ID: 1085350217 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:75793425-75793447 |
| Sequence | GTCACCCAGTGGGCCCCAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 242 | |||
| Summary | {0: 1, 1: 0, 2: 5, 3: 22, 4: 214} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1085350217_1085350222 | 1 | Left | 1085350217 | 11:75793425-75793447 | CCACCTGGGGCCCACTGGGTGAC | 0: 1 1: 0 2: 5 3: 22 4: 214 |
||
| Right | 1085350222 | 11:75793449-75793471 | CATCTTCATCCAGCAGCCCAGGG | 0: 1 1: 0 2: 3 3: 22 4: 276 |
||||
| 1085350217_1085350226 | 18 | Left | 1085350217 | 11:75793425-75793447 | CCACCTGGGGCCCACTGGGTGAC | 0: 1 1: 0 2: 5 3: 22 4: 214 |
||
| Right | 1085350226 | 11:75793466-75793488 | CCAGGGAAAAGTGCAGCGACTGG | 0: 1 1: 0 2: 1 3: 17 4: 215 |
||||
| 1085350217_1085350221 | 0 | Left | 1085350217 | 11:75793425-75793447 | CCACCTGGGGCCCACTGGGTGAC | 0: 1 1: 0 2: 5 3: 22 4: 214 |
||
| Right | 1085350221 | 11:75793448-75793470 | ACATCTTCATCCAGCAGCCCAGG | 0: 1 1: 0 2: 1 3: 23 4: 230 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1085350217 | Original CRISPR | GTCACCCAGTGGGCCCCAGG TGG (reversed) | Intronic | ||