ID: 1085346327

View in Genome Browser
Species Human (GRCh38)
Location 11:75770339-75770361
Sequence GAGCAGCACCCACACCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085346327_1085346336 19 Left 1085346327 11:75770339-75770361 CCCTCTTGGTGTGGGTGCTGCTC 0: 1
1: 0
2: 1
3: 48
4: 188
Right 1085346336 11:75770381-75770403 CCAGCTGCTGCCCTGTCTCGGGG 0: 1
1: 0
2: 3
3: 22
4: 234
1085346327_1085346334 18 Left 1085346327 11:75770339-75770361 CCCTCTTGGTGTGGGTGCTGCTC 0: 1
1: 0
2: 1
3: 48
4: 188
Right 1085346334 11:75770380-75770402 CCCAGCTGCTGCCCTGTCTCGGG 0: 1
1: 0
2: 11
3: 86
4: 581
1085346327_1085346332 17 Left 1085346327 11:75770339-75770361 CCCTCTTGGTGTGGGTGCTGCTC 0: 1
1: 0
2: 1
3: 48
4: 188
Right 1085346332 11:75770379-75770401 ACCCAGCTGCTGCCCTGTCTCGG 0: 1
1: 2
2: 19
3: 107
4: 672
1085346327_1085346329 -7 Left 1085346327 11:75770339-75770361 CCCTCTTGGTGTGGGTGCTGCTC 0: 1
1: 0
2: 1
3: 48
4: 188
Right 1085346329 11:75770355-75770377 GCTGCTCGTAGCCCTTGAAGAGG 0: 1
1: 0
2: 0
3: 7
4: 52
1085346327_1085346337 20 Left 1085346327 11:75770339-75770361 CCCTCTTGGTGTGGGTGCTGCTC 0: 1
1: 0
2: 1
3: 48
4: 188
Right 1085346337 11:75770382-75770404 CAGCTGCTGCCCTGTCTCGGGGG 0: 1
1: 1
2: 7
3: 36
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085346327 Original CRISPR GAGCAGCACCCACACCAAGA GGG (reversed) Intronic
900170847 1:1267968-1267990 GAGCAGCACCAGCAGTAAGAGGG - Exonic
900441452 1:2657606-2657628 GAGCAGCACCCACACCCCCAGGG + Intronic
900441857 1:2659693-2659715 GAGCAGCACCCACACCCCCAGGG + Intronic
900441868 1:2659733-2659755 GAGCAGCACCCACACCCCCAGGG + Intronic
900442163 1:2661258-2661280 TAGCAGCACCCACACCCCCAGGG + Intronic
900442458 1:2662784-2662806 TAGCAGCACCCACACCCCCAGGG + Intronic
900442750 1:2664309-2664331 GAGCAGCACCCACACCCCCAGGG + Intronic
900442761 1:2664349-2664371 GAGCAGCACCCACACCCCCAGGG + Intronic
900443057 1:2665874-2665896 TAGCAGCACCCACACCCCCAGGG + Intronic
900443351 1:2667400-2667422 TAGCAGCACCCACACCCCCAGGG + Intronic
900443643 1:2668925-2668947 GAGCAGCACCCACACCCCCAGGG + Intronic
900443654 1:2668965-2668987 GAGCAGCACCCACACCCCCAGGG + Intronic
900443950 1:2670490-2670512 TAGCAGCACCCACACCCCCAGGG + Intronic
900444238 1:2672016-2672038 GAGCAGCACCCACACCCCCAGGG + Intronic
900444645 1:2674103-2674125 GAGCAGCACCCACACCCCCAGGG + Intronic
900444656 1:2674143-2674165 GAGCAGCACCCACACCCCCAGGG + Intronic
900444856 1:2675146-2675168 TAGCAGCACCCACACCCCCAGGG + Intronic
900445143 1:2676672-2676694 GAGCAGCACCCACACCCCCAGGG + Intronic
900445562 1:2678880-2678902 TAGCAGCACCCACACCCCCAGGG + Intronic
900445852 1:2680406-2680428 GAGCAGCACCCACACCCCCAGGG + Intronic
900447405 1:2688234-2688256 GAGCAGCACCCACACCCCCAGGG + Intronic
900447865 1:2690525-2690547 GAGCAGCACCCACACCCCCAGGG + Intronic
900447876 1:2690565-2690587 GAGCAGCACCCACACCCCCAGGG + Intronic
900450284 1:2702611-2702633 GAGCAGCACCCACACCCCCAGGG + Intronic
900450716 1:2748305-2748327 GAGCAGCACCCACACCCCCAGGG + Intronic
900450727 1:2748345-2748367 GAGCAGCACCCACACCCCCAGGG + Intronic
900453768 1:2763722-2763744 GAGCAGCACCCACACCCCCAGGG + Intronic
900454481 1:2767307-2767329 GAGCAGCACCCACACCCCCAGGG + Intronic
900455213 1:2770984-2771006 GAGCAGCACCCACACCCCCAGGG + Intronic
900455959 1:2774729-2774751 GAGCAGCACCCACACCCCCAGGG + Intronic
900745753 1:4359747-4359769 GAGCAGCACCCACATCTACAGGG + Intergenic
901511916 1:9721824-9721846 GGGCAGCACCCACCACATGAAGG + Exonic
905625648 1:39489334-39489356 GAGCAGCCCCCACAGCAACAGGG - Intergenic
906725322 1:48040204-48040226 GAACAGCTCCCACCCCAAGGTGG - Intergenic
908070504 1:60454917-60454939 TGGCAGCAGCCATACCAAGAGGG - Intergenic
908071806 1:60468684-60468706 GAGCAGCACACACACACATAAGG + Intergenic
909913756 1:81292562-81292584 GGGCATCTGCCACACCAAGAGGG + Intergenic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
916209373 1:162347616-162347638 GAGCAGCTCCCACTGCAAAAGGG - Intronic
921060221 1:211578887-211578909 CAGCAGCCCCCACACCCAGGCGG + Intergenic
921298350 1:213725538-213725560 AAGCAGTACCCACAGCAGGAAGG - Intergenic
924371620 1:243356906-243356928 GAGGATCACTCACACCCAGAAGG + Intronic
924420490 1:243904887-243904909 GATCCTCACCCACAGCAAGAAGG - Intergenic
924596208 1:245447149-245447171 CAGCAGCAAGCACACCAGGAAGG - Intronic
924623743 1:245684128-245684150 GACCACCACCCACAACAAAATGG + Intronic
1062919309 10:1267165-1267187 GACCAGCACCCACACCTACCCGG - Intronic
1063300108 10:4843529-4843551 GGGCAGCTCAGACACCAAGAGGG - Intronic
1063611900 10:7569835-7569857 GAGTAGCACCTACACAAGGAAGG - Intronic
1064325877 10:14350741-14350763 GAGATACACCCACACCAAGGAGG + Intronic
1065326101 10:24552067-24552089 GAGCAGCCCCCACCGCAAGCAGG - Intergenic
1065841876 10:29708752-29708774 GAGCTCCACCCACACCCAGCAGG - Intronic
1068628395 10:59274161-59274183 TAGCATCACCCACACACAGAGGG + Intronic
1070009411 10:72457563-72457585 GAGCAACACCAACACCAAGCTGG + Intronic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1077200467 11:1304525-1304547 CAGCAGCACCCGCGCCAGGACGG + Intronic
1082814915 11:57501303-57501325 GAGCAGCACCAACACCACCCAGG - Exonic
1084119402 11:67060097-67060119 TAGCAGCCCCCACACCAGCATGG + Intronic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1086516310 11:87617517-87617539 GAGCAGCAAACCCACCAAAATGG - Intergenic
1088131021 11:106491146-106491168 CAGCAGCACCAACAACAAAATGG - Intergenic
1089601397 11:119617532-119617554 GAGAAGCACCCACAGCAAAGGGG - Intergenic
1092083107 12:5734575-5734597 GAGCCACAGCCACACCTAGAGGG - Intronic
1093554107 12:20450088-20450110 GAGCAGCATCAAATCCAAGACGG - Intronic
1093899629 12:24616333-24616355 GAGCAGCTCGCTCACCTAGAGGG + Intergenic
1093919658 12:24845122-24845144 GAGCACCACTCACACCAGGGAGG + Intronic
1095710826 12:45286130-45286152 GAGCAGCAGCAACAGCACGATGG + Intronic
1098080293 12:66777298-66777320 GGGCAGCACCAAGACCAAGTTGG - Intronic
1102415387 12:112757965-112757987 GAGCAGCTGCCACAGCAGGATGG - Intronic
1104647656 12:130508684-130508706 GAGGAGCAGCCACAGGAAGAAGG - Intronic
1105721407 13:23118811-23118833 GAGCAGCAGGCACATGAAGAGGG + Intergenic
1106513030 13:30427972-30427994 AAGCAGCACCAAATCCAAGATGG + Intergenic
1108591184 13:51914341-51914363 GAGCAGCACTGTCACCAAGGTGG + Intergenic
1110189202 13:72711732-72711754 GAGCAGCAACCACACAAGGCAGG + Intronic
1112094064 13:96113062-96113084 GAACACCACACACACCATGAGGG - Intronic
1113653438 13:112054038-112054060 GGGCAGCGCCCACAGCAAGCCGG + Intergenic
1115695038 14:35887794-35887816 GGGCATCAACCACACAAAGAGGG + Intronic
1116978209 14:51139443-51139465 GAGCAGCACCCACAGAGAGAGGG - Intergenic
1117021033 14:51570603-51570625 CAGCAGCATCAACACCATGAAGG + Intronic
1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG + Intergenic
1117542228 14:56759446-56759468 GAAGAGCACCCACACCAACAAGG + Intergenic
1118602900 14:67482804-67482826 GGGGGGCACCCACAGCAAGAGGG - Intronic
1121336822 14:93082711-93082733 GAGCAGGACCCAAGCCAAGCCGG + Intronic
1125061274 15:35427998-35428020 GATGAGCTCCCAAACCAAGAAGG + Intronic
1125761336 15:42097555-42097577 CAACAGCACCCAAACCAAGGGGG - Intergenic
1128308255 15:66614104-66614126 GTGCAGTACCCACACAAAGTGGG - Intronic
1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG + Intergenic
1129269208 15:74410654-74410676 GGGCAGCACCCCCAGCCAGAGGG + Exonic
1129947367 15:79550859-79550881 GAGAAAGACCCACAGCAAGAAGG - Intergenic
1130087398 15:80789144-80789166 CAGCAGAACCCACACCAACTGGG - Intronic
1130843763 15:87725446-87725468 AAGCAGCACCCACAGAAAGAAGG + Intergenic
1132496919 16:268287-268309 AAGCTGCACCCACAGCAGGATGG + Exonic
1132644461 16:992409-992431 GAGCAGCCCCCTCCCCATGAGGG - Intergenic
1133569362 16:7026008-7026030 GATCAGACCCCAGACCAAGAAGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134578132 16:15349195-15349217 GAGCCGCAGCCACACCGAGCAGG - Intergenic
1134724459 16:16408351-16408373 GAGCCGCAGCCACACCGAGCAGG + Intergenic
1134942971 16:18303508-18303530 GAGCCGCAGCCACACCGAGCAGG - Intergenic
1137409307 16:48214367-48214389 AGGCAGCACCCAGAGCAAGAAGG - Intronic
1138050226 16:53768719-53768741 AAGCAGCAGCCTCACCAAGCAGG - Intronic
1142307855 16:89295541-89295563 CAGCAGCACCAGCACCAGGAAGG - Intronic
1143995748 17:11005013-11005035 CAGCACCACCCACAGAAAGATGG - Intergenic
1144812389 17:18008798-18008820 GATCTCCACCCACCCCAAGATGG - Intronic
1145819046 17:27817275-27817297 AAGCAGCAGCCACTCCCAGATGG - Intronic
1145867696 17:28251302-28251324 CAGCAGCACCCACACGAGGCCGG + Intergenic
1147184841 17:38707492-38707514 GAGCTGTGCCCACACAAAGACGG + Exonic
1149552147 17:57548293-57548315 GAGCTGCACCCACCCCAGGGAGG - Intronic
1150041220 17:61863412-61863434 TAGCAGCACCCCCAGGAAGAGGG - Exonic
1150280201 17:63925726-63925748 TAGCAGCACCTGCAGCAAGAGGG + Intergenic
1152559684 17:81071826-81071848 GAGCAGTTCCCACGCCAAGTAGG + Intronic
1152809557 17:82375142-82375164 GAGCAGCTGCCACAGCCAGAAGG - Exonic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1157200945 18:45659079-45659101 CAGCAGCTCCTACACCAAGCAGG + Intronic
1157320208 18:46628441-46628463 AAGCAGCACCCACAGCAAATAGG + Intronic
1160718838 19:588969-588991 AAGCAGCACCCACGCCCAGCCGG + Intergenic
1160844405 19:1160098-1160120 CACCAGCACCCACAGCCAGAGGG - Intronic
1160898626 19:1415494-1415516 CAGCAGCCCCCACCCCATGAAGG - Intronic
1161060890 19:2214253-2214275 CTCCAGCACCCACACCACGATGG - Intronic
1161595982 19:5151211-5151233 GAGCAGCCCCCACAGCAATCAGG + Intronic
1167720611 19:51177686-51177708 CAGCAGCACCCAAACCATGACGG + Intergenic
927486179 2:23489816-23489838 GGGCGGTACCCACACCAAGGAGG + Intronic
927515349 2:23668868-23668890 AGGCAGCACCCACCCCGAGAGGG + Intronic
928295233 2:30076985-30077007 CAGCACCACCCATGCCAAGAGGG + Intergenic
929442603 2:41976533-41976555 GAGGAACACCCACACCATGGAGG - Intergenic
930475354 2:51875217-51875239 GTCAAGCACCCACACCCAGAAGG + Intergenic
934571756 2:95377057-95377079 GAGCAGGAGCCACTCCAAGGTGG - Intronic
935170426 2:100607295-100607317 GAGCAGCTTCCACAGCAAGGAGG + Intergenic
936231253 2:110701067-110701089 ACTCAGCACCCACATCAAGATGG - Intergenic
937328760 2:121008658-121008680 GAGCAGCACACACAGCATGGAGG + Intergenic
944105811 2:196077978-196078000 GAGCTGCACCCAGACCAGGATGG - Intergenic
947960294 2:234230634-234230656 GGGCAGCACCCACACAAATATGG + Intergenic
949060177 2:241952381-241952403 GAGAATCACCCACACCCAGGGGG - Intergenic
1169396136 20:5231200-5231222 GAGGAGGATCCTCACCAAGATGG + Intergenic
1170551326 20:17480010-17480032 GAGCTTCTCCCACTCCAAGAAGG + Intronic
1170776849 20:19382548-19382570 GAGCAGCTCCCAAATCAGGAAGG - Intronic
1171236188 20:23526908-23526930 GGGCAGCCCCCAAACAAAGAGGG + Intergenic
1171390058 20:24795483-24795505 GACCAGCACCCACTCCAACATGG - Intergenic
1171784362 20:29448946-29448968 GACCAGGACCCACAGCACGACGG - Intergenic
1174039902 20:47691720-47691742 GAGCAGCACACACACAAAAAAGG + Intronic
1174281152 20:49440397-49440419 GAGAACGACCCACACCAAGAGGG - Intronic
1175977242 20:62717143-62717165 GGGCACCACCCACCCCAGGAGGG + Intronic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1177734396 21:25070807-25070829 TAGCATCTCCCACACCAGGAAGG - Intergenic
1178497691 21:33101312-33101334 GAGCAGCACCCCCACCTCCAAGG - Intergenic
1179011559 21:37560404-37560426 AAGCAGCACCTGCACCAGGAAGG - Intergenic
1180650899 22:17376044-17376066 GATCTGCACCCTCACCAAGGAGG + Intronic
1180895970 22:19332396-19332418 GAGCAGCCCACACTCCAACAGGG + Intronic
1181256731 22:21567726-21567748 GAGCAGCACCAAATCCAAGATGG + Intronic
1181489682 22:23253852-23253874 GAGCAGCGCCGGCACCAAGATGG + Exonic
1182278047 22:29202639-29202661 GACCTGGACCCACACCCAGATGG - Intergenic
1184336423 22:43855790-43855812 GAGCTGCCCCCACACTAACAGGG + Intronic
1184726875 22:46352165-46352187 GAGCAGCACGCACCTGAAGAAGG - Exonic
950795984 3:15511041-15511063 AATTAGCACCCACACAAAGAAGG - Intronic
951870909 3:27361079-27361101 GAGCAGCCCTCAGACCAACATGG - Intronic
953026352 3:39147457-39147479 GAGAAGCTCCCACACCGGGAGGG - Intronic
953330916 3:42052424-42052446 GAGCAACCCCCAAACCCAGAAGG - Intronic
953515541 3:43587465-43587487 GAGAAGGCCCCACACCAAGTGGG + Intronic
953599943 3:44352573-44352595 TATCAGCATCCACACCAAAATGG + Intronic
954202589 3:49032913-49032935 GTGCAGGAACCACATCAAGATGG + Intronic
954700515 3:52448320-52448342 GAGCAGGAACCAATCCAAGATGG - Intergenic
954813094 3:53259999-53260021 GGGCTGCACCCAAGCCAAGAGGG + Intergenic
956849073 3:73211791-73211813 AATCACCACCCACACCATGATGG - Intergenic
960131099 3:114056880-114056902 TAGCAGCTCCCACACCAGCAGGG - Intronic
962172298 3:133114543-133114565 GAGCAGCAACAACAACAGGAGGG - Intronic
962751026 3:138434908-138434930 GAACAGCACGCGCACCACGAAGG - Exonic
962875027 3:139529429-139529451 CAGCAGCAGCCACACCATCATGG - Intronic
963115947 3:141729121-141729143 CAGCATCACTCGCACCAAGAAGG + Intergenic
963480495 3:145867597-145867619 GTGCTGCACACTCACCAAGAGGG + Intergenic
965926739 3:173989820-173989842 GAACAGCACACAAACCAAGAAGG + Intronic
967807510 3:193728809-193728831 GAGCAGCACCCACCACACCAAGG - Intergenic
969231394 4:5834179-5834201 GGGCAGCTCCCACAGCCAGATGG + Intronic
969525263 4:7701070-7701092 CAGCAGCACCCCCACCAGGGAGG + Intronic
969531651 4:7733965-7733987 GAACAGCCTCCACACCAAGGAGG + Intronic
969947671 4:10801208-10801230 GAGCAGCACCCAGACTAGGGTGG - Intergenic
970086563 4:12354180-12354202 GAGCAACTCCCACTCCTAGATGG - Intergenic
970133418 4:12895783-12895805 GAACAGGACCCTCACCAAGTAGG + Intergenic
975118691 4:70705557-70705579 GACCAGCGCCCAGCCCAAGACGG - Intronic
975844759 4:78513405-78513427 GTGCAGATCCCACACCAGGATGG + Intronic
978370932 4:108029099-108029121 AAGCAGCACCCACCCCAGGCAGG - Intronic
984018517 4:174455208-174455230 GAACAGAACTCACACCCAGAGGG + Intergenic
986482452 5:8202781-8202803 GCGCTCCACCCACAGCAAGAGGG - Intergenic
987558255 5:19483421-19483443 CAGCAGCACCCTCACCATCAGGG - Exonic
994201874 5:96985840-96985862 GAGCAGCAGCCATACCCAGCAGG + Intronic
996633559 5:125665187-125665209 GAGCAGCACCCAAACAGGGAAGG + Intergenic
999007713 5:148001254-148001276 AAGCAGTAGCCAGACCAAGATGG + Intergenic
999262242 5:150245269-150245291 GAGCAGCATCCACACGCAGCCGG + Intronic
1000338512 5:160259676-160259698 GAACTTCACCCTCACCAAGAAGG - Exonic
1000953995 5:167520692-167520714 GAGAAGAACACACACCTAGAAGG - Intronic
1002581652 5:180212524-180212546 CAGCAGCACCCCCAGCAGGAGGG + Intergenic
1004269016 6:14177275-14177297 CTGCAGCAGCCACACCAAGTTGG + Intergenic
1004510219 6:16278791-16278813 GTGCACCACCCGCACCAAGACGG + Exonic
1004532080 6:16462976-16462998 CAGCAGCACCCCCACCACTAAGG + Intronic
1005282315 6:24287184-24287206 CATCAGCCCCCACACCAAAAAGG + Intronic
1005654218 6:27916461-27916483 GTGCTGCACCCACACCAACATGG + Intergenic
1006150069 6:31982346-31982368 GAGCTGCACCCCCACCGATAGGG - Exonic
1006156370 6:32015084-32015106 GAGCTGCACCCCCACCGATAGGG - Exonic
1008329976 6:50233125-50233147 GAGCTGAACTCACACTAAGAAGG + Intergenic
1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG + Intronic
1011528964 6:88299024-88299046 GAGAAACACCCAAAACAAGAAGG + Intergenic
1018000180 6:159571991-159572013 CAACAGTACCAACACCAAGATGG - Intergenic
1019312022 7:367528-367550 CTGCAGCACCCACACCAGGAGGG + Intergenic
1019542987 7:1559809-1559831 GAGCAGCCCCCACAGCCAGGAGG + Intronic
1019633457 7:2062783-2062805 GTGCAGCACCCACCGCAGGAAGG + Intronic
1022326529 7:29337051-29337073 AAGCAGCACCCAATCCTAGAGGG - Intronic
1024730333 7:52246672-52246694 GAGGAGCACCCACATTATGAAGG + Intergenic
1029305077 7:99613224-99613246 GAGAAGGACCCACCCTAAGAGGG + Intergenic
1030019254 7:105256781-105256803 GATCAGCACCCACATCTAGATGG + Intronic
1030583754 7:111391331-111391353 GAGCTTCACACTCACCAAGAGGG + Intronic
1030911315 7:115252505-115252527 CAGCAGCCACCACAACAAGATGG - Intergenic
1032160091 7:129503057-129503079 GAGCAGCCCCCACACCCAGACGG + Intronic
1037898684 8:22675187-22675209 GAGCAACAACCAAATCAAGAGGG - Intergenic
1038589574 8:28824367-28824389 AAGCAGCACCCAGATAAAGAAGG - Intronic
1039032883 8:33328832-33328854 GAGCAGCACCCACAAAGATATGG + Intergenic
1040870822 8:52098801-52098823 GAGCAGCCCCCCAAGCAAGAAGG - Intergenic
1042965520 8:74347887-74347909 GAGCAGAACCCACACCAACTTGG - Intronic
1047672560 8:127164256-127164278 GAGGAGCCCCCACAGCAAGTTGG + Intergenic
1049373173 8:142277323-142277345 GAGCAGCACACACACCTCAAAGG + Intronic
1049487615 8:142874736-142874758 TAGCAGCAACCTCACCCAGATGG + Intronic
1049579308 8:143404201-143404223 GAGCAGGTCCCACACAAAGTAGG - Intergenic
1049736928 8:144213161-144213183 CCGCAGAACCAACACCAAGAAGG - Intronic
1051260424 9:15258550-15258572 GAGCAGCAGCCATGTCAAGAAGG + Intronic
1053453727 9:38214684-38214706 GAGCTGAACCCTCACCAAGTGGG + Intergenic
1055203403 9:73695832-73695854 GAGCAGCAGCAAGAGCAAGAGGG - Intergenic
1057060350 9:91998593-91998615 GGGCAGGACTAACACCAAGAAGG + Intergenic
1058379988 9:104367122-104367144 GAGAAGCATCCACATCAATAGGG - Intergenic
1061881072 9:133569351-133569373 GAGAGGCAGCCACACCAGGAGGG - Intronic
1186591447 X:10934183-10934205 GAGCAGAACAAAAACCAAGATGG - Intergenic
1186865870 X:13720339-13720361 TAGCAGCACGGACACCTAGAAGG + Intronic
1187206505 X:17186802-17186824 GGTCAGCACCCAGAACAAGAAGG - Intergenic
1190442445 X:50488698-50488720 GTGCAGCACGCACACCAACATGG - Intergenic
1192149082 X:68700699-68700721 GAGCAGTGCCCACACCAGCAGGG + Intronic
1193986914 X:88253352-88253374 GGGCAGCACCCACATACAGAGGG - Intergenic
1195039100 X:100997886-100997908 GAGAAACACCCACACCAACAGGG + Intergenic
1197785162 X:130191171-130191193 GAGCAGCCCCCACCCCTTGAGGG + Intergenic
1199616428 X:149659613-149659635 GAGCATCAGCCACCCCAGGAGGG + Intergenic
1199626213 X:149743635-149743657 GAGCATCAGCCACCCCAGGAGGG - Intergenic