ID: 1085345782

View in Genome Browser
Species Human (GRCh38)
Location 11:75767518-75767540
Sequence CTGTAGGTCAGGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085345782_1085345792 11 Left 1085345782 11:75767518-75767540 CCCACTGCCCTCCTGACCTACAG 0: 1
1: 0
2: 2
3: 25
4: 316
Right 1085345792 11:75767552-75767574 CATTTCCCATACCATGGCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 93
1085345782_1085345790 5 Left 1085345782 11:75767518-75767540 CCCACTGCCCTCCTGACCTACAG 0: 1
1: 0
2: 2
3: 25
4: 316
Right 1085345790 11:75767546-75767568 CCTGTCCATTTCCCATACCATGG 0: 1
1: 0
2: 2
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085345782 Original CRISPR CTGTAGGTCAGGAGGGCAGT GGG (reversed) Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900790829 1:4679289-4679311 CTGAACTCCAGGAGGGCAGTGGG + Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
902157962 1:14505014-14505036 GTGTAGCTCAGGAGGGAACTAGG + Intergenic
902288495 1:15421808-15421830 GATTAGGTCAGGAGGGCTGTTGG - Intronic
902375206 1:16027199-16027221 CTGTAGGACAGCAGGACAGATGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
902910064 1:19589332-19589354 ATGTAAGTCAGGAGGGCGATAGG - Intergenic
903869796 1:26425643-26425665 CAGTAGGTGAGGAGGCCACTGGG + Intronic
904850412 1:33455020-33455042 CTGGGGGTCAGCAAGGCAGTGGG + Intergenic
905824475 1:41018072-41018094 GTGTAGGCCAGGTGGGCAGCGGG + Exonic
906315437 1:44784156-44784178 CGGGAGGGAAGGAGGGCAGTGGG + Exonic
906712646 1:47942567-47942589 CTTCTGATCAGGAGGGCAGTAGG - Intronic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
909990102 1:82212925-82212947 CTGTAGGTCAGTACATCAGTTGG + Intergenic
910487921 1:87736296-87736318 CAGTTGGTCAGGTGGTCAGTGGG - Intergenic
911093727 1:94038759-94038781 CTGTAGGTCAGCAGGGCTTTGGG + Intronic
912382805 1:109256397-109256419 CTGGAGGGTAGGTGGGCAGTCGG + Intronic
912655802 1:111485496-111485518 GTGTAGGTCAGGAAGGAAGGAGG - Intronic
915492153 1:156256760-156256782 CTGTAGGCCAAGTGGGCACTAGG - Intronic
916599437 1:166277338-166277360 CTGTATGCCTGGGGGGCAGTTGG + Intergenic
916795744 1:168165559-168165581 GTCTAGCTCAGGAGGGCTGTAGG - Intergenic
918171740 1:182004106-182004128 CTGCAGGTCACCAGGGAAGTGGG - Intergenic
919607755 1:199706776-199706798 CTGTAAGTCAGCAGGTCAGAAGG + Intergenic
919607757 1:199706784-199706806 CAGCAGGTCAGAAGGGCAGAAGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919932889 1:202233014-202233036 CTGGAGGTCAGCATGGCAGTCGG - Intronic
920535733 1:206735505-206735527 CTGTAGGTCAGGAGTGTGATAGG + Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922795304 1:228336813-228336835 CGGCAGGGCAGGAGGCCAGTGGG - Intronic
1066457615 10:35585562-35585584 CTGCAGGTCAGCAGCGCAGCAGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067130104 10:43556244-43556266 TTTTAGGCCAAGAGGGCAGTTGG - Intergenic
1067361556 10:45585079-45585101 CTATAGGTCAGAAATGCAGTAGG - Intronic
1067432743 10:46254588-46254610 CTATAGGTTAGGAGGCCAGGGGG - Intergenic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070532211 10:77346906-77346928 TTCTTGGTCAGCAGGGCAGTCGG - Intronic
1070595803 10:77832371-77832393 AAGTAGGTCAGGAGCCCAGTGGG - Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1073059810 10:100726685-100726707 GTGTAGGTTAGGGAGGCAGTAGG + Intergenic
1073353190 10:102834228-102834250 CTGAAGGTCAGGGGTGGAGTAGG - Intronic
1073443271 10:103565178-103565200 GGGCAGGTCAGGAGGGCAGCTGG + Intronic
1073498380 10:103914928-103914950 CAGTTGGTCAGAAGTGCAGTTGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1078617924 11:12882100-12882122 CTGTAGCTCAGGAGGGCCACAGG + Intronic
1078670959 11:13364633-13364655 TTGTATGTCTGGAAGGCAGTGGG + Intronic
1080883268 11:36342318-36342340 CTGGAGATCAGTAGGGCAGACGG + Intronic
1081030458 11:38074334-38074356 CTTTCGATCAGGAGGACAGTAGG - Intergenic
1081443888 11:43110785-43110807 GTGCAGGTCAAGAGGGAAGTGGG - Intergenic
1082787759 11:57326252-57326274 GTGTATGTCACTAGGGCAGTGGG - Exonic
1083697181 11:64450592-64450614 CTGGTGGTCAGGAGGGGAGGTGG - Exonic
1084115871 11:67042730-67042752 CAGGAGGTCAGGAGGCCAGGTGG + Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084457614 11:69277607-69277629 ATGCAGGGCAGGTGGGCAGTAGG + Intergenic
1084586454 11:70065507-70065529 CTTCAGGCCAGGAGGGCACTGGG - Intergenic
1085047698 11:73363039-73363061 CTGTCGGTGAGCAGGGCAGCAGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087199611 11:95332461-95332483 GGTTAGGTCAGGAGAGCAGTTGG + Intergenic
1088656618 11:112005921-112005943 CTTGAGGTCAGGAGGACAGTGGG + Intronic
1088888795 11:114028824-114028846 CTGGATGTAAGGAGGACAGTGGG - Intergenic
1088938881 11:114433969-114433991 CTGTCACTCAGGAGTGCAGTGGG + Intronic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1091151949 11:133337313-133337335 CTGTAGGTGAGTGGGCCAGTGGG - Intronic
1091546976 12:1507745-1507767 GGGTACGGCAGGAGGGCAGTGGG + Intergenic
1091584883 12:1810438-1810460 CTGCAGGGAAGGAGGGCATTTGG + Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1092162518 12:6323894-6323916 CTGTTGCTCAGGAAGTCAGTGGG + Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099243970 12:80172518-80172540 CTGCAGGTCAGGAGGGCAATGGG + Intergenic
1102488792 12:113276485-113276507 TCGGAGGTCAGGAGGGCAGTGGG + Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1104843620 12:131835974-131835996 CTGGAGGTCAGGGCGGAAGTGGG + Intronic
1105451248 13:20502262-20502284 CTGTCGCACAGGAGGGCTGTGGG + Intronic
1106174652 13:27319732-27319754 CTGCAGATTAGGTGGGCAGTGGG + Intergenic
1107721995 13:43258875-43258897 CTGTAGGTCAGTATCACAGTGGG - Intronic
1108465862 13:50714887-50714909 CTGTAGGTTAGAAGTCCAGTGGG + Intronic
1108576585 13:51796451-51796473 ATGGAGGTGAGGGGGGCAGTAGG + Intronic
1108663363 13:52605990-52606012 CTGCAGGCCAGGACTGCAGTGGG - Intergenic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1112131661 13:96531559-96531581 GTGCAGGTCAGCAGGGCAGAGGG + Intronic
1113816588 13:113175916-113175938 CTGGAGCTCAGCAGGGCTGTGGG - Intergenic
1113865118 13:113516844-113516866 CTGGAGGTCAGAATGGCAGCTGG + Intronic
1114653493 14:24301717-24301739 TTGCAGGTAAGGAGGGAAGTAGG + Exonic
1115694404 14:35881232-35881254 CTGTATGCCTGGGGGGCAGTTGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118154804 14:63229363-63229385 CTGTAGGTCAGAAGTCCAGCAGG + Intronic
1118258934 14:64229684-64229706 CTGAAGGTCACGTGGGGAGTAGG - Intronic
1118294070 14:64552587-64552609 CTGGAGGTCAGGAAAGGAGTTGG + Intronic
1118581164 14:67299696-67299718 ATATAGGTTAGTAGGGCAGTGGG + Intronic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1120118404 14:80648186-80648208 CTCTGAGTCAGGAGAGCAGTTGG + Intronic
1120280924 14:82436812-82436834 CTGTAGGTCATGAGTCCAGGTGG - Intergenic
1120715216 14:87834210-87834232 CTTGAGGTCAGGAGGCCAGGAGG + Intergenic
1122216144 14:100205963-100205985 CTGGAGGTCAGGGCTGCAGTGGG - Intergenic
1122393376 14:101406169-101406191 GTGCAGGTCAGGAGGTCAGGAGG + Intergenic
1122635831 14:103129214-103129236 CTGCAGGGCTGGAGCGCAGTGGG + Intronic
1125116077 15:36093397-36093419 CTGGAAGGCAGGAGGCCAGTTGG - Intergenic
1125902503 15:43361780-43361802 CTGTAGATCAGGAAGACAGTGGG - Exonic
1126955330 15:53927338-53927360 CTGTAGGCAAGGAGAACAGTTGG + Intergenic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128730234 15:70015811-70015833 CTGGGGGTCAGGAGGGCTGCGGG - Intergenic
1129882666 15:79017451-79017473 CTGTAGGTCTGCAGGATAGTGGG + Intronic
1130883943 15:88077966-88077988 CTGTAGCCCAGGAGGCCTGTGGG - Intronic
1131636342 15:94236833-94236855 TTGTAGATCAGGAGGGAGGTAGG + Intronic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1133282849 16:4676968-4676990 CTGCAGGACAGGATGGCAGGCGG - Intronic
1133398056 16:5464232-5464254 CTGGTGCTCAGGAGAGCAGTTGG + Intergenic
1133812612 16:9172569-9172591 CAGTAGGTCATGGGGGGAGTGGG - Intergenic
1136235297 16:28910198-28910220 CAGGAGGGTAGGAGGGCAGTAGG - Intronic
1136235299 16:28910206-28910228 GTGTAGGGCAGGAGGGTAGGAGG - Intronic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1136399434 16:30009841-30009863 AGGTAGGGGAGGAGGGCAGTGGG - Intronic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137546754 16:49410160-49410182 CTGTGGGTCAGGAACACAGTGGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137741393 16:50779557-50779579 AGGGAGGTCAGGTGGGCAGTTGG + Intronic
1137753759 16:50885667-50885689 TCATAGGTCAGGAGGCCAGTAGG - Intergenic
1138031638 16:53563910-53563932 GTGGAGATCAGGAAGGCAGTGGG - Intergenic
1138452074 16:57099130-57099152 CTGGAAGTCAGGATAGCAGTAGG - Intronic
1139187376 16:64822838-64822860 CTGTAGGTCAGAAGTCCAGGTGG + Intergenic
1139922885 16:70470852-70470874 CTGCAGGGCAGGGGAGCAGTAGG + Intronic
1140063946 16:71594121-71594143 CTTTAGGTCTAGAGGGCAGGAGG - Intergenic
1140252468 16:73306143-73306165 CTCTAGGGCAGGAGAACAGTAGG - Intergenic
1141312717 16:82930778-82930800 CCCTAGGTGAGAAGGGCAGTGGG + Intronic
1141401242 16:83748896-83748918 CTGTAGGGCACAAGGGCAGAAGG + Intronic
1141832991 16:86520047-86520069 ATGTAGGTCATGAGGACAGGAGG + Intergenic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146594262 17:34155835-34155857 CTGAAGGCCACGAGGGTAGTTGG - Intronic
1147955793 17:44133664-44133686 CTCTAGGCCAGGAAGGCAGGAGG - Intergenic
1148343507 17:46888234-46888256 GTGTGGGTCAGGTGGGGAGTTGG + Intergenic
1149541730 17:57472585-57472607 CTCAAGGTCATGAGGCCAGTTGG - Intronic
1149999420 17:61424349-61424371 CAGTAGGTCAGGATGGAACTTGG - Intergenic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1151035863 17:70798719-70798741 ATGTAAGTCAGCAGGGCAGTGGG - Intergenic
1151458755 17:74242239-74242261 CTGGAGGTCTGCAGGGCTGTAGG + Intronic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1152526069 17:80888966-80888988 CAAGAGGCCAGGAGGGCAGTGGG + Intronic
1152626057 17:81388449-81388471 CTGGAGGGCAGGTGGGCGGTGGG + Intergenic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1154151695 18:11911083-11911105 CTGTAGGTCAGGAGCCCACACGG - Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1157385116 18:47253821-47253843 CTGTAGGGTGGGAGGGCACTGGG - Intergenic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1160378568 18:78431649-78431671 CTCTAGGTCTGGAAAGCAGTGGG - Intergenic
1160707160 19:535060-535082 CTGTGGCCCAGGAGGGCCGTGGG + Intronic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1162885265 19:13692373-13692395 CTGTGACTCAGGAGGGCAGGTGG + Intergenic
1164543567 19:29140575-29140597 CTGTAGGTCCTGAGGCCTGTTGG - Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165620090 19:37238702-37238724 GTGCAGGTCAGGATGGGAGTTGG + Intronic
1165854407 19:38870993-38871015 CTGGAAGTGAGGAGGGCATTCGG + Intronic
1166000842 19:39876641-39876663 CTACAGGTGAGGAGGGCTGTGGG - Exonic
1166003623 19:39892894-39892916 CTACAGGTGAGGAGGGCTGTGGG - Exonic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
1167736663 19:51298579-51298601 CTGTAGGGCAGGCAGGCAGGAGG + Intergenic
925977487 2:9151199-9151221 CTGTGGGTCAGGAACGCGGTGGG - Intergenic
926297595 2:11579874-11579896 CTGGAGTCCAGGAGAGCAGTCGG - Intronic
927013920 2:18935798-18935820 CAGTAGGTCAGTAGGGTACTGGG + Intergenic
927022523 2:19031949-19031971 CAGTAGCTCAGGAAGGCAATAGG + Intergenic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929599035 2:43193600-43193622 ATGAAGGTCAGCAGGTCAGTGGG - Intergenic
929599832 2:43198158-43198180 CTGAAGGCCAGGCTGGCAGTGGG + Intergenic
931140250 2:59449701-59449723 TTGTATGTCAAGAGGGCAGAAGG - Intergenic
931228169 2:60351792-60351814 AAGCAGGTGAGGAGGGCAGTCGG - Intergenic
931847853 2:66222801-66222823 CTCCAGGTAAGGATGGCAGTGGG + Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
933586230 2:84182198-84182220 CTGTAGGTCAGAAGTCCAGCTGG - Intergenic
934139464 2:89031663-89031685 ATATAGGTCAGGTGGGCAGAGGG + Intergenic
936501752 2:113072304-113072326 CTGTTGGCCAACAGGGCAGTGGG + Exonic
936688983 2:114863536-114863558 TTGTTGGTCAGGATGGCAATTGG - Intronic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
936755394 2:115703536-115703558 CTGTCGGGCAGGTTGGCAGTTGG + Intronic
936893781 2:117403817-117403839 CTCTAGGGCAGGAGAGTAGTTGG + Intergenic
937229671 2:120390344-120390366 CTGCAGGTCAGGAGCACAGAGGG + Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
940597105 2:155808762-155808784 CTGTAATTCAGATGGGCAGTGGG + Intergenic
943230203 2:185241340-185241362 GTGTAGGTTAGGAGGTAAGTGGG + Intergenic
944863497 2:203838383-203838405 CAGTAAGTCAAGAGTGCAGTTGG - Intergenic
944923062 2:204435624-204435646 CTGGAGGGCAGCAGGGGAGTGGG - Intergenic
946037250 2:216754086-216754108 CTCTAGGTCAGGAAGGAAGGGGG - Intergenic
946967726 2:225055642-225055664 CCCTAGGTCAGAAGGGCAGTGGG - Intergenic
947908960 2:233789408-233789430 GTGTAGGGAAGGAGGACAGTGGG + Intronic
1170114580 20:12843583-12843605 CCTTAGGTCAGGAGTTCAGTTGG + Intergenic
1170613165 20:17930089-17930111 TGGGAGGTCAGGAGGGCAGGTGG - Intergenic
1171177259 20:23061715-23061737 CTGCAGGAAAGAAGGGCAGTGGG + Intergenic
1172115933 20:32573726-32573748 CTGCAGGTCAGCAGAGCAGTGGG - Intronic
1174517447 20:51103420-51103442 CTGTAGGTCAGAAGTCCAGGAGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175809343 20:61849426-61849448 CTGTAGGTCAGAAGTCCAGATGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176239300 20:64068534-64068556 ATGCAGGGCAGGAGGGGAGTTGG - Intronic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1178924408 21:36762797-36762819 CTGGAGGCCAGGATGGAAGTGGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179979153 21:44887522-44887544 GTGCAGGTCAGGATGGCAGGAGG - Intronic
1179979173 21:44887602-44887624 GTGCAGGTCAGGATGGCAGGAGG - Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1182290794 22:29278041-29278063 CTGTATGCCTGGGGGGCAGTTGG - Exonic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183786014 22:40029667-40029689 CTGCAGGGCAGAAGGCCAGTTGG - Exonic
1184831218 22:46989571-46989593 CTGCCGGTCAGCGGGGCAGTTGG + Intronic
1184879162 22:47294254-47294276 CTGTAGGTCAGAAGTCCAGCAGG - Intergenic
950340923 3:12243674-12243696 CTGGGGGTTAGGAGGGCTGTAGG + Intergenic
952334546 3:32392685-32392707 CTGGAGGGCAGGGGGTCAGTTGG + Intronic
953432347 3:42850552-42850574 CTGTGTGTCAAGGGGGCAGTGGG + Intronic
953462842 3:43095361-43095383 CTGTAAGCCCAGAGGGCAGTGGG - Intronic
959503245 3:107130913-107130935 CTGGAGGTCAGAAAGGAAGTGGG + Intergenic
959592664 3:108097090-108097112 CTGTAGGTCAGAAGTCCAGTAGG + Intergenic
960898804 3:122533411-122533433 CTGCAGGTCAGGAGAGAGGTAGG + Intronic
962369042 3:134805535-134805557 CTGCTGGGCAGGAGGGCAGGAGG - Intronic
962719694 3:138160886-138160908 CTGTCGTTCAGGAGTGCAGTGGG - Intergenic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
963935403 3:151047060-151047082 CTGTAGGTCAGAAGTCCAGTGGG - Intergenic
964400189 3:156290599-156290621 CTCCAGGTCAGGTGGGCAGTAGG - Intronic
966621178 3:181965945-181965967 CTGGAGGTCAGGAAGCCAGCAGG + Intergenic
966855868 3:184193517-184193539 CTGAAAGACAGGAGGGCAGGAGG - Intronic
968699023 4:2046099-2046121 CTGGAGTGCAGGTGGGCAGTGGG - Intergenic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969476980 4:7427413-7427435 CTGAAGCTCAGGAGTGAAGTCGG - Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969890660 4:10256834-10256856 CTCAAGGTCAGGAAGTCAGTTGG - Intergenic
971385851 4:26139936-26139958 CTGTAGGTCATGAGAGGGGTGGG + Intergenic
975740160 4:77421990-77422012 CTGTTGCACAGTAGGGCAGTAGG - Intronic
976052550 4:81026304-81026326 CTGTAGGTTAGAAGTTCAGTGGG - Intergenic
976973393 4:91136483-91136505 TTGTAGGTCAGGATGGGAGATGG - Intronic
977651753 4:99478113-99478135 CTCTAGGTCAGCAGAGCATTAGG - Intergenic
978327515 4:107576055-107576077 GCGTTAGTCAGGAGGGCAGTTGG + Intergenic
979271659 4:118769511-118769533 CTGAAGAGCAGGAGGTCAGTGGG + Intronic
979607073 4:122650015-122650037 CTGTAAGTAAGTAGGACAGTTGG - Intergenic
981887523 4:149694494-149694516 ATGAAGGTCAGGAGAACAGTGGG - Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
983749143 4:171242665-171242687 ATTTAGGGCAGGAGGGTAGTGGG + Intergenic
983880408 4:172925803-172925825 CTGTAGGTCAGGAGTCCATGAGG - Intronic
984717272 4:182937499-182937521 CTGCAGGACACGAGGGCAGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987275084 5:16353959-16353981 CTGTTGCCCAGGAGTGCAGTGGG - Intergenic
987562139 5:19538264-19538286 CTGTAGGTCAGAAGTCCAGGTGG - Intronic
988913580 5:35870295-35870317 CTGCAAGGCAGGAAGGCAGTAGG + Intronic
990123407 5:52484193-52484215 CTGTAGGTCAGAAATGCAGGAGG - Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992050566 5:72936706-72936728 CTGTAGGCCAGGAGCTCAGCTGG + Intergenic
993405110 5:87501915-87501937 TTGTATGTCATGAGGTCAGTAGG - Intergenic
993785472 5:92128876-92128898 ATGTTGGCCAAGAGGGCAGTTGG - Intergenic
995814911 5:116157349-116157371 CTGTAGGTGGGCAAGGCAGTTGG + Intronic
997587096 5:135049872-135049894 GTGTCTGTCAGGAGAGCAGTGGG + Intronic
997676878 5:135719791-135719813 CTGGACTGCAGGAGGGCAGTGGG - Intergenic
998040604 5:138948798-138948820 GCCTAGGTCAGGAGGGCAGCGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999648556 5:153743331-153743353 CTATAGGTCAGAAGTCCAGTAGG + Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001085153 5:168695176-168695198 CTTTATGTCAGGAGTGAAGTGGG - Intronic
1001270868 5:170310739-170310761 CTGGGGGTAACGAGGGCAGTGGG + Intergenic
1002203144 5:177543028-177543050 CTGGAGGTCAGGTGGACAGATGG - Intronic
1002972820 6:2041671-2041693 GTGGAGGTCAGGAGTGCAGTAGG + Intronic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1003979517 6:11376906-11376928 CTGAAGCTCAGCAGGGCAGTAGG - Intronic
1005575805 6:27188181-27188203 CTGCAGGTAAGCAGGGCACTTGG + Intergenic
1005923269 6:30418759-30418781 CTGTAGGTGAGGAGGGCCTGGGG + Intergenic
1006366830 6:33621135-33621157 CTGGAGATCAGGAGGGCTGGCGG + Exonic
1010711346 6:79178632-79178654 CTGAAGGTTAGGATGGCTGTGGG - Intergenic
1011106362 6:83786087-83786109 CTGAAAGTCTGGAGGGCATTTGG + Intergenic
1013623080 6:111909246-111909268 CTGAAAGGCAGGAGGGCAGAAGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016302443 6:142647292-142647314 CTATGGCTCAGGAGGGCATTTGG + Intergenic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1017790709 6:157796411-157796433 CTGTTGGTCAGCAAGGCAGTGGG + Intronic
1018825619 6:167406133-167406155 GTGTCAGGCAGGAGGGCAGTGGG + Intergenic
1019117349 6:169775631-169775653 CTGAAGCTCAGGAGAGAAGTAGG + Intronic
1019194318 6:170272359-170272381 CTGGAGGACAGGGGGGCTGTCGG + Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1028087462 7:86653976-86653998 CTGCAGATCTAGAGGGCAGTGGG - Intronic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1030251189 7:107446934-107446956 CTGTAGGTTAGAAGTCCAGTGGG + Intronic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031995505 7:128227810-128227832 CTGTAGGGGAGGAAGGCTGTTGG - Intergenic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1040587536 8:48757548-48757570 CTGTAGGTAAGGAGTGGGGTAGG + Intergenic
1043511068 8:80950647-80950669 CTGGAGGCCAGGAGGGCGGCAGG + Intergenic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1045201082 8:99982217-99982239 CTTTAGGTCAAGAAGGCAGTGGG + Intronic
1045517390 8:102872170-102872192 CTGTAGGTCAGAAGTTCAGGAGG - Intronic
1045743621 8:105390206-105390228 CTGTTAGTCAGAAGTGCAGTTGG - Intronic
1047303198 8:123632689-123632711 ATGGAGGTCAGGAGACCAGTTGG - Intergenic
1047348279 8:124049431-124049453 CCGTAGGTCTGGGGAGCAGTGGG - Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047480776 8:125280929-125280951 CTGTAGGTTTGTAGGGCAGCAGG - Intronic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048845771 8:138602609-138602631 CTGCAGGCCAGGTGGGAAGTAGG - Intronic
1048958722 8:139558044-139558066 CTGGAGGGCAGTAGGGCAATTGG + Intergenic
1049393679 8:142385854-142385876 CTGTAGGTCAGAAGTCCAGCTGG + Intronic
1050019665 9:1269787-1269809 CTTGAGAACAGGAGGGCAGTGGG + Intergenic
1052991152 9:34520149-34520171 CTTCAGGTCAGGTTGGCAGTGGG - Intronic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053366088 9:37523477-37523499 CTGGAGGTCAGGGCTGCAGTGGG + Intronic
1053446200 9:38154977-38154999 CTGGAGGTCAGGGGCCCAGTCGG + Intergenic
1054815974 9:69475945-69475967 ATGTGGGTCAGGAGCGCTGTAGG + Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1056570458 9:87810186-87810208 CTGTAGGTCAGAAGTCCAGTCGG - Intergenic
1057210165 9:93196779-93196801 CTGTTGGTCAGGAGGGGTGGCGG + Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1059798963 9:117730472-117730494 TTGAAGGCCACGAGGGCAGTTGG - Intergenic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061248644 9:129414118-129414140 CTGTAGGCCAGGAGAGGAGGGGG + Intergenic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1062137722 9:134938509-134938531 CTGGAGGGCAGGAGGGCAACAGG - Intergenic
1186665646 X:11714185-11714207 CTGTTGTTCAGGAGGAGAGTTGG + Intergenic
1186859734 X:13660449-13660471 GGGTAGGGCAGAAGGGCAGTGGG - Intronic
1190360268 X:49642670-49642692 CTGTAAGTCAGTAGTTCAGTTGG - Intergenic
1190874431 X:54449587-54449609 CTAAAGGTCAGGTGGGCATTTGG + Intronic
1191898108 X:66014922-66014944 CTGTATGCCAGGAGAGAAGTTGG + Intergenic
1192326792 X:70139488-70139510 CTGAAGGTCAGGAGGGGTCTGGG - Intronic
1192511058 X:71720605-71720627 CGGTAGCTTAGGAGGGCTGTGGG + Intergenic
1192515639 X:71760948-71760970 CGGTAGCTTAGGAGGGCTGTGGG - Intergenic
1192528847 X:71869702-71869724 CGGTAGCTTAGGAGGGCTGTGGG - Intergenic
1195954131 X:110310839-110310861 CTTAAGGTTATGAGGGCAGTAGG - Intronic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic