ID: 1085350217

View in Genome Browser
Species Human (GRCh38)
Location 11:75793425-75793447
Sequence GTCACCCAGTGGGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085350217_1085350222 1 Left 1085350217 11:75793425-75793447 CCACCTGGGGCCCACTGGGTGAC 0: 1
1: 0
2: 5
3: 22
4: 214
Right 1085350222 11:75793449-75793471 CATCTTCATCCAGCAGCCCAGGG 0: 1
1: 0
2: 3
3: 22
4: 276
1085350217_1085350226 18 Left 1085350217 11:75793425-75793447 CCACCTGGGGCCCACTGGGTGAC 0: 1
1: 0
2: 5
3: 22
4: 214
Right 1085350226 11:75793466-75793488 CCAGGGAAAAGTGCAGCGACTGG 0: 1
1: 0
2: 1
3: 17
4: 215
1085350217_1085350221 0 Left 1085350217 11:75793425-75793447 CCACCTGGGGCCCACTGGGTGAC 0: 1
1: 0
2: 5
3: 22
4: 214
Right 1085350221 11:75793448-75793470 ACATCTTCATCCAGCAGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085350217 Original CRISPR GTCACCCAGTGGGCCCCAGG TGG (reversed) Intronic