG + Intergenic
1203360710 Un_KI270442v1:217798-217820 GACCCACCGCACCCAACCCACGG + Intergenic
1188295690 X:28445592-28445614 AAGCCACCGCACCCAGCCCAAGG - Intergenic
1188426511 X:30053392-30053414 GAGCCACCGCACCCAGCCCAGGG + Intergenic
1188614680 X:32143129-32143151 TGTCCTCAGCACCCACCACAAGG + Intronic
1189123234 X:38417604-38417626 TACATACAGCACTCAGCACCGGG + Intronic
1190449588 X:50565278-50565300 TATCCCCAGCACCTAGCACAGGG + Intergenic
1190568359 X:51754847-51754869 TACCCACAGTGGCTAGCACAGGG + Intergenic
1190797937 X:53761187-53761209 ACACCCCAGCACCCAGCACAGGG + Intergenic
1190917222 X:54820023-54820045 ACACCCCAGCACCCAGCACAGGG - Intergenic
1190931036 X:54949970-54949992 ACACCCCAGCACCCAGCACAGGG - Intronic
1192036274 X:67566249-67566271 TAGCCTCAGAATCCAGCACAGGG - Intronic
1192437301 X:71150913-71150935 TCCCAACAACACCTAGCACATGG - Intronic
1192534712 X:71917520-71917542 TACCCCCAGAAATCAGCACAGGG - Intergenic
1192588397 X:72339294-72339316 TGACCCCAGCACCCAGCACAGGG - Intronic
1194141700 X:90217362-90217384 CACCCACAGCATCACGCACAGGG - Intergenic
1194585448 X:95727948-95727970 TATCCACAGTACCCAGGAGATGG - Intergenic
1194981964 X:100450263-100450285 TACCCAGAACACAGAGCACATGG + Intergenic
1195897398 X:109760697-109760719 CATCCACAGGAACCAGCACAGGG + Intergenic
1196090458 X:111735887-111735909 TTTCCACAGCACCCAGTACAGGG - Intronic
1196166136 X:112537131-112537153 TACTCACAGCACTTAGCATAAGG + Intergenic
1196645380 X:118112274-118112296 TATTCTGAGCACCCAGCACATGG - Intronic
1196854814 X:119972853-119972875 TACCCAGAGCCCCCAGCGCCTGG - Intergenic
1196857271 X:119995897-119995919 TACCCAGAGCCCCCAGCGCCTGG - Intergenic
1198050666 X:132950240-132950262 TAACCCCAGCACATAGCACAGGG + Intronic
1198252571 X:134894853-134894875 TATCCTCAGCACCTAGCACAGGG - Intronic
1198387177 X:136140463-136140485 TACCTAGTGCACCAAGCACAGGG + Intergenic
1198997514 X:142590862-142590884 GATCCACAGCACCTAGAACATGG + Intergenic
1199818127 X:151418561-151418583 TACCCCCAGCACATGGCACATGG - Intergenic
1199834406 X:151574318-151574340 TGTCTGCAGCACCCAGCACAGGG - Intronic
1200000754 X:153058700-153058722 GAGCCACTGCATCCAGCACATGG + Intronic
1200487452 Y:3786464-3786486 CACCCACAGCATCACGCACAGGG - Intergenic
1201077716 Y:10199729-10199751 GGCCCACAGCACCCAACCCACGG - Intergenic
1202054452 Y:20814971-20814993 TACCCAAAACACCCAGAAAATGG + Intergenic