ID: 1085346186

View in Genome Browser
Species Human (GRCh38)
Location 11:75769356-75769378
Sequence CCACTGCGGCTGGTGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085346172_1085346186 25 Left 1085346172 11:75769308-75769330 CCCACCATTCTTAGTTATTAGGG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 192
1085346170_1085346186 28 Left 1085346170 11:75769305-75769327 CCACCCACCATTCTTAGTTATTA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 192
1085346174_1085346186 24 Left 1085346174 11:75769309-75769331 CCACCATTCTTAGTTATTAGGGA 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 192
1085346175_1085346186 21 Left 1085346175 11:75769312-75769334 CCATTCTTAGTTATTAGGGATAT 0: 1
1: 0
2: 2
3: 19
4: 202
Right 1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085346186 Original CRISPR CCACTGCGGCTGGTGACCCC TGG Intronic
900186894 1:1336933-1336955 CCACTGCGTCTTGGGAGCCCAGG - Intronic
901142526 1:7044320-7044342 GCAGTGCCGCTGGGGACCCCGGG + Intronic
901280466 1:8030073-8030095 CCACCGCGCCTGGTGAACTCTGG + Intergenic
902821681 1:18947287-18947309 CCTCTGCTGCTGGTGATCCGTGG + Intronic
902943444 1:19816553-19816575 CCTTTGGGGCTGGTGACTCCAGG - Intergenic
903213152 1:21829725-21829747 CCACTGCAGCTGGTGCCAACTGG - Intronic
905951838 1:41958547-41958569 CCCCTGCAGCTTGTGACCCCCGG - Intronic
910968344 1:92830313-92830335 CCAGTGCAGTTGGTGACACCAGG - Intergenic
914875603 1:151511226-151511248 CCTTCGCGGCTGGAGACCCCGGG + Intronic
914982864 1:152430710-152430732 CCACTGTGGCTGCTGAGGCCTGG - Intergenic
915727552 1:158028573-158028595 CCACTGAGGCTGGAAAGCCCAGG + Intronic
916660781 1:166920954-166920976 CCACCGCGGCTGGCGCCCTCGGG + Exonic
920576600 1:207065423-207065445 CCACTGCAACTGCTGCCCCCGGG + Intronic
921229988 1:213059956-213059978 CCACTGCGCCTGGCCACACCCGG + Intronic
1063036254 10:2289383-2289405 CGACTGCTGCTGGTGACCCAGGG - Intergenic
1064071100 10:12228855-12228877 CCACTGCGCCTGGCCACGCCTGG + Intronic
1065435535 10:25701237-25701259 TCACTGCAGCTTCTGACCCCTGG + Intergenic
1067293312 10:44959777-44959799 CCGCAGCGCCTGCTGACCCCAGG - Exonic
1070935144 10:80288258-80288280 CCACTGCTCTTGGAGACCCCTGG - Intronic
1072732670 10:97858144-97858166 CCCCTGCTACTGGTAACCCCTGG + Intronic
1076346301 10:129781074-129781096 CCCCAGCTGCTGGTGACTCCAGG - Intergenic
1076625027 10:131816420-131816442 CAACAGCAGCTGGTCACCCCCGG + Intergenic
1081218948 11:40436840-40436862 CAACTGAGGCTGGAGACCTCTGG + Intronic
1085346186 11:75769356-75769378 CCACTGCGGCTGGTGACCCCTGG + Intronic
1085574369 11:77589544-77589566 CCCCTGCGGGCGGTGACACCCGG - Intronic
1086305896 11:85481818-85481840 CCACTGTGGATGGAGACTCCAGG + Intronic
1089874145 11:121703889-121703911 CCACTGCTGCTGCTGATACCTGG - Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1096469706 12:51868631-51868653 CCCATGCTGCTGGAGACCCCAGG + Intergenic
1096622681 12:52874318-52874340 CCACGGCGGCCGGGGGCCCCAGG + Intergenic
1101031943 12:100669113-100669135 CCACTGCTGCTGGCGCCACCTGG - Intergenic
1101211964 12:102543660-102543682 ACAATGAGGCTGGTGCCCCCTGG + Intergenic
1101412186 12:104478779-104478801 CCACTGCTGCTGATGGCCACAGG - Intronic
1102258545 12:111429843-111429865 CCCCTGCCCCTGGTGCCCCCCGG - Intronic
1103736671 12:123065078-123065100 CCACAGCCGCTGGAGGCCCCTGG + Intronic
1104171104 12:126281624-126281646 CCACTGTGACTGCTGAGCCCTGG - Intergenic
1105705595 13:22965869-22965891 CCCCTGGGGCTGGGGTCCCCTGG + Intergenic
1107663633 13:42665615-42665637 CCACTGTGACTGGAGACCCCTGG - Intergenic
1107987347 13:45786822-45786844 GCACTGGGACTGGTGGCCCCAGG - Intronic
1112542961 13:100335657-100335679 CAACTGTGCCTGGTGTCCCCTGG - Intronic
1113416219 13:110130738-110130760 GCCCTGAGGCTGGTGACCCCTGG - Intergenic
1120020616 14:79525954-79525976 TCACTGCAGCTTCTGACCCCTGG + Intronic
1120924260 14:89782193-89782215 ACACTGAGGCTGGAGACCCCTGG - Intergenic
1121308946 14:92924350-92924372 GCACTGCGGCTGCTGAGCCTGGG + Intronic
1121799649 14:96764021-96764043 CCACAGGGGCTGGGGACCCCTGG - Intergenic
1122797299 14:104212460-104212482 CCACGGCGGCTGGAGAGCGCAGG + Intergenic
1125609102 15:40958848-40958870 CCACCGCGGCTGGGGTCCTCAGG - Intergenic
1126037115 15:44556797-44556819 CCACTGCGTCTGGCCACACCTGG + Intronic
1128083815 15:64872536-64872558 CCACTGCACCTGGCTACCCCTGG - Intronic
1128495837 15:68198037-68198059 CGACTGAGGCTTGAGACCCCAGG - Intronic
1128549614 15:68589954-68589976 CCACAGTGGCCCGTGACCCCCGG + Intronic
1129029073 15:72605468-72605490 CTACTGGGGCAGGTGACTCCTGG + Intergenic
1130985196 15:88840216-88840238 CCCCTGTGGCTGCTGACTCCTGG - Intronic
1131150547 15:90044855-90044877 CCACAGTGACTGGTGGCCCCTGG - Intronic
1132497153 16:269290-269312 CCACAGCGGCTTGTGGCCCTGGG - Exonic
1132667526 16:1089059-1089081 TCACAGAGGCTGGAGACCCCAGG + Intergenic
1132795125 16:1716769-1716791 CCACTGCGCCTGGTCATACCTGG - Intronic
1135423036 16:22317229-22317251 CCACTGGGACTGGGGCCCCCGGG - Intronic
1136284525 16:29233302-29233324 CCTCTGGGGCTCTTGACCCCCGG - Intergenic
1140069191 16:71634495-71634517 CCACTGTTGCTGGTGACCGAAGG + Intronic
1140473991 16:75229495-75229517 CGCCTGAGGGTGGTGACCCCAGG - Exonic
1142144641 16:88487778-88487800 CCACTGGCTCTGGTGACCCCAGG - Intronic
1143781146 17:9230397-9230419 CCCCAGGGGCCGGTGACCCCAGG - Intronic
1143791055 17:9295901-9295923 CCACTGCGCCTGGCCACACCTGG - Intronic
1144865688 17:18334227-18334249 CCACTGCGCCTGGCCACGCCTGG + Intronic
1151388634 17:73770803-73770825 CCACTGGGGCTGCTGAGGCCAGG + Intergenic
1151653048 17:75481712-75481734 GCTGTGGGGCTGGTGACCCCTGG - Intronic
1151754141 17:76061997-76062019 CCACTGCGCCTGGCCACACCCGG - Intronic
1152029391 17:77832294-77832316 CCCCCGGGGCTGGGGACCCCTGG - Intergenic
1152291440 17:79442167-79442189 CCACAGCTGCTGGGGACCACTGG + Intronic
1153397572 18:4641833-4641855 CTTCTGCAGCTGCTGACCCCTGG + Intergenic
1153654838 18:7273299-7273321 CCCCTGAGGCTGGAGACACCAGG + Intergenic
1153688542 18:7568428-7568450 CCGGCGCGGCTGGCGACCCCGGG + Intronic
1154075457 18:11196057-11196079 CCACTCTGGCTGGTGACAACAGG + Intergenic
1154468151 18:14669902-14669924 TCACTGCAGCTGGAAACCCCTGG + Intergenic
1155162749 18:23208835-23208857 CCAGTGGTGCTGGTGAGCCCTGG + Intronic
1156511092 18:37637455-37637477 CCACTGTGCCTGGAGAGCCCAGG + Intergenic
1159583632 18:70262266-70262288 CCACTGTGGGTGGTGTCACCAGG - Intergenic
1160767458 19:814782-814804 CCACTGGAGCTGGGGTCCCCAGG - Intronic
1160794921 19:940872-940894 CCACTGTGGCTGCTGGCGCCGGG + Intronic
1161014660 19:1977822-1977844 CCTATGTGGCTGGTGGCCCCAGG + Intronic
1161105174 19:2440017-2440039 CCACTGCGCCTGGTCCCCCAGGG + Intronic
1162136898 19:8561022-8561044 CCACTGCGCCTGGCCACGCCTGG + Intronic
1162530456 19:11233164-11233186 CCACTGAGGCTGGAGATTCCAGG + Intronic
1162917383 19:13881663-13881685 CCGCTGGGGCTGGAGACCCGGGG + Intergenic
1163612508 19:18308742-18308764 CCACAGGGCCTGGTGGCCCCTGG - Intronic
1163762741 19:19146209-19146231 CCCCGGCCGCTGCTGACCCCTGG - Intronic
1164636714 19:29796781-29796803 CCACTGTGCCTGGCCACCCCAGG - Intergenic
1165039404 19:33058492-33058514 CCACTGCGCCTGGTGACTATTGG - Intronic
1166383594 19:42368583-42368605 CCATTGCGGCTGGTGTGCCTGGG + Exonic
1168017144 19:53582624-53582646 CCACTGCGCCTGGCCACCTCCGG - Intergenic
1168071269 19:53953335-53953357 CCACTGCGCCTGGTGAGCTCTGG + Intergenic
1168179590 19:54652086-54652108 CCCCTGCTGCAGGGGACCCCTGG + Intronic
926212793 2:10883559-10883581 CCCCTGAGCCTGCTGACCCCAGG + Intergenic
927987446 2:27422458-27422480 CCACTGCGCCCGGTCACACCAGG - Intergenic
928217233 2:29371812-29371834 CCTCTCCAGCTGGTGATCCCAGG + Intronic
931230810 2:60372901-60372923 CCACAGATGCTGGTGACACCTGG - Intergenic
932106377 2:68946733-68946755 GCACTGCGGCTAGAGACCCAAGG - Intronic
933729744 2:85447544-85447566 CTACTGCTGCTGGTGAGCTCAGG + Intergenic
933788102 2:85860039-85860061 GTACTGCCGCTGGTGACCCTGGG + Intronic
934579809 2:95428878-95428900 CCACTGTGCCTGGTGTCCACAGG - Intergenic
934599638 2:95647847-95647869 CCACTGTGCCTGGTGTCCACAGG + Intergenic
934886837 2:98032369-98032391 GCACAGATGCTGGTGACCCCTGG - Intergenic
935308504 2:101759916-101759938 TCACTGCAGCTTGTGACTCCTGG + Intronic
936457461 2:112686373-112686395 CCACTGTGGCTAATGAGCCCGGG - Intergenic
940864662 2:158805990-158806012 CCACTGTGGCAGGAGACCCTAGG + Intronic
941883628 2:170506142-170506164 CCACTGCAGCTGGGAACCACTGG + Intronic
942034547 2:171998176-171998198 CCACTACTGCTGGTGCCACCTGG + Intronic
947917456 2:233842859-233842881 TCACTGCGGCTGGTGAGAACTGG + Intronic
948867502 2:240783214-240783236 CCACTGCAGCTGCTGATCTCTGG + Intronic
949005869 2:241647329-241647351 CCACTGCGCCTGGCCACCACCGG - Intronic
1169271100 20:4200071-4200093 CCACTGCGCCTGGTCACCCATGG - Intergenic
1169495811 20:6113744-6113766 CTTCAGCAGCTGGTGACCCCTGG - Intronic
1170791688 20:19514178-19514200 CCAGTTCTGCTGGGGACCCCTGG - Intronic
1172134197 20:32676065-32676087 CCACTGAGGCAGGTGGCCTCAGG + Intergenic
1172725131 20:37033902-37033924 CCACTGTGCCTGGCGCCCCCCGG + Intronic
1172903707 20:38353356-38353378 CCACTGGGGTTGGAGACTCCTGG + Intronic
1173476249 20:43361854-43361876 ACACTGCTGCTGCTGGCCCCAGG + Intergenic
1175424413 20:58854692-58854714 CCCCTGCGGCTGCTGAGACCCGG + Exonic
1175741498 20:61422837-61422859 GCACTGAGGCTGCTGAGCCCAGG - Intronic
1176089620 20:63313077-63313099 CCACTGCACCCGGTGACCCCTGG + Intronic
1176145558 20:63563848-63563870 GCCCTGCTGCTGGTGGCCCCGGG + Exonic
1176239630 20:64069924-64069946 CCACCCAGGCAGGTGACCCCTGG - Intronic
1176806366 21:13487747-13487769 TCACTGCAGCTGGAAACCCCTGG - Intergenic
1179266938 21:39812273-39812295 CCCCTGTGGCTGGTACCCCCAGG - Intergenic
1179722899 21:43325432-43325454 CCACTGCGGTTGGTGCTCACAGG + Intergenic
1179731417 21:43369876-43369898 GCAGTGAGGCTGGTGACCACCGG - Intergenic
1180859860 22:19071906-19071928 CAACTGCGGCAGGTGAACCCGGG + Intronic
1181329081 22:22075148-22075170 CCACTACGGCTGTGGACCTCAGG + Intergenic
1181661305 22:24351143-24351165 CCACTGGTGCTGGTTTCCCCTGG - Intronic
1183927149 22:41214359-41214381 CCACCGTGGCTGGTGAACCTTGG - Intronic
1185169935 22:49286848-49286870 CCACTGTGGCTGCTGTCCACAGG + Intergenic
1185225491 22:49649460-49649482 ACTCAGCCGCTGGTGACCCCAGG + Intronic
1185251890 22:49806650-49806672 GCATTGCGGCTGCTGCCCCCAGG - Intronic
1185351578 22:50342428-50342450 GCCCTGCGGCTGGCGGCCCCGGG - Intergenic
950002707 3:9669386-9669408 GTACTGAGGCTGGTGACCCAGGG - Intronic
951496614 3:23335607-23335629 TCACTGCAGCTGGGGACTCCTGG + Intronic
952980068 3:38727236-38727258 CCACTGAGGCGGGTCACTCCAGG - Intronic
957244573 3:77701390-77701412 CCACTGTGCCTGGTGCCCCTGGG + Intergenic
957707700 3:83812046-83812068 CAACTGCGGGTGGGGAACCCTGG - Intergenic
961110080 3:124276454-124276476 CCACTGGTTCTGGTCACCCCAGG - Intronic
961610809 3:128136396-128136418 CCAATGTGGGTGGTGAGCCCAGG + Intronic
961823288 3:129586179-129586201 CTACTGCGGCTGGTGTGCCCTGG - Exonic
962521451 3:136200940-136200962 CCACTGCGCCTGGCCACACCTGG - Intergenic
964077249 3:152706525-152706547 ACACTGCGGCTGGAGTCACCTGG + Intergenic
968045150 3:195619803-195619825 CCACTGAGGGTCGTGGCCCCGGG - Intergenic
968061005 3:195726140-195726162 CCACTGAGGGTCGTGGCCCCGGG - Exonic
968432786 4:568471-568493 CCACTGAAGCTGGTGGTCCCTGG - Intergenic
969635209 4:8365146-8365168 GCAGTGGGGCTGGGGACCCCGGG + Intergenic
971328373 4:25662780-25662802 CCACTGAGGTGGATGACCCCTGG + Exonic
973878113 4:55241616-55241638 CCTCTGCAGCTGCTGGCCCCGGG - Intergenic
977230111 4:94441510-94441532 CCACTGCGCCTGGCCACCTCTGG + Intergenic
983644044 4:169971895-169971917 CGACTGTGGCTGGAGAGCCCAGG + Intergenic
985564612 5:609052-609074 TCCCTGCTGCTGGGGACCCCAGG + Intergenic
992159095 5:73983249-73983271 CCAGGGTGGCTGGTGACCCATGG + Intergenic
996536844 5:124586202-124586224 CTACTGCGGCAGGTAAGCCCAGG + Intergenic
996614332 5:125422465-125422487 CCACTGGGACTGGGGACCCCTGG - Intergenic
997438294 5:133890975-133890997 CCACTGAGGCTGGTGCTTCCTGG - Intergenic
997459447 5:134042180-134042202 CCATGGCAGCTGTTGACCCCAGG - Intergenic
998512264 5:142723303-142723325 CCTCTGCAGCTGATGATCCCTGG + Intergenic
999180226 5:149664967-149664989 CCACGGCGGCTGCCGACCCTGGG - Intergenic
1003002787 6:2351612-2351634 ACAGTGTGGCTGGTGACCACTGG + Intergenic
1006934034 6:37705223-37705245 CCACTGGGGCTGCTGAGGCCTGG - Intergenic
1017764393 6:157594777-157594799 ACACTGGGGCTGGTGTCACCAGG - Intronic
1017868725 6:158467959-158467981 TCTCTGCAGCTGGTGCCCCCTGG - Intronic
1018289980 6:162282125-162282147 CCACGGGGGTTGGAGACCCCTGG + Intronic
1019157995 6:170051784-170051806 CCACTGGCTCTGCTGACCCCTGG + Intergenic
1019205862 6:170361047-170361069 CAACAGTGGCTGGTGACACCAGG - Intronic
1019498328 7:1351920-1351942 CCACAGCCGCTGGAGTCCCCTGG + Intergenic
1020462708 7:8442668-8442690 CCACTACGGCTGGGAAACCCCGG - Intronic
1020845236 7:13273970-13273992 CCACTGCTGCTGATACCCCCAGG - Intergenic
1022960864 7:35425086-35425108 CCACTGCAGCTAGTGGCCACAGG + Intergenic
1023026637 7:36056654-36056676 CCAGTGCTGCAGGTGACCCAGGG + Intergenic
1023080891 7:36525113-36525135 CCACTGCATCAGATGACCCCAGG - Intronic
1023792455 7:43763600-43763622 CCACTACTGCTTTTGACCCCTGG + Intronic
1024080848 7:45853801-45853823 CCACTGCGGCTGGACATCCACGG - Intergenic
1024096744 7:45988085-45988107 CCACTGGGGCTGCTGCCTCCAGG - Intergenic
1025123658 7:56328038-56328060 CCACTGCGGCTGGACATCCACGG + Intergenic
1025739279 7:64182975-64182997 CCTCTCTGGCTGGAGACCCCCGG + Intronic
1026174935 7:67988287-67988309 ACACTGAGGCTGCTGATCCCAGG - Intergenic
1028615845 7:92765999-92766021 CCACTGTGGCTGGAGAACCGTGG + Intronic
1032159336 7:129498720-129498742 TCACTGCAGCTGCTGCCCCCCGG - Intergenic
1034530589 7:151693944-151693966 TCACTGCAACTTGTGACCCCTGG + Intronic
1036123439 8:6042086-6042108 CCAGTGTGGCTGGGGACCCGAGG + Intergenic
1042612307 8:70612848-70612870 CCATTGCGCCTAGTGACCACTGG + Intronic
1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG + Exonic
1045685173 8:104704065-104704087 CCACTGAGGATGGAGAGCCCTGG - Intronic
1046217266 8:111164730-111164752 CCACTGCAACTGCTGCCCCCCGG + Intergenic
1046317022 8:112517194-112517216 CCACTGCGTGTCGTGACCCAGGG - Exonic
1047760489 8:127950542-127950564 CATCTGAGCCTGGTGACCCCTGG - Intergenic
1048581888 8:135735646-135735668 CCACTGCTGCTGATGCCCCCGGG + Intergenic
1049368724 8:142253417-142253439 CCACTGGGGGTGGTGACTCGGGG - Intronic
1049633205 8:143670666-143670688 CCACTGCGCCTGGCCACACCTGG + Intergenic
1049832829 8:144713241-144713263 GCACTGCGGCCGGTGACCCCGGG - Intergenic
1053370984 9:37561444-37561466 CCACTGAGGCTGGGGACACCAGG - Intronic
1054337430 9:63818683-63818705 CCACTGCAGCTGGTGACTTTAGG + Intergenic
1057199332 9:93131977-93131999 CCTCTCCCACTGGTGACCCCTGG - Intronic
1058691350 9:107523197-107523219 CCACCGCGCCTGGTCACACCTGG - Intergenic
1058763308 9:108157775-108157797 CCACTGCAGCTGGTGACACTTGG - Intergenic
1059432944 9:114260717-114260739 TCACTGGGGCTGGTGGGCCCAGG - Intronic
1059640627 9:116213299-116213321 CCATTTGGGCTGATGACCCCTGG + Intronic
1060734063 9:126055172-126055194 CCACAGCAACTGGGGACCCCAGG + Intergenic
1061700320 9:132410524-132410546 GCGCTGCGGGTGGGGACCCCCGG - Intronic
1062005687 9:134237463-134237485 CCACGGCAGCAGGGGACCCCAGG - Intergenic
1062546149 9:137064560-137064582 CCTCTCTGGCTGGAGACCCCCGG - Exonic
1062599007 9:137311745-137311767 CCCCTGTGGCTGGGGAGCCCAGG - Intronic
1062641281 9:137519836-137519858 CCACTGCCTCAGGTCACCCCAGG - Intronic
1190466399 X:50728402-50728424 CCAGTGATGTTGGTGACCCCAGG - Intronic
1200233510 X:154457901-154457923 CCCCGGTGGCAGGTGACCCCGGG + Intergenic
1201179523 Y:11332225-11332247 GCACTGCGGCAGGTGCACCCAGG - Intergenic