ID: 1085346359

View in Genome Browser
Species Human (GRCh38)
Location 11:75770532-75770554
Sequence CATTTTTAACAGCATGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 655}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085346359_1085346362 -4 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346362 11:75770551-75770573 AATGTTTTTGCACTGGGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 248
1085346359_1085346364 2 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346364 11:75770557-75770579 TTTGCACTGGGCAGTGGGATAGG 0: 1
1: 0
2: 1
3: 25
4: 248
1085346359_1085346365 3 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346365 11:75770558-75770580 TTGCACTGGGCAGTGGGATAGGG 0: 1
1: 0
2: 0
3: 25
4: 231
1085346359_1085346367 29 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346367 11:75770584-75770606 TTCTCTGTGGTAGTGCTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 140
1085346359_1085346363 -3 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346363 11:75770552-75770574 ATGTTTTTGCACTGGGCAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 213
1085346359_1085346366 16 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346366 11:75770571-75770593 TGGGATAGGGATGTTCTCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 210
1085346359_1085346361 -10 Left 1085346359 11:75770532-75770554 CCTTGTTCATGCTGTTAAAAATG 0: 1
1: 1
2: 2
3: 45
4: 655
Right 1085346361 11:75770545-75770567 GTTAAAAATGTTTTTGCACTGGG 0: 1
1: 0
2: 2
3: 35
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085346359 Original CRISPR CATTTTTAACAGCATGAACA AGG (reversed) Intronic
902697239 1:18148442-18148464 CTTTATTAGCAGCATGAAAACGG + Intronic
903483852 1:23675070-23675092 CTTTATTAACAGCATGAGAACGG + Intergenic
904378880 1:30097932-30097954 CTTTATTAGCAGCATGAAAATGG - Intergenic
905379311 1:37548964-37548986 CTTTATCAACAGCATGAAAACGG + Intronic
905477253 1:38237826-38237848 CTTTATTAGCAGCATGAAAATGG + Intergenic
907003174 1:50883285-50883307 CATTTTTAAAAGAATCAACATGG - Intronic
907625251 1:56023173-56023195 CTTTGTTAGCAGCATGAAAATGG - Intergenic
908048890 1:60205976-60205998 CTTTATTAGCAGCATGAAAATGG + Intergenic
908212973 1:61920539-61920561 CTTTATTAGCAGCATGAAAACGG + Intronic
908293971 1:62694505-62694527 CTTTATCAACAGCATGAAAACGG - Intergenic
908882153 1:68744082-68744104 CTTTTTCAGCAGCATGAATATGG + Intergenic
908884270 1:68769990-68770012 CTTTTTCAGCAGCATGAAAATGG - Intergenic
908911295 1:69074376-69074398 CTTTATTAGCAGCATGAAAATGG - Intergenic
909271438 1:73628022-73628044 CTTTATCAACAGCATGAAAAAGG - Intergenic
909522577 1:76586852-76586874 CACTTTTAACAGCATCCACTTGG - Intronic
909702367 1:78541552-78541574 CTTTATTAGCAGCATGAAAAGGG - Intergenic
909805842 1:79873411-79873433 CATTTTTAAAAGCATGAGATAGG + Intergenic
909946034 1:81663782-81663804 CATGTTTAGCAGCATGATAATGG + Intronic
910245645 1:85135442-85135464 CATTTTAAACAGGATGGTCAGGG + Intergenic
910378839 1:86603477-86603499 CATTATTAGCAGCATGAGAATGG - Intergenic
910524443 1:88161716-88161738 CATTTTGAAAATCTTGAACATGG - Intergenic
910628777 1:89336266-89336288 CATTATCAACAGCATGAAAATGG + Intergenic
910833997 1:91489110-91489132 CTTTGTTAACAGCATGACCATGG - Intergenic
911331854 1:96533405-96533427 CTTTTTCAGCAGCATGAAAATGG + Intergenic
912027610 1:105198260-105198282 CATTTTTAATAGCACCAAAAAGG - Intergenic
912328631 1:108795332-108795354 AATTTTTACCTGCATTAACATGG - Intronic
912660656 1:111526552-111526574 CTTTATTAGCAGCATGAAAATGG + Intronic
912677401 1:111696978-111697000 AAATTTTAACAACTTGAACATGG + Intronic
912730833 1:112101821-112101843 CATTTTTAAGAGGTTGCACATGG + Intergenic
913066615 1:115261512-115261534 CTCTTTTTACAGCATGAAGAAGG + Intergenic
913351695 1:117868252-117868274 CATCTATAAAAGCATGAACTTGG + Exonic
915775392 1:158479338-158479360 CATCTTTAAACTCATGAACATGG + Intergenic
915803921 1:158824404-158824426 CTTTATTAGCAGCATGAAAACGG + Intergenic
915873103 1:159582985-159583007 GATTGTGAACAGCATGAAGATGG + Intergenic
915923317 1:159995326-159995348 CTTTTTCAGCAGCATGAAAATGG - Intergenic
916287869 1:163130970-163130992 CCTTTCTAGCTGCATGAACATGG + Intronic
916900381 1:169215797-169215819 CATTTGTGACAATATGAACATGG + Intronic
917892653 1:179454437-179454459 CTTTATTAGCAGCATGAAAATGG + Intronic
918015378 1:180628563-180628585 CTTTATTAGCAGCATGAAAACGG - Intergenic
918302243 1:183214996-183215018 GATTTTTAAGAGCATAAAAAGGG - Intronic
918734345 1:188038995-188039017 CTTTATTAGCAGCATGAAAATGG + Intergenic
918831418 1:189404305-189404327 CTTTTTCAGCAGCATGAAAATGG - Intergenic
918931273 1:190859481-190859503 CTTTATCAACAGCATGAAAATGG - Intergenic
919173654 1:193990732-193990754 CTTTATTAGCAGCATGAAAATGG + Intergenic
919248117 1:195014974-195014996 CTTTATCAACAGCATGAAAATGG - Intergenic
919358518 1:196559415-196559437 CATTTATAACAGCATAAAACTGG - Intronic
919399845 1:197099063-197099085 CATTATATAGAGCATGAACAAGG - Intronic
920594371 1:207254532-207254554 CTTTATTAACAGCATGAGAATGG - Intergenic
920859200 1:209691318-209691340 CATTTTTAACATCTTTAAGAGGG - Intronic
921744064 1:218717725-218717747 CATTTTGAAAAGAATGAGCATGG + Intergenic
922231139 1:223687538-223687560 CTTTTTCAGCAGCATGAAAATGG + Intergenic
922291538 1:224212858-224212880 CATTTTTATCTTCATGTACAAGG + Intergenic
922530342 1:226340451-226340473 CTTTATCAGCAGCATGAACATGG + Intergenic
922636569 1:227178803-227178825 CTTTGTTAGCAGCATGAAAATGG + Intronic
923428232 1:233892999-233893021 TATTTATAGCAGCATGAAAATGG - Intergenic
923646428 1:235825574-235825596 CATTTATAATAGCATCAAAAAGG + Intronic
923725796 1:236504220-236504242 CATTTGTAACTGCATCAATAAGG - Intergenic
923793818 1:237134304-237134326 CTTGATTAACAGCATGAACATGG - Intronic
924036372 1:239942805-239942827 CTTTATTAGCAGCATGAAAAAGG - Intergenic
924644811 1:245867756-245867778 CATTTTAAACAGGATGATCGGGG + Intronic
1063048699 10:2420915-2420937 CTTTATTAGCAGCATGAAAACGG + Intergenic
1063292199 10:4761082-4761104 CAGTTTTGACAGCATGACCAAGG - Intergenic
1064093298 10:12403665-12403687 TATTTTTAAATGCATTAACAGGG - Intronic
1065056106 10:21844183-21844205 CTTTATTAGCAGCATGAAAATGG + Intronic
1065448541 10:25828927-25828949 TATTTTTACCATCATGAAAATGG + Intergenic
1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG + Intergenic
1066452036 10:35538257-35538279 CTTTTTCAGCAGCATGAAAATGG + Intronic
1067812425 10:49440156-49440178 CTTTATTAGCAGCATGAAAATGG - Intergenic
1068172717 10:53416769-53416791 CTTTATTAGCAGCATGAAAATGG + Intergenic
1068437983 10:57016265-57016287 CAGATTTAACATCATTAACAAGG - Intergenic
1069231276 10:66011627-66011649 CATTTCTGACAGTATGAACTTGG - Intronic
1069549662 10:69354281-69354303 TCTTTTTAACAGTATGAAAACGG - Intronic
1070018103 10:72555479-72555501 CATTTTTAACGGCAGAAGCAAGG + Intronic
1070616189 10:77971120-77971142 CATTTTAAACAGCCTGCAAAGGG + Intronic
1070764100 10:79046728-79046750 GATTTTTAACAGCAGGGAAAAGG - Intergenic
1071086162 10:81871119-81871141 CATTTTGCAAAGCATGAATAAGG - Intergenic
1071427274 10:85571564-85571586 CATTTTTAACCAAATTAACAAGG - Intergenic
1072905824 10:99452679-99452701 CTTTATAAACAGCATGGACATGG - Intergenic
1073709869 10:106023908-106023930 CATTTCTTCCAGAATGAACATGG - Intergenic
1073726419 10:106236590-106236612 CTTTATCAGCAGCATGAACATGG - Intergenic
1073835719 10:107438820-107438842 CACTATTAAGAGAATGAACAAGG - Intergenic
1073913155 10:108370682-108370704 TATTCATAACAGCAAGAACATGG + Intergenic
1074852941 10:117453541-117453563 CTTTATCAACAGCATGAAAACGG - Intergenic
1075181878 10:120218729-120218751 CATCTTTAACAGCATCAAATTGG + Intergenic
1075920402 10:126207117-126207139 CTTTATTAGCAGCATGAAAACGG + Intronic
1075941890 10:126396825-126396847 CTTTATTAGCAGCATGAGCACGG + Intergenic
1076011631 10:126994030-126994052 CTTTTTTAACAATATGAAAAAGG - Intronic
1076016771 10:127034140-127034162 CTTTATCAGCAGCATGAACAGGG - Intronic
1076032241 10:127169468-127169490 CATTTTTAGCTGTATGAATATGG + Intronic
1076034924 10:127191579-127191601 GATTTTTAAAAACATGAAGAAGG + Intronic
1076200332 10:128552702-128552724 CTTTATCAGCAGCATGAACACGG + Intergenic
1076216168 10:128695149-128695171 AATTTTTAACAGAATGAATGTGG + Intergenic
1077990522 11:7406617-7406639 CATTCTTAACAGCAAAGACATGG - Intronic
1079147724 11:17868640-17868662 CTTTATTAGCAGCATGAAAATGG - Intronic
1079609534 11:22414783-22414805 TATTTTTAACTGAATGAATAAGG - Intergenic
1080190670 11:29544156-29544178 CATTTTAAATAGCATGTACTTGG - Intergenic
1081281149 11:41210539-41210561 CTTTATCAACAGCATGAAAATGG + Intronic
1081455659 11:43220019-43220041 CTTTATTAGCAGCATGAAAATGG - Intergenic
1082630874 11:55540620-55540642 CTTTATAAACAGCATGAAAACGG - Intergenic
1082745303 11:56954739-56954761 CTTTATTAGCAGCATGAAAATGG - Intergenic
1083867471 11:65464596-65464618 CATTTTTAAGAGAATGAAGACGG + Intergenic
1083970796 11:66073282-66073304 TATTCTAAACAACATGAACAAGG - Intronic
1084724133 11:70929365-70929387 CATTTGTTACAGCAGCAACAGGG - Intronic
1084782002 11:71416105-71416127 CATTTATAACAGCAGCCACACGG + Intergenic
1085027693 11:73246406-73246428 CATTTTTGACATCATAAAAATGG - Intergenic
1085346359 11:75770532-75770554 CATTTTTAACAGCATGAACAAGG - Intronic
1085559087 11:77453742-77453764 CTGGTTTAACTGCATGAACATGG - Intronic
1085754920 11:79194257-79194279 CTTTATCAACAGCATGAAAACGG + Intronic
1085766152 11:79283946-79283968 CATTTATAATAGCATCAAAAAGG + Intronic
1085807295 11:79648086-79648108 CATTATCAGCAGCATGAAAATGG + Intergenic
1086367576 11:86123336-86123358 GATTTTTAAAAGTATCAACATGG - Intergenic
1086608097 11:88721605-88721627 CATTTGTAACAGTATGAATCTGG - Intronic
1086754489 11:90542680-90542702 TATTTTTAAAAGTAGGAACAGGG - Intergenic
1087248371 11:95867907-95867929 CATTTGTAAAAGCATGTATAAGG + Intronic
1087294875 11:96359686-96359708 CATTTTTAACTTCATAAATATGG - Intronic
1087690787 11:101318398-101318420 CCTTATTAGCAGCATGAAAATGG - Intergenic
1087953831 11:104258758-104258780 CATTCTGAACATGATGAACATGG + Intergenic
1088057437 11:105602394-105602416 CATTTTTAACAGAAATAACATGG - Intergenic
1088177983 11:107075755-107075777 CATTTATAATAGCATCAAAAAGG + Intergenic
1088389005 11:109292455-109292477 CTTTATTAGCAGCATGAAAATGG + Intergenic
1088544831 11:110948707-110948729 CTTTATTAGCAGCATGAAAATGG - Intergenic
1089019458 11:115197727-115197749 CAATTTTATCAGCATTAACTGGG - Intronic
1089348386 11:117806775-117806797 CATTTTTTAAAGTTTGAACATGG + Intronic
1089478507 11:118786242-118786264 CAATTAAAACAGCATGAGCACGG - Exonic
1090532965 11:127610164-127610186 TGTTTTTGACAGCATGAAAATGG - Intergenic
1091008007 11:131971247-131971269 CATTTTTAAAACCATGTTCACGG + Intronic
1091061830 11:132470785-132470807 AATGGTTAAGAGCATGAACATGG - Intronic
1091445097 12:540549-540571 CATTTGTAAAAGCATGGAGAAGG + Intronic
1091935415 12:4430899-4430921 CATAATCAACAGCTTGAACAAGG + Intronic
1092620966 12:10267984-10268006 AAATTTTAAAAGCCTGAACATGG - Intergenic
1092691881 12:11120919-11120941 CATTTTTATCAGGATGAAATTGG + Intronic
1093277816 12:17151657-17151679 CTTTATTAGCAGCATGAAAATGG - Intergenic
1093503347 12:19836780-19836802 CAATCTTAAAAGGATGAACAGGG + Intergenic
1093909008 12:24724909-24724931 CCTTTATAACAGCATGAGAAGGG - Intergenic
1093973823 12:25399918-25399940 CTTTGTTAGCAGCATGAAAATGG + Intergenic
1094149377 12:27265861-27265883 TATTTTTATCAGCATCAATAGGG - Intronic
1094489083 12:30947419-30947441 CATTATCAGCAGCATGAAAACGG - Intronic
1094769870 12:33643136-33643158 TATTTTAAACTGAATGAACACGG - Intergenic
1095394817 12:41750064-41750086 CTTTATTAGCAGCATGAAAACGG - Intergenic
1095453035 12:42351289-42351311 CATTTTTTAAAACATTAACAAGG + Intronic
1095650637 12:44604722-44604744 CATTTTTAACATGATAAATAAGG - Intronic
1095738529 12:45584254-45584276 CATCTATAGCATCATGAACAGGG + Intergenic
1096436754 12:51597536-51597558 CATTTCTACCAGCGTGAACTTGG + Intronic
1097386880 12:58960730-58960752 GATTATTTACACCATGAACATGG - Intergenic
1097662633 12:62447400-62447422 CTTTATTAGTAGCATGAACATGG - Intergenic
1098030817 12:66251948-66251970 CATTTTTGAGAGGATGAAGAAGG + Exonic
1098121067 12:67239493-67239515 TATTTTTATCAGCATTAAAAGGG - Intergenic
1098335245 12:69397681-69397703 CTTTATTAGCAGCATGAAAATGG + Intergenic
1098592421 12:72229151-72229173 CTTTTTTAGCAGCATGAGAATGG - Intronic
1099008050 12:77259168-77259190 CATTTTTAATAGGATGGTCAAGG + Intergenic
1099028636 12:77496802-77496824 CATTTTTAACAAAATGCTCAGGG - Intergenic
1099121945 12:78701111-78701133 CATTTATAAGATCATGAAAAGGG - Intergenic
1099240939 12:80137859-80137881 CATTTTTATCAACGTGAACCAGG - Intergenic
1099560287 12:84164783-84164805 CTTTATTAGCAGCATGAAAATGG - Intergenic
1099760194 12:86911542-86911564 CATTTATAACAGTGTGAAAATGG + Intergenic
1099812644 12:87604711-87604733 CCTTATTAGCAGCATGAAAATGG - Intergenic
1100695164 12:97084681-97084703 CTTTATCAACAGCATGAAAATGG - Intergenic
1101194475 12:102368801-102368823 CTTTATTAACAGCATGAGAATGG - Intergenic
1101340407 12:103837948-103837970 CTTTATTAGCAGCATGAAAATGG - Intronic
1101431784 12:104633019-104633041 CATTTTTCAGAGCATGCTCATGG + Intronic
1101509116 12:105376888-105376910 CATCTTAAACAGAATGATCAGGG + Intronic
1101876650 12:108600463-108600485 CATTTGTTACAGCAGCAACAGGG - Intergenic
1101990562 12:109480768-109480790 AATTTTCCACAGCATGCACATGG - Intronic
1102557187 12:113734874-113734896 CATTTTTAACAACATCCCCAGGG - Intergenic
1102745888 12:115248742-115248764 CTTTATTAGCAGCATGAAAATGG - Intergenic
1103856672 12:123974714-123974736 CATTTTTGACTGCTTTAACAAGG + Intronic
1104645780 12:130496422-130496444 CTTTATTAGCAGCATGAAAAAGG + Intronic
1104754574 12:131261131-131261153 CACTCTTAACAGCATCCACATGG - Intergenic
1104896030 12:132164033-132164055 CTTCTTTAACAGTACGAACACGG - Intergenic
1105530137 13:21211643-21211665 TATCTTTATCAGCATGAAAATGG + Intergenic
1105993279 13:25645074-25645096 CTTTATCAACAGCATGAAAACGG - Intronic
1106205684 13:27591841-27591863 TATTTTAAACAGCATGATCAAGG + Intronic
1106351983 13:28939775-28939797 CTTTGTTAGCAGCATGAAAACGG - Intronic
1106499075 13:30309691-30309713 CTTTATTAGCAGCATGAAAACGG + Intergenic
1106656212 13:31749651-31749673 CTTTTACTACAGCATGAACAGGG - Intronic
1106886015 13:34184820-34184842 CATTATAAACAGAATGAACAGGG - Intergenic
1108149660 13:47520504-47520526 CATATTTAACATCATAAAGATGG - Intergenic
1108266471 13:48713829-48713851 CTTTATTAGCAGCATGAAAATGG - Intergenic
1108778335 13:53795302-53795324 AATCTTTAAGAGAATGAACAGGG - Intergenic
1108858190 13:54821364-54821386 CTTTATTAGCAGCATGAAAATGG + Intergenic
1109311139 13:60695095-60695117 CACTTCTCACAGAATGAACAAGG - Intergenic
1109334963 13:60982064-60982086 CTTTATCAACAGCATGAAAATGG - Intergenic
1109672218 13:65623931-65623953 CATTTTTGACCTCATAAACAGGG - Intergenic
1109811335 13:67516889-67516911 CATTATCAACAACGTGAACACGG - Intergenic
1109863108 13:68225844-68225866 CTTTATTAGCAGCATGAAAATGG - Intergenic
1111399539 13:87716011-87716033 CTTTTTTAAAAGCCTAAACAGGG + Intergenic
1111482787 13:88853576-88853598 TATTTTTAAGATCAGGAACAGGG + Intergenic
1111514118 13:89305615-89305637 CATTTTAAATAGGATGAAAATGG + Intergenic
1111799503 13:92964530-92964552 CTTTATTAGCAGCATGAAAACGG + Intergenic
1111965672 13:94859178-94859200 CTTTTTTGACTGCATGAAAATGG + Intergenic
1112305309 13:98268092-98268114 CATTTTTAACTGGTTGAAGATGG + Intronic
1113157746 13:107343630-107343652 CTTTTTCAGCAGCATGAAAATGG + Intronic
1113170489 13:107496639-107496661 CTTTTTCAGCAGCATGAAAATGG - Intronic
1113470897 13:110545135-110545157 CTTTATTAGCAGCATGAACACGG + Intronic
1113497644 13:110744537-110744559 CTTTATTAGCAGCATGAAAATGG - Intergenic
1114147671 14:19995659-19995681 CATTATTCACAGCAAGGACATGG + Intergenic
1114507694 14:23231290-23231312 CATTTGTGACAGCATCAAGAAGG - Intronic
1114775912 14:25481023-25481045 TATTTATAACAGTATGAAAATGG + Intergenic
1114809222 14:25876762-25876784 CATCTTAAAAAGCATGAAAATGG - Intergenic
1115055746 14:29124399-29124421 CTTTATTAACAGCATGAGAAGGG - Intergenic
1115076807 14:29402927-29402949 CTTTATTAGCAGCATGAAAATGG - Intergenic
1115428516 14:33289293-33289315 CATATATAACAGCATCATCATGG - Intronic
1115934798 14:38540363-38540385 CATTTTGAACCTCATGGACAGGG + Intergenic
1116103807 14:40474772-40474794 CTTTATTAGCAGCATGAAAATGG - Intergenic
1116262188 14:42644579-42644601 CATTCTAAATAGCATGAAGACGG + Intergenic
1116303619 14:43218439-43218461 CTTTATCAACAGCATGAAAATGG - Intergenic
1116319284 14:43439490-43439512 CATTTTTAACAGCTTTATTAAGG + Intergenic
1116590222 14:46762079-46762101 CTTTATCAACAGCATGAAAATGG - Intergenic
1117958785 14:61143344-61143366 CTTTATCAACAGCATGAAAATGG - Intergenic
1117968984 14:61233869-61233891 CTTTTTTAGCAGCATGAGAATGG + Intronic
1118532880 14:66727296-66727318 CTTTATCAACAGCATGAAAATGG + Intronic
1119989583 14:79181114-79181136 TATTTTTAAAAGTATGAACTTGG + Intronic
1120133088 14:80830083-80830105 CATTTTCATCAGCAGGATCAAGG + Intronic
1120372940 14:83661348-83661370 AATTTTTAAAAGAATGCACAAGG + Intergenic
1121377327 14:93425049-93425071 CCTTTATAGCAGCATGAAAATGG - Intronic
1121409972 14:93743111-93743133 CAATTTTAAAACCAAGAACATGG - Intronic
1121479945 14:94258858-94258880 CTTTTTCAGCAGCATGAAAATGG - Intronic
1124225131 15:27887227-27887249 CTTTATTAGCAGCATGAAAATGG + Intronic
1125207376 15:37169435-37169457 CCTTATTAGCAGCATGAAAATGG - Intergenic
1125445170 15:39746491-39746513 CAATTTTAAAAGCATGCAGATGG + Intronic
1126532628 15:49727685-49727707 CTTTATCAACAGCATGAAAATGG + Intergenic
1126561728 15:50051366-50051388 CTTTATTAGCAGCATGAAAACGG + Intronic
1128313222 15:66644602-66644624 AATTTTAAACAGGAAGAACAAGG - Intronic
1128619415 15:69136318-69136340 CTTTATTAGCAGCATGAAAATGG - Intergenic
1128877006 15:71210026-71210048 CTTTATTATCAGCATGAAAACGG + Intronic
1129828948 15:78654592-78654614 TATTTTTCACAGCACGTACACGG - Intronic
1130095732 15:80854431-80854453 CATTTTTAACAGCATCTGTAGGG + Intronic
1131462723 15:92630033-92630055 CTTTATTAGCAGCATGAAAATGG + Intronic
1131937901 15:97527185-97527207 CTTTATTCACAGCATGAAAAGGG + Intergenic
1132133295 15:99305977-99305999 TATTTTTAACAACATGATTAAGG + Intronic
1132269205 15:100508264-100508286 CATTTCCAACAGGAAGAACAGGG - Intronic
1133431586 16:5741724-5741746 CATTTGTAACAGCTTCCACAAGG + Intergenic
1133698568 16:8288050-8288072 CTTTATTAACAGCATGAGAATGG - Intergenic
1134476237 16:14576108-14576130 CTTTATTAGCAGCATGAAAATGG + Intronic
1134566059 16:15252878-15252900 CTTTATTAAGAGCATGAAAATGG - Intergenic
1134736435 16:16503820-16503842 CTTTATTAAGAGCATGAAAATGG + Intergenic
1134815177 16:17199829-17199851 CTTTATTAGCAGCATGAAAATGG + Intronic
1134931079 16:18208348-18208370 CTTTGTTAAGAGCATGAAAATGG - Intergenic
1135209048 16:20508405-20508427 CTTTATTAGCAGCATGAAAATGG - Intergenic
1135828738 16:25754497-25754519 CTTTATTAACAGCATGAGAATGG - Intronic
1135919154 16:26632730-26632752 CTTTTTCAACAGCATGAACATGG - Intergenic
1138356022 16:56381004-56381026 CTTTATTAGCAGCATGAAAATGG - Intronic
1138730392 16:59187665-59187687 CATTTTTAACGTCATGCTCAAGG + Intergenic
1139049588 16:63107444-63107466 CATTTTAAACAGGGTGATCAGGG + Intergenic
1140592758 16:76372752-76372774 CTTTATCAACAGCATGAAAATGG + Intronic
1141841798 16:86578551-86578573 CATTTTTAAAGCCATGAAGAAGG + Exonic
1142368158 16:89661526-89661548 CTTTATTAGCAGCATGAAAACGG + Intronic
1144047234 17:11464969-11464991 CTTTTTGAATAGCATGAACCTGG - Intronic
1147036094 17:37682292-37682314 CATTTTAAACAGTATGGACAAGG - Intergenic
1149191242 17:54065689-54065711 CATTTTTCTCATCATGAAAATGG + Intergenic
1150135869 17:62694791-62694813 TATTTTAAATATCATGAACAGGG - Intergenic
1150579330 17:66457850-66457872 CTTTTTTAGCAGCATGAGAACGG + Intronic
1151363096 17:73600346-73600368 CCTTGTTAGCAGCACGAACAGGG - Intronic
1151462564 17:74263282-74263304 CATTTTTAAATGAATGAAAAGGG - Intergenic
1153076132 18:1164266-1164288 CTTTATTAGCAGCATGAAAACGG - Intergenic
1153323822 18:3798100-3798122 CTTTATTAGCAGCATGAAAATGG + Intronic
1153775003 18:8445051-8445073 GTTTATTAACAGCATGAAAATGG - Intergenic
1155235662 18:23816511-23816533 CATCTTTCACACCCTGAACATGG - Intronic
1155389546 18:25319758-25319780 CATCGTTAACAACATCAACATGG + Intronic
1155510218 18:26568844-26568866 TATTTTCAACAGTATCAACAAGG - Intronic
1155544879 18:26904572-26904594 CTTTGTTAGCAGCATGAAAATGG - Intergenic
1155675808 18:28426843-28426865 CTTTATCAGCAGCATGAACATGG + Intergenic
1155760188 18:29555623-29555645 CATTTCTATCATCATCAACAAGG + Intergenic
1155988234 18:32253293-32253315 CTTTATCAACAGCATGAAAATGG - Intronic
1156062049 18:33090622-33090644 CAGATTTAACAGCATCAATAAGG + Intronic
1156961113 18:43032302-43032324 CACGTCTAACAGCTTGAACAGGG - Intronic
1157374019 18:47146560-47146582 CATTTGTAACAGCCAGAAAATGG + Intronic
1158267478 18:55676438-55676460 CTTTATCAACAGCATGAAAACGG - Intergenic
1158701676 18:59754193-59754215 CTTTATTAGCAGCATGAAAACGG + Intergenic
1159533043 18:69679556-69679578 CATTTTAAACAGCATGATTATGG - Intronic
1159617380 18:70597499-70597521 CTTTATCAGCAGCATGAACACGG + Intergenic
1159650243 18:70970127-70970149 CTTTATCAACAGCATGAAAATGG - Intergenic
1159760394 18:72418926-72418948 CTTTATTAGCAGCATGAAAATGG + Intergenic
1159768086 18:72514846-72514868 CTTTATTAGCAGCATGAAAATGG - Intergenic
1159888360 18:73931987-73932009 CTTTATTAACAGCATGAGAATGG + Intergenic
1159933705 18:74342020-74342042 CATTTTTCATAGTATGAAAATGG + Exonic
1159962537 18:74566860-74566882 CTTTATCAACAGCATGAAAATGG - Intronic
1160423685 18:78766545-78766567 CAGTTTAAACAGCATGGCCATGG + Intergenic
1161948793 19:7455656-7455678 CTTTATCAGCAGCATGAACACGG - Intronic
1163242892 19:16075350-16075372 CATTTTTATTAAAATGAACATGG + Intronic
1164917277 19:32061985-32062007 CTTTATTAGCAGCATGAAAATGG + Intergenic
1165024562 19:32950190-32950212 TATTTTTGACAGGTTGAACAAGG - Intronic
1165667183 19:37642588-37642610 CAATTTAAACTCCATGAACATGG + Intronic
1167319187 19:48785399-48785421 TAGTTTTAACAGCATGCACCTGG - Intergenic
1167702086 19:51054840-51054862 CAATTTAAACAGCATGGTCAGGG - Intergenic
925354720 2:3231096-3231118 CATTTACAACAGCATCAAAAAGG - Intronic
925477351 2:4232129-4232151 CATTTGAAACAGCAGGAAAAGGG + Intergenic
925526862 2:4813027-4813049 CTTTATTAGCAGCATGAAAATGG - Intergenic
925737307 2:6975064-6975086 CTTTATTAGCAGCATGAAAATGG - Intronic
925796994 2:7556342-7556364 CTTTATTAACAGCATGAGAATGG - Intergenic
926392114 2:12403917-12403939 CTTTATTAACAGCATGAGAAAGG + Intergenic
926660696 2:15462852-15462874 CATTATTTAAAGGATGAACAAGG + Intronic
927368784 2:22330464-22330486 GATATTTATCAGCATGAACCAGG - Intergenic
928267395 2:29823295-29823317 CATTATCAGCAGCATGAAAATGG + Intronic
928587894 2:32780401-32780423 CATTTATAATAGTATGAAAAAGG - Intronic
928619924 2:33078168-33078190 CTGTTGTAACAGCATGAACTTGG + Intronic
928687365 2:33762530-33762552 CATTTTTAACAAAATGATAAAGG + Intergenic
928866873 2:35927621-35927643 CTTTATCAACAGCATGAAAATGG + Intergenic
929035524 2:37688005-37688027 CTTTATTAACAGCGTGAAAATGG - Intronic
929103820 2:38344023-38344045 CTTTATTACCAGCATGAAAATGG + Intronic
930261929 2:49157136-49157158 CATTTATAACAGCATAAAACAGG - Intergenic
930493093 2:52101810-52101832 CTTTATTAGCAGCATGAAAATGG - Intergenic
931039729 2:58283944-58283966 CTTTATTAAGAGCATGAAAATGG + Intergenic
931111817 2:59119138-59119160 CATTTTTAACATAATGAATTTGG - Intergenic
931952627 2:67382229-67382251 CTTTATTAGCAGCATGAAAATGG - Intergenic
933135960 2:78736072-78736094 CATTTTTAAAAAAATGACCAAGG + Intergenic
933156049 2:78976170-78976192 AATTTATAATAGCATCAACAAGG - Intergenic
933251238 2:80031290-80031312 CTTTATTAGCAGCATGAAAATGG - Intronic
933716307 2:85363604-85363626 CTTTATCAACAGCATGAAAACGG - Intronic
934324849 2:92003464-92003486 TATTTTTATCAGCATCAATAGGG - Intergenic
934960659 2:98669496-98669518 CTTTATTAGCAGCATGAAAATGG + Intronic
935393717 2:102582431-102582453 CATTTTGAACTGCATGATAATGG - Intergenic
935927934 2:108090172-108090194 CTTTATCAACAGCATGAAAATGG + Intergenic
935941786 2:108246323-108246345 CTTTATTAACAGCATGAAAAGGG - Intergenic
936259977 2:110950437-110950459 AATTTTTAACGGCATAAACAAGG + Intronic
936811595 2:116408743-116408765 CTTTATTAGCAGCATGAAAATGG + Intergenic
936833874 2:116683324-116683346 CATATTTAATATCATGAACTGGG + Intergenic
937208273 2:120251001-120251023 CATTGGTAACAGGATGCACAGGG - Intronic
937343464 2:121106699-121106721 GATTTTTATCTGCAGGAACAGGG - Intergenic
937497854 2:122443172-122443194 CTTTATTAGCAGCATGAAAACGG - Intergenic
938977374 2:136492760-136492782 CTTTTTTAACAGCATGTAATGGG - Intergenic
938995365 2:136672419-136672441 CTTTATCAACAGCATGAAAACGG + Intergenic
939094630 2:137820739-137820761 CTTTGTTAGCAGCATGAGCATGG - Intergenic
939310982 2:140475918-140475940 CATATCTAACAGCATAAATATGG + Intronic
939388870 2:141539846-141539868 CATTTTTAAGTGCTTGAAAAAGG - Intronic
939473604 2:142657006-142657028 AATTTTTAGCAACATGAACCAGG + Intergenic
939481820 2:142757789-142757811 TATTTTTAGCGGCATGATCAGGG + Intergenic
939482028 2:142761141-142761163 TATTTTGAACAGAATGAAAATGG + Intergenic
939508194 2:143074925-143074947 CTTTATCAACAGCATGAAAATGG + Intergenic
939842633 2:147207137-147207159 CTTTTTCAGCAGCATGAAAATGG - Intergenic
940161146 2:150714904-150714926 CTTTATTAGCAGCATGAAAATGG - Intergenic
940342560 2:152596537-152596559 GATTTTTAAGAGCATAAAAAGGG - Intronic
940941214 2:159563503-159563525 AATATTTAACAGCAACAACATGG + Intronic
941321712 2:164063717-164063739 CAATTCTAAATGCATGAACATGG + Intergenic
941421242 2:165285183-165285205 CATTTTGAACAAGATGAAGATGG + Intronic
941468758 2:165859769-165859791 CTTTATTAGCAGCATGAAAATGG - Intronic
942142622 2:172993062-172993084 CATTATTAGCAGCACCAACATGG - Intronic
942610654 2:177738976-177738998 CATTTTAAACTGCAGAAACAAGG - Intronic
943071739 2:183149224-183149246 AATTTTTAAGAGTATAAACAAGG - Intronic
943107773 2:183568212-183568234 CATTTAGAACAGCATAAACAAGG - Intergenic
943250104 2:185509330-185509352 CCTTTCTAGCAGCATGATCAAGG - Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944231980 2:197404876-197404898 CATTTTTAAAAATATAAACATGG + Intronic
944862450 2:203827916-203827938 CTTTATTAGCAGCATGAAAATGG + Intergenic
945133542 2:206600472-206600494 CTTTTTAAAAATCATGAACATGG + Intronic
945555655 2:211272102-211272124 CTATTTTTACAGCATTAACATGG - Intergenic
945628903 2:212246302-212246324 CATTTTAAGCAGCTTGAATACGG + Intronic
945643424 2:212460235-212460257 CTTTATTAGCAGCATGAAAATGG + Intronic
945784647 2:214217909-214217931 CATTTTTAAGAGTATAAAAAGGG - Intronic
946466083 2:219913420-219913442 CTTTATTAGCAGCATGAAAACGG - Intergenic
946569818 2:221011638-221011660 CATTTTTAGTAGCATAAACGGGG - Intergenic
946657074 2:221960145-221960167 CCTTTTTAGCAGCATGAGAATGG - Intergenic
946711942 2:222515633-222515655 CATATTTAACAGCTTTATCAAGG + Intronic
946759196 2:222976425-222976447 CATTTTTAAGAACATGAATTCGG - Intergenic
946863189 2:224019537-224019559 CATGGTGAACAGGATGAACAAGG - Intronic
946933007 2:224690154-224690176 TATTTTTAACAGTATTTACAAGG + Intergenic
946939625 2:224757434-224757456 CTTTATTAGCAGCATGAAAATGG + Intergenic
947096517 2:226572951-226572973 CTTTATTAACAACATGAAAATGG + Intergenic
1168778903 20:472075-472097 AAATTTTAACATCATGAGCAAGG - Intergenic
1169392552 20:5202377-5202399 CATTTTAAATAGGGTGAACAGGG + Intergenic
1169609566 20:7363913-7363935 CTTTATTAGCAGCATGAAAATGG + Intergenic
1169609826 20:7365819-7365841 CTTTATCAACAGCATGAAAATGG + Intergenic
1170211707 20:13851826-13851848 CAGTTTTAACAGCATCCTCAAGG - Intronic
1173994634 20:47328280-47328302 CATTTTTATAAGCATGGAGAGGG + Intronic
1174266651 20:49336840-49336862 TATTTTTAAAAGCCTGATCAAGG + Intergenic
1174517782 20:51106379-51106401 CTTTTTCAGCAGCATGAAAATGG - Intergenic
1174917293 20:54666826-54666848 CATTATCAGCAGCATGAAAATGG + Intergenic
1174950137 20:55033749-55033771 CATTTATAACAATAGGAACAGGG - Intergenic
1175195497 20:57240588-57240610 CTTTTTCAGCAGCATGAAAATGG - Intronic
1175663881 20:60841897-60841919 CTTTATCAACAGCATGAAAATGG - Intergenic
1176589740 21:8634995-8635017 CTTTTTTAACAACATAAATATGG - Intergenic
1176594275 21:8677223-8677245 TATTTTTATCAGCATCAATAGGG - Intergenic
1176717105 21:10361622-10361644 CATTTTTAACAACATGGATGAGG - Intergenic
1177344888 21:19855376-19855398 CTTTGTTAGCAGCATGAAAATGG - Intergenic
1177614530 21:23499996-23500018 CTTTATTAGCAGCATGAAAAAGG - Intergenic
1177789249 21:25704844-25704866 CATTAATAACATGATGAACATGG - Intronic
1178004200 21:28197788-28197810 CATTATCAGCAGCATGAAAACGG - Intergenic
1178267544 21:31158051-31158073 CATTTTTAAGAGTGTGAACAGGG + Intronic
1178911062 21:36674150-36674172 CTTTATTAGCAGCATGAAAACGG - Intergenic
1180272574 22:10612010-10612032 CTTTTTTAACAACATAAATATGG - Intergenic
1180277128 22:10654357-10654379 TATTTTTATCAGCATCAATAGGG - Intergenic
1180601230 22:17018353-17018375 CATTTTTAACAACATGGATGAGG + Intergenic
1182186545 22:28409110-28409132 AATTTTTCACAGCAGGAAAAGGG - Intronic
1184051258 22:42006571-42006593 CATTTTTAACAGAAGAAAAATGG - Intronic
1184862231 22:47179108-47179130 CTTTATTAACAGCATGAGAATGG + Intergenic
949137550 3:586706-586728 CTTTTTTAACAACATAAATATGG + Intergenic
949631590 3:5933842-5933864 CATTGTTAACTGCATAATCATGG + Intergenic
949721255 3:6992961-6992983 CTTTATTAACAGTATGAAAACGG - Intronic
949875282 3:8622665-8622687 CATTTTTATCTACATGAATACGG - Intronic
951041827 3:17996404-17996426 CATTTTTTACAGTATTAATAAGG - Intronic
951164847 3:19472648-19472670 CTTTTTCAGCAGCATGAAAATGG + Intronic
951360385 3:21717876-21717898 CTTTATTAACAGCATAAAAATGG + Intronic
952308445 3:32166307-32166329 AATTTTAACCAGCATTAACATGG + Exonic
953503589 3:43461769-43461791 CTTTATCAACAGCATGAAAATGG + Intronic
954548967 3:51464175-51464197 CTTTTTTAAAAGCATAAGCAGGG + Intronic
954889938 3:53917057-53917079 CATTTATAATAGCATCAAAAAGG - Intergenic
957509954 3:81174689-81174711 CATTTGTATCAGCATAAATACGG + Intergenic
957954269 3:87163690-87163712 CTTTATCAACAGCATGAAAACGG - Intergenic
958468292 3:94485272-94485294 CTTTATTAACAGCATGAGAATGG - Intergenic
958598146 3:96257094-96257116 CATTTTGAACAACATAAAGATGG + Intergenic
958611734 3:96435677-96435699 CTTTATTAGCAGCATGAACATGG - Intergenic
958798401 3:98730949-98730971 AGTTTTTAAGATCATGAACAAGG + Intergenic
959395505 3:105832492-105832514 CATTTTAAAAAGGATGAAAAGGG - Intronic
959788674 3:110331604-110331626 CTTTATCAACAGCATGAAAATGG - Intergenic
960478486 3:118159669-118159691 CTTTATTAACAGCATGAGAACGG + Intergenic
962166731 3:133057161-133057183 CGTTTTAAATAGAATGAACAAGG - Intronic
962380617 3:134895798-134895820 CATTTTGAAAAGGATGGACAGGG + Intronic
962488682 3:135869275-135869297 CTTTATCAACAGCATGAAAATGG - Intergenic
963492827 3:146022388-146022410 CTTTATCAACAGCATGAAAATGG + Intergenic
963552839 3:146745885-146745907 CAGTTCTAAAATCATGAACATGG + Intergenic
963553386 3:146754111-146754133 CTTTATCAGCAGCATGAACACGG - Intergenic
964233116 3:154493554-154493576 CTTTTTTAGCAGCATGCAAACGG + Intergenic
964286756 3:155126254-155126276 CATTTTTATCACCATGAACTGGG + Intronic
964559573 3:157979090-157979112 CATTATTCTCAGCATGAAAATGG + Intergenic
965117047 3:164503350-164503372 CATTTGTAACAGAATGAAATTGG - Intergenic
965657554 3:171004558-171004580 CATTTTTAACAGCAACAAAAGGG + Intronic
965809515 3:172577572-172577594 CTTTATCAACAGCATGAAAATGG + Intergenic
965864214 3:173184361-173184383 CTTTATCAACAGCATGAAAAAGG + Intergenic
965931271 3:174045177-174045199 CTTTATTAGCAGCATGAAAACGG - Intronic
965957250 3:174386234-174386256 CTTTATTAGCAGCATGAAAATGG - Intergenic
966023897 3:175251287-175251309 CATTTTTATAACCAAGAACAAGG - Intronic
966461269 3:180179604-180179626 CATTTTAAGCAATATGAACAAGG - Intergenic
966475558 3:180341015-180341037 GATTTTTAAAAACATTAACAAGG - Intergenic
966619455 3:181947790-181947812 CATTGTTCACAGTGTGAACAGGG - Intergenic
966635131 3:182124435-182124457 CAATTTTACAAGCATGACCAGGG + Intergenic
966830677 3:184005620-184005642 CATTAAAAAAAGCATGAACAGGG + Intronic
967596908 3:191336587-191336609 GGTTTTTAAAAGCATGGACATGG - Intronic
969878525 4:10154170-10154192 GATTTTTAGCAGCAAGACCAGGG - Intergenic
969889499 4:10246713-10246735 CCTTTTTAAGAGCATAAACCTGG - Intergenic
970058493 4:12002197-12002219 CATTTGTGACAACATGAACATGG + Intergenic
970094310 4:12445264-12445286 CTTTATTAGCAGCATGAAAATGG - Intergenic
970361858 4:15317680-15317702 CATTTTTAACATCTTGAAAATGG - Intergenic
970635320 4:18004277-18004299 CTTTGTTAGCAGCATGAAAATGG - Intronic
971793460 4:31198361-31198383 CTTTATTAGCAGCATGAAAATGG - Intergenic
972128816 4:35803088-35803110 CTTTATCAGCAGCATGAACACGG - Intergenic
972138836 4:35929656-35929678 CATTTTTAACTGCATCTTCAGGG - Intergenic
972381050 4:38520777-38520799 CTTTATTAGCAGCATGAAAACGG + Intergenic
972714306 4:41630525-41630547 CATCTCTAACATCATAAACAAGG - Intronic
972966784 4:44520183-44520205 CTTTATTAGCAGCATGAAAATGG - Intergenic
973220151 4:47716864-47716886 TATTTTTAACAGTATGAAAGTGG - Intronic
973248441 4:48035995-48036017 TATTTTTAAAAGCATGTAGAAGG - Exonic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973845339 4:54906672-54906694 CATTTTTGAATCCATGAACATGG - Intergenic
973957469 4:56077089-56077111 CATTTCTAGCAGCATGAGAATGG - Intergenic
974624905 4:64412905-64412927 CATTTTTAACATTAACAACAAGG + Intergenic
974642272 4:64646553-64646575 CTTTATTAGCAGCATGAAAATGG - Intergenic
975257452 4:72254819-72254841 CTTTATTAGCAGCATGAAAATGG + Intergenic
975371796 4:73597690-73597712 TATTTATAACAGCAAGCACATGG + Intronic
975804426 4:78097434-78097456 CTTTATTAGCAGCATGAAAATGG - Intronic
976315399 4:83654245-83654267 CATTTTAAAAAGACTGAACAAGG - Intergenic
976496612 4:85737580-85737602 TATTTTGAGCAGCAAGAACATGG - Intronic
976529009 4:86128628-86128650 CTTTTTTAACAGCATGAGAATGG + Intronic
976954282 4:90875979-90876001 CATTTTAAAAATCATGAATAGGG + Intronic
977096032 4:92745451-92745473 CATGTTAAACAGTATAAACATGG - Intronic
977475275 4:97499673-97499695 AATTTTTAATAGCATGGTCAGGG + Intronic
977512195 4:97974809-97974831 CTTTATCAGCAGCATGAACATGG + Intronic
978094833 4:104763191-104763213 GATGTTTCAGAGCATGAACATGG - Intergenic
978170361 4:105662570-105662592 CATATTTTACAACATGAACCAGG - Intronic
978195919 4:105971853-105971875 TTTTTTTATCAGCATGAACAGGG + Intronic
978375577 4:108072154-108072176 CATTTTAAAAAACATGAACAGGG - Intronic
978915561 4:114123003-114123025 TATCTTTAACAGCATGAAAATGG - Intergenic
979127225 4:116989791-116989813 AATTTTTAACAGAGTGAAAAGGG - Intergenic
979500343 4:121433406-121433428 CTTTATCAACAGCATGAACATGG - Intergenic
979594521 4:122519527-122519549 CCTTATTAGCAGCATGAAAATGG + Intergenic
979741032 4:124151263-124151285 CATTTTTAAAAGAATGAATGGGG + Intergenic
979922842 4:126523691-126523713 CTTTATCAGCAGCATGAACATGG - Intergenic
980225556 4:129979510-129979532 AATTTTTATCATCATTAACAGGG + Intergenic
980683591 4:136196101-136196123 TATTTTTAACATGATGACCAGGG + Intergenic
981030241 4:140118182-140118204 AATTTTTAAAAGATTGAACACGG - Intronic
981483688 4:145262957-145262979 CTTTATTAGCAGCATGAAAAAGG + Intergenic
982611821 4:157584082-157584104 CATTATCAGCAGCATGAAAATGG - Intergenic
982762245 4:159299253-159299275 CAGTTATAACAGAATGCACAAGG - Intronic
982796826 4:159655839-159655861 CATGTCTAACAAAATGAACAAGG - Intergenic
983004965 4:162473024-162473046 TATTTTGAAGAGCATGAAAATGG - Intergenic
983119076 4:163858169-163858191 CATATTAAACACCATGAGCATGG + Intronic
983470818 4:168152209-168152231 AATTTTAAACAGGATAAACAGGG + Intronic
983478418 4:168243187-168243209 CTTTATCAGCAGCATGAACATGG + Intronic
983717545 4:170803750-170803772 CATGTTTGAAAGCATGAATAAGG - Intergenic
983887812 4:173000433-173000455 CGTTTTTAAATCCATGAACATGG - Intronic
984109206 4:175589961-175589983 CATTTCAAACAGCAGGAAAATGG - Intergenic
984291248 4:177797467-177797489 CATTTTTAAAAGAATGATAATGG + Intronic
984390547 4:179126149-179126171 CTTGTTTAACAGCTTTAACAAGG + Intergenic
984410037 4:179386295-179386317 CTTTATTAGCAGCATGAAAATGG - Intergenic
985052004 4:186000427-186000449 GTTTTTAAATAGCATGAACATGG - Intergenic
986009995 5:3705378-3705400 CATTTATAACAATATGAAGATGG - Intergenic
986401694 5:7388423-7388445 CATTTATATCACTATGAACAAGG - Intergenic
986906787 5:12503995-12504017 CTTTATTAACAGCATGACAATGG + Intergenic
987651037 5:20740149-20740171 CTTTATAAACAGCATGAAAATGG + Intergenic
987998533 5:25317312-25317334 CATTTTAGACAGGATGACCAGGG - Intergenic
988076986 5:26365647-26365669 TATTTATAGCAGCATGAAAATGG + Intergenic
988204234 5:28114348-28114370 CTTTATCAGCAGCATGAACATGG - Intergenic
989529025 5:42485169-42485191 AATTTATAACAGCAAGACCATGG - Intronic
990372325 5:55132822-55132844 TATTGTTAACAGCATGAAGAAGG - Intronic
990432383 5:55748942-55748964 CAATTTTAAGAGCATGAAAAGGG - Intronic
990941573 5:61207466-61207488 CTTTATCAACAGCATGAAAATGG - Intergenic
990975304 5:61555426-61555448 TCTTTTTAGCAGCATGAAAATGG - Intergenic
991143355 5:63273079-63273101 CTTTATCAGCAGCATGAACATGG - Intergenic
991241015 5:64459755-64459777 GAATTTTAAAAGCATGAAGAAGG + Intergenic
991586726 5:68209853-68209875 CCTTATTAGCAGCATGAAAATGG - Intergenic
992386168 5:76286633-76286655 CTTTATTAGCAGCATGAAAATGG - Intronic
994105061 5:95938315-95938337 CACTTTTCCCAGAATGAACAAGG - Intronic
994221652 5:97202867-97202889 CATTTTCAAAAGTATGTACAAGG + Intergenic
994357603 5:98811535-98811557 CATTTTCAACAGCATGAACAAGG - Intergenic
995129448 5:108613926-108613948 CTTTATCAACAGCATGAAAAAGG + Intergenic
995272948 5:110243311-110243333 CATTTTTATAAGCACCAACATGG - Intergenic
996073833 5:119165570-119165592 CTTTATTAGCAGCATGAAAACGG - Intronic
996179863 5:120406275-120406297 CTTTATTAGCAGCATGAAAATGG + Intergenic
996670473 5:126112346-126112368 CATTATCAGCAGCATGAAAATGG + Intergenic
997056841 5:130453579-130453601 CTTTATTAGCAGCATGAAAATGG - Intergenic
997620031 5:135281982-135282004 CTTTATTAGCAGCATGAACACGG + Intronic
998567460 5:143228827-143228849 ATTTTTTAAAAGCCTGAACATGG - Intronic
998639904 5:143997589-143997611 CTTTATCAACAGCATGAAAATGG + Intergenic
999581606 5:153044773-153044795 CATGTTTAGCAATATGAACATGG + Intergenic
1000571963 5:162925629-162925651 CTTTTTCAGCAGCATGAAAACGG - Intergenic
1000639312 5:163682695-163682717 CTTTATTAGCAGCATGAAAATGG + Intergenic
1000746294 5:165037913-165037935 CTTTATTAGCAGCATGAAAATGG + Intergenic
1001181496 5:169525153-169525175 CTTTATCAACAGCATGAAAATGG - Intergenic
1001503710 5:172259439-172259461 CATTTTTAAAACCCTCAACAGGG - Intronic
1002333388 5:178461067-178461089 CATTTTTGGCAGCAGGACCAGGG + Intronic
1002631250 5:180580710-180580732 CATTTTTAATCAAATGAACAAGG + Intergenic
1003371190 6:5528393-5528415 CACTTTAAACATCCTGAACATGG - Intronic
1003877310 6:10450324-10450346 CATTTTTACCAACCTGAAGAAGG - Intergenic
1003942110 6:11039873-11039895 CATTTCTGACAACATGAAAAAGG + Intronic
1004679703 6:17881221-17881243 CATTTTTAAGAGCCTGATAAAGG - Intronic
1008120579 6:47611842-47611864 AAATTTTAGCAGCATGAAAATGG + Intronic
1009517707 6:64641081-64641103 CATTATCAACAGAATGAAAATGG - Intronic
1009632264 6:66214381-66214403 CATTTTTACCAGTTTGCACAGGG - Intergenic
1009827878 6:68890973-68890995 CCTTATCAACAGCATGAAAACGG - Intronic
1010282490 6:74037624-74037646 CATTATCAGCAGCATGAAAATGG + Intergenic
1011124335 6:83990626-83990648 CATTTTTACTTGAATGAACAAGG + Intergenic
1011144402 6:84196419-84196441 CTTTATCAACAGCATGAAAATGG + Intronic
1011391392 6:86857785-86857807 CATTTGCAACAACATGAACCTGG - Intergenic
1011439287 6:87370206-87370228 CTTTATCAACAGCATGAAAATGG - Intronic
1011791615 6:90905078-90905100 CATTTCTACCTGCATTAACATGG - Intergenic
1011834133 6:91408931-91408953 CATCATTAGCAGCATGAAAATGG + Intergenic
1012221267 6:96652117-96652139 CATTTACAGCAGCATGAAGAGGG + Intergenic
1012379594 6:98604342-98604364 AATTTTAAACAGACTGAACAAGG + Intergenic
1012691642 6:102320244-102320266 CTTTTTTAGCAGCATGAAAATGG + Intergenic
1012907838 6:105088592-105088614 CTTTATCAACAGCATGAAAACGG + Intergenic
1013031409 6:106336801-106336823 CATTTCTAGCAGAATGAACATGG - Intergenic
1013300057 6:108796443-108796465 CTTTTTTAACAACCTGCACATGG + Intergenic
1013503145 6:110772140-110772162 CTTTATTAACAGCATGAAAACGG - Intronic
1013651252 6:112197144-112197166 TATTTTTATCATCATGATCATGG + Intronic
1013816802 6:114108853-114108875 CATTTTTAACAGCTTTATTAAGG - Intronic
1013823499 6:114183481-114183503 CTTTATTAGCAGCATGAAAATGG + Intronic
1014582636 6:123157798-123157820 CTTTATTAGCAGCATGAAAATGG + Intergenic
1014596845 6:123354281-123354303 CATTTTTAACAAAAAGAATAAGG - Intronic
1014636551 6:123854213-123854235 GATTTTGTACAGCATGAAAAAGG - Intronic
1014841676 6:126227104-126227126 CTTTATTAGCAGCATGAAAATGG + Intergenic
1014842144 6:126232560-126232582 CATTTTCATCAGGGTGAACAAGG - Intergenic
1015053686 6:128874413-128874435 CTTTATTAGCAGCATGAAAATGG + Intergenic
1015216999 6:130761869-130761891 CTTTTTTAGCAGCATGAGAACGG - Intergenic
1015481076 6:133710672-133710694 CTTTATTAGCAGCATGAAAATGG - Intergenic
1015490798 6:133823444-133823466 CTTTATCAACAGCATGAAAATGG - Intergenic
1016142350 6:140627846-140627868 CATTATTAGCAGCATGAGAATGG - Intergenic
1016241768 6:141939712-141939734 CTTTATTAGCAGCATGAAAATGG + Intergenic
1016792284 6:148078687-148078709 CATTTTTAACTGCATGATGTTGG - Intergenic
1017580621 6:155860347-155860369 CTTTATTAGCAGCATGAAAATGG + Intergenic
1017790558 6:157794381-157794403 CTTTATTAGCAGCATGAAAACGG + Intronic
1019318107 7:400806-400828 GACATTTAACAGCATGGACATGG + Intergenic
1020239913 7:6385945-6385967 CAATTTTTACAGCATTGACAAGG - Intronic
1020456165 7:8375355-8375377 CTTTATCAACAGCATGAAAATGG + Intergenic
1020600120 7:10264127-10264149 CAATTTTTACATCAGGAACAGGG + Intergenic
1020730112 7:11869573-11869595 CTTTTTCAGCAGCATGAAAATGG - Intergenic
1021019830 7:15583541-15583563 CATTTTTAACTGCTTCAGCAAGG - Intergenic
1021104944 7:16627072-16627094 AATTGTCATCAGCATGAACATGG - Exonic
1021155376 7:17203467-17203489 CATCTTTACCAGCATGAACATGG - Intergenic
1021590276 7:22254005-22254027 TATTTTTAACAGTATAAATAAGG - Intronic
1021608801 7:22436078-22436100 CATTTTACACAGTAGGAACAAGG - Intronic
1022106000 7:27198811-27198833 CATTTTTGAGAGAATGAATAGGG + Intronic
1022707178 7:32813546-32813568 CATTTTTAACACCATCCACGTGG + Intergenic
1022966142 7:35474145-35474167 CATTATCAGCAGCATGAAAATGG + Intergenic
1023786772 7:43716104-43716126 CTTTATCAACAGCATGAAAACGG + Intronic
1024792932 7:52986563-52986585 CTTTATTACCAGCATGAAAATGG + Intergenic
1026225653 7:68437768-68437790 CTTTATTAGCAGCATGAAAACGG + Intergenic
1026403454 7:70039706-70039728 CATTTTTACCAGTAAGAACTGGG - Intronic
1026459123 7:70597886-70597908 GATTTTCAACAGGATGATCAGGG + Intronic
1027719238 7:81718182-81718204 AATTTTAAAAAGCTTGAACATGG + Intronic
1027834323 7:83220328-83220350 CTTTATTAGCAGCATGAAAATGG + Intergenic
1027842957 7:83337799-83337821 CTTTATTAACAGCATGAGAAGGG - Intergenic
1028041826 7:86062979-86063001 CTTTATTAGCAGCATGAAAACGG + Intergenic
1028070526 7:86444316-86444338 CTTTATTAGCAGCATGAAAATGG + Intergenic
1028326178 7:89527908-89527930 CTTTATTAGCAGCATGAAAATGG - Intergenic
1028496414 7:91465884-91465906 AATTTTAAACAGCAGGAAAAGGG - Intergenic
1028724867 7:94075620-94075642 CCTTTTTAACAGCATAGACAAGG + Intergenic
1028746601 7:94334390-94334412 ATCTTTTAACAGCATGAATATGG - Intergenic
1028884286 7:95913672-95913694 CTTTATTAACAGCATGAGAAAGG + Intronic
1030225526 7:107146126-107146148 CATTTTTCCCAGCAGGCACATGG + Intronic
1031194092 7:118590429-118590451 CTTTATTAACAGCATGAGAACGG + Intergenic
1031536382 7:122938699-122938721 GATTTTTCCCACCATGAACATGG + Intergenic
1031825240 7:126557037-126557059 CATTTTTCAGAGCAAGAATAGGG - Intronic
1032412349 7:131705608-131705630 TATTTTTAAAATCAGGAACAAGG - Intergenic
1032796856 7:135284459-135284481 CACTTTTCACAGCATGAACGGGG + Intergenic
1033581250 7:142738520-142738542 CAGTTTGAAAAGCATGAAAAGGG + Intergenic
1034037173 7:147837114-147837136 CTTTATTAGCAGCATGAAAATGG - Intronic
1035371160 7:158379771-158379793 CTTTATTAGCAGCATGAAAAAGG - Intronic
1035744738 8:1953629-1953651 AATTTTTAACAGCACGAAACAGG + Intronic
1036593686 8:10192848-10192870 CGTTTATAACAGCATGTTCATGG + Intronic
1036931219 8:12957966-12957988 TATTTTTAACAGCAACAAAAAGG - Intronic
1037310826 8:17554196-17554218 CATTTTTAGCAGCAACAACTTGG - Intronic
1037363822 8:18102040-18102062 CTTTATTAGCAGCATGAAAATGG - Intergenic
1037532923 8:19795589-19795611 CTTTATTAGCAGCATGAAAATGG + Intergenic
1037739087 8:21590961-21590983 CATTTTTAACAGCCCAATCAGGG + Intergenic
1038159389 8:25022493-25022515 CTTTATTAACAGCATGAGAATGG - Intergenic
1038853481 8:31304255-31304277 CATTTGTGACAACATGAACCTGG - Intergenic
1039946858 8:42137380-42137402 TGTTTTTAACAGGATGAATATGG - Intergenic
1042130302 8:65581447-65581469 CATTATCAGCAGCATGAAAACGG - Intergenic
1042226890 8:66521220-66521242 AATTTTTAACAGGAAGAGCATGG - Intergenic
1042689175 8:71478234-71478256 TATTTTTAAGAGCATGTAAAAGG + Intronic
1043093104 8:75929322-75929344 CTTTATTAGCAGCATGAAAATGG - Intergenic
1043101835 8:76057360-76057382 CATATATAGCAGCATAAACATGG - Intergenic
1043247620 8:78025456-78025478 CATTTATAACATCTTGAAAAGGG + Intergenic
1043255066 8:78124614-78124636 TATATTTAACAACATGAAAATGG + Intergenic
1043266135 8:78269849-78269871 CTTTATTAACAGCATGAGAATGG - Intergenic
1043595295 8:81878460-81878482 CTTTATTAACAGCATGAGAATGG + Intergenic
1044184283 8:89233905-89233927 TATTTATAACAACAGGAACAGGG - Intergenic
1044193901 8:89352324-89352346 CTTTATTAGCAGCATGAAAATGG - Intergenic
1044333660 8:90950545-90950567 CATATTTAACACCCTAAACATGG - Intronic
1044439052 8:92201509-92201531 CTTTATTAGCAGCATGAAAACGG - Intergenic
1044691558 8:94885123-94885145 CATCTTTAAGAGCATCAACTTGG + Exonic
1045597301 8:103670956-103670978 CATTATCAACAGCATGAAAATGG - Intronic
1045735853 8:105295948-105295970 CTTTATTAGCAGCATGAAAATGG - Intronic
1045808626 8:106195156-106195178 CAGATTTAATAGCAGGAACAAGG - Intergenic
1045939909 8:107727447-107727469 CTTTATTAGCAGCATGAAAATGG - Intergenic
1046477970 8:114773872-114773894 CTTTATTAGCAGCATGAAAATGG - Intergenic
1047026157 8:120826720-120826742 CCTTTTCAGCAGCATGAAAAGGG + Intergenic
1047149311 8:122242364-122242386 CTTTATCAACAGCATGAAAATGG + Intergenic
1047488028 8:125350493-125350515 CTTTATCAACAGCATGAAAATGG - Intronic
1047489421 8:125362388-125362410 CATTTTGTCCAGCATGAATAAGG - Intronic
1047823853 8:128551661-128551683 CCTTTTTAAGAACAAGAACAAGG - Intergenic
1047917885 8:129602789-129602811 TCTTTATAACAGCATGAAAATGG - Intergenic
1048057327 8:130880190-130880212 CTTTTTCAGCAGCATGAAAATGG + Intronic
1048189130 8:132272483-132272505 CTTTATCAACAGCATGAAAATGG - Intronic
1048218058 8:132514879-132514901 CATTTTAAATATCTTGAACATGG - Intergenic
1048598201 8:135889300-135889322 CAATTTGAATAGGATGAACAAGG - Intergenic
1048858215 8:138702040-138702062 CATTTTTAAAAGCATGTATAAGG - Intronic
1051088342 9:13378245-13378267 TATTTTTCACAAGATGAACATGG + Intergenic
1052217911 9:25989328-25989350 CTTTATTAGCAGCATGAAAATGG - Intergenic
1052271666 9:26634109-26634131 CATTTTCAGCAGCATGAAAATGG - Intergenic
1052311418 9:27073128-27073150 CTTTATTAGCAGCATGAAAATGG + Intergenic
1052414345 9:28158090-28158112 CTTTATTAGCAGCATGAAAATGG - Intronic
1053397921 9:37791393-37791415 CTTTATCAACAGCATGAAAATGG - Intronic
1053693297 9:40610817-40610839 TATTTTTATCAGCATCAACAGGG - Intergenic
1053940281 9:43241212-43241234 TATTTTTATCAGCATCAACAGGG - Intergenic
1054271535 9:63029270-63029292 TATTTTTATCAGCATCAACAGGG + Intergenic
1054304540 9:63410045-63410067 TATTTTTATCAGCATCAACAGGG - Intergenic
1054403286 9:64734064-64734086 TATTTTTATCAGCATCAACAGGG - Intergenic
1054436908 9:65219554-65219576 TATTTTTATCAGCATCAACAGGG - Intergenic
1054493489 9:65802440-65802462 TATTTTTATCAGCATCAACAGGG + Intergenic
1054922626 9:70557341-70557363 CATTTTTACCATCATCATCATGG - Intronic
1055037402 9:71832536-71832558 CTTCTCTAACACCATGAACAGGG - Intergenic
1055534733 9:77228704-77228726 CTTCATTAACAGCATGAAAATGG - Intronic
1056008407 9:82299445-82299467 CATTTTTTAAAGCCTGAAAATGG - Intergenic
1056505374 9:87253361-87253383 CTTTATCAGCAGCATGAACACGG - Intergenic
1057541292 9:95973935-95973957 CATGTTTAACTGCATGGAGAGGG - Intronic
1058230222 9:102416401-102416423 CTTTATCAACAGCATGAAAATGG + Intergenic
1058335155 9:103818888-103818910 TGTTTTTAAAGGCATGAACATGG + Intergenic
1059303781 9:113338171-113338193 CATTATGAACAGTATTAACAAGG - Intronic
1059490746 9:114665574-114665596 CTTTATTAACAGCATGAGAACGG - Intergenic
1059590500 9:115654721-115654743 CATGTTTAACTTCATAAACATGG - Intergenic
1060761155 9:126249933-126249955 CTTTATTAGCAGCATGAAAATGG - Intergenic
1060784325 9:126438093-126438115 CATTTTTAACTGTATGAATTAGG - Intronic
1186014993 X:5181287-5181309 AATTTTTAAAAGAATGAATAAGG + Intergenic
1186140798 X:6571231-6571253 CATTTTTATCAGAATACACATGG + Intergenic
1186156043 X:6727978-6728000 CTTTATTAGCAGCATGAAAATGG - Intergenic
1186264790 X:7820634-7820656 CTTTTTCAGCAGCATGAAAACGG - Intergenic
1187948953 X:24453179-24453201 CTTTATTAGCAGCATGAAAATGG + Intergenic
1188010979 X:25055637-25055659 CTTTATTAGCAGCATGAAAATGG - Intergenic
1188635208 X:32421408-32421430 CACCTTGAACAGCAGGAACATGG + Intronic
1188907780 X:35808892-35808914 CTTTATTAGCAGCATGAAAACGG + Intergenic
1190149577 X:47932956-47932978 CATTTTTTACTCCATGAGCATGG + Intronic
1191094789 X:56662512-56662534 CATTACTAACAGCATGAGAATGG + Intergenic
1191914844 X:66190260-66190282 CATTTTCAACATATTGAACAGGG + Intronic
1192489824 X:71566314-71566336 CCTTTATAGCAGCATGAAAACGG - Intronic
1192722762 X:73717094-73717116 CTTTATTAGCAGCATGAAAATGG - Intergenic
1192742323 X:73905250-73905272 CTTTATTAGCAGCATGAAAATGG + Intergenic
1192920134 X:75697593-75697615 CTTTATCAACAGCATGAAAATGG - Intergenic
1193003967 X:76595647-76595669 CTTTATTAGCAGCATGAAAACGG - Intergenic
1193209022 X:78783618-78783640 CTTTGTTAGCAGCATGAAAATGG + Intergenic
1193226597 X:78990774-78990796 CTTTATCAACAGCATGAAAATGG + Intergenic
1193331368 X:80238744-80238766 CTTTATTAGCAGCATGAAAATGG - Intergenic
1193969857 X:88038075-88038097 CTTTATTAGCAGCATGAAAATGG + Intergenic
1194145743 X:90260237-90260259 CTTTATTAACAGCATGAGAACGG - Intergenic
1194174086 X:90625288-90625310 CATTTTTTACAACATGGAGAGGG + Intergenic
1194220366 X:91182498-91182520 CATTATCAGCAGCATGAAAACGG + Intergenic
1194777438 X:97982166-97982188 CATTTTCAACTCCATCAACAGGG + Intergenic
1194814274 X:98423471-98423493 TATTTTTAACAGTATGAGAATGG + Intergenic
1194864808 X:99053074-99053096 CATTATCAGCAGCATGAAAATGG + Intergenic
1196579284 X:117360669-117360691 CTTTATTAGCAGCATGAAAACGG + Intergenic
1196594635 X:117529955-117529977 CATTTTAAACAGAATTGACATGG - Intergenic
1196730118 X:118932744-118932766 CATATTTAACTGAATGAAAATGG - Intergenic
1196871495 X:120116575-120116597 CATATTTGGCAGCATGCACAGGG + Intergenic
1197471820 X:126872825-126872847 CCTTTTTAGCAGCATGAGAATGG - Intergenic
1197566886 X:128099301-128099323 CTTTATTAGCAGCATGAAAATGG - Intergenic
1198046397 X:132907515-132907537 CAGTTTCAACAGCATTAACTTGG - Intronic
1198085392 X:133277588-133277610 CTTTATTAGCAGCATGAAAATGG + Intergenic
1198531126 X:137550166-137550188 CATTTTTACCAGCACGTCCAGGG - Intergenic
1198662907 X:138990433-138990455 CTTTATCAACAGCATGAAAATGG - Intronic
1198689933 X:139269932-139269954 CATTTTTAAATGCATAATCAAGG + Intergenic
1200491494 Y:3829532-3829554 CTTTATTAACAGCATGAGAACGG - Intergenic
1200556879 Y:4646250-4646272 CATTATCAGCAGCATGAAAACGG + Intergenic
1200616107 Y:5381383-5381405 AATTTTTAACAGGATGGTCAGGG - Intronic
1201959226 Y:19660396-19660418 CTTTATTAGCAGCATGAAAACGG - Intergenic
1202019752 Y:20452073-20452095 CCTTATTAGCAGCATGAAAATGG + Intergenic