ID: 1085363302

View in Genome Browser
Species Human (GRCh38)
Location 11:75912673-75912695
Sequence ATGAACAATCTGTCTGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085363302 Original CRISPR ATGAACAATCTGTCTGAGTA GGG (reversed) Intronic
902431193 1:16364651-16364673 ATGAACAATATTTCAGAGTCAGG + Intronic
904343676 1:29854231-29854253 CTGAGCATTCTGGCTGAGTACGG + Intergenic
905493528 1:38364238-38364260 ATGAAAAGTCTGTCTGAGCATGG - Intergenic
907686971 1:56621728-56621750 ATGAACAATCTCACAGAGGAAGG - Intronic
907844124 1:58188197-58188219 ATGCAAAAACTGGCTGAGTATGG - Intronic
910368347 1:86489716-86489738 TTTAACCATCTGTCTGTGTATGG - Intronic
911205370 1:95086918-95086940 ATGAAAAGTCTGTCTGAGCATGG - Intergenic
912772484 1:112477347-112477369 ATGAAGATGCTGTCTGAGTTGGG - Intronic
915504395 1:156344197-156344219 ATAAACAATGAGTCTGAGTCTGG - Intronic
918572159 1:186009647-186009669 ATGAACATTGTGCCTGAATAAGG + Intronic
920802096 1:209199057-209199079 ATGAAAAATCTGCCTGGGCATGG - Intergenic
923366657 1:233268336-233268358 ATAAAAAATCTGGCTGAGTGAGG + Intronic
1064221779 10:13447089-13447111 ATGAAAAACATCTCTGAGTACGG + Intronic
1065012683 10:21433594-21433616 ATGAAAAGTCTGTCTGGGCATGG - Intergenic
1071331802 10:84568100-84568122 ATGAAAAGTCTGTCTGGGTATGG - Intergenic
1072381587 10:94877886-94877908 ATTTACAATCAGTGTGAGTATGG + Intergenic
1076770653 10:132662326-132662348 ATGAACATTCAGTCTTAGTGTGG - Intronic
1077206707 11:1348253-1348275 ATGAACAATCCGTGTAAGTGCGG + Intergenic
1078574901 11:12492370-12492392 ATGAACAATTTGTGTAACTATGG + Intronic
1082675529 11:56096556-56096578 ATGAACCCTATGTGTGAGTATGG - Intergenic
1085363302 11:75912673-75912695 ATGAACAATCTGTCTGAGTAGGG - Intronic
1086312899 11:85555684-85555706 ATGAAAAGTCTCTCTGGGTATGG - Intronic
1086941902 11:92807030-92807052 ATGAAAAATCTGTCTGGACATGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087336431 11:96850591-96850613 CCCATCAATCTGTCTGAGTACGG + Intergenic
1087409637 11:97775416-97775438 ATGATCAAACTGTCTTACTATGG - Intergenic
1089986951 11:122823834-122823856 ATGAAAAGTCTGTCTGGGTGTGG + Intergenic
1090140720 11:124257639-124257661 ATGAAAAGTCTGTCTGTGCATGG + Intergenic
1090694365 11:129222830-129222852 ATGCAGATTCTGACTGAGTATGG + Intronic
1097342709 12:58457073-58457095 ATGAAAAATCTGGCAGAGTGTGG + Intergenic
1100873307 12:98936336-98936358 ATGAACAATTTGGCTGGGCATGG + Intronic
1100989447 12:100236376-100236398 ATGACCATTCTGTGGGAGTAAGG + Intronic
1101905397 12:108821087-108821109 ACGAAGAATCTGGCTGAGTATGG + Intronic
1104181344 12:126384793-126384815 GTGAACATTCTATCTGAGCAAGG + Intergenic
1107120777 13:36793629-36793651 ATGAATAATCTGTCAGTGAAGGG - Intergenic
1107532952 13:41301862-41301884 ATGAAAAGTCTGTCTGGGTGTGG + Intergenic
1107985354 13:45771146-45771168 ATGAAAAGTCTGTCTGGGTGGGG + Intergenic
1109653239 13:65354894-65354916 ATATACAAGCTGTCTGAGGAAGG + Intergenic
1109961339 13:69636612-69636634 ATGAACAATAAGTCTGAGTGTGG - Intergenic
1112313676 13:98342406-98342428 ATAAACAAACTGGCTGGGTACGG + Intronic
1112928914 13:104711972-104711994 ATCAACAGTCTGTCTGGGTGTGG - Intergenic
1113126697 13:106987194-106987216 TGGAACAAGCTGGCTGAGTAAGG + Intergenic
1113183461 13:107658876-107658898 CTGAACAAACAATCTGAGTAGGG - Intronic
1117872150 14:60212451-60212473 TTGAACAATTTGTTTCAGTAAGG + Intergenic
1119139307 14:72251257-72251279 ATGAAAAGTTTGTCTGGGTATGG + Intronic
1120076132 14:80160432-80160454 ATGAAAATTCTGACTGAGAAGGG - Intergenic
1120097254 14:80402883-80402905 ATGAAAAGTCTGTCTGGGCATGG + Intergenic
1120556893 14:85938770-85938792 ATGAAAAATCTCTCTGAGCGTGG + Intergenic
1126412787 15:48389118-48389140 TTGAACAATGTGTCTGTGTCTGG + Intergenic
1126731002 15:51682129-51682151 ATGAATAGACTGTCTGAGAAAGG - Intronic
1130313650 15:82776129-82776151 TTGAACAAATTGTCTGGGTATGG + Intronic
1131469120 15:92680681-92680703 ATGAACAATGTTTTAGAGTAGGG - Intronic
1131715430 15:95105596-95105618 ATAAAAACTCTGTCAGAGTAAGG + Intergenic
1131963738 15:97815733-97815755 ATGAACAATCTGCCTGCAAATGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133368682 16:5231463-5231485 ATGAAAAGTCTGTCTCAGCATGG - Intergenic
1138159779 16:54742171-54742193 ATGAAGAACTTCTCTGAGTAAGG + Intergenic
1139947242 16:70649737-70649759 AAGAAAGATCTGTGTGAGTACGG - Intronic
1144273289 17:13640746-13640768 ATGAAAAGTCTGTCTGGGCATGG - Intergenic
1146236886 17:31174687-31174709 ATGAACAAACTGTGTGTCTAAGG - Intronic
1150391109 17:64790470-64790492 ATGAACAAACTCTCTCAGCAGGG + Intergenic
1153830953 18:8922096-8922118 ATGAAAAGTCTGTCTGGGCATGG + Intergenic
1157028055 18:43870837-43870859 ACGAACAATGTGACTGAGTATGG - Intergenic
1158109948 18:53929767-53929789 ATGAACAAGCTGTGTGAGTATGG + Intergenic
1158114826 18:53983575-53983597 ATGAGTAATATGTCTGAGAAAGG - Intergenic
1158210237 18:55040781-55040803 ATGAAAAGTCTGTCTGGGCATGG - Intergenic
1162693701 19:12454859-12454881 ATGGACCATCTGTGTGATTATGG + Intronic
1163037433 19:14578781-14578803 ATGAACAACCAGCCTGGGTAAGG - Intergenic
1167093739 19:47362316-47362338 ATGAACAAAATGTCAGAGTTGGG + Intronic
926157882 2:10467715-10467737 ATGGACAATGTGTGTGAGTGAGG + Intergenic
926665736 2:15520478-15520500 TCCAACAGTCTGTCTGAGTATGG - Intronic
929044083 2:37773700-37773722 ATGAACAATCTGTCTGAACAAGG - Intergenic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
930188571 2:48434761-48434783 ATTAACAATATGTATTAGTAAGG - Intergenic
930240644 2:48932639-48932661 ATGAACAAACAGTCTAATTAAGG + Intergenic
930758065 2:54998967-54998989 ATGAACATTTTGTATGAGTAAGG - Intronic
931862994 2:66376643-66376665 ATGAACCAACTGTCTGATGATGG - Intergenic
937504022 2:122515960-122515982 ACAAAAAATCTGTCTGGGTATGG + Intergenic
939339113 2:140870161-140870183 ATGAAAAGTCTGTCTGGGTGTGG - Intronic
940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG + Intronic
940553698 2:155194819-155194841 ATGAAAAGTCTGTCTGGGTGTGG + Intergenic
946789026 2:223280869-223280891 ATGAAAAATCTGTGTCAGAATGG + Intergenic
947073502 2:226317362-226317384 AAGAACAATCTGCCTGAGCACGG + Intergenic
1170689043 20:18595558-18595580 ATGAACAATTCGGCTGAGAACGG - Intronic
1171969875 20:31557617-31557639 ATGAATACTCTGTAGGAGTAGGG - Intronic
1174813630 20:53668203-53668225 ATGATCACTGTGTTTGAGTAAGG + Intergenic
1177013481 21:15756104-15756126 GTGAAAAGTCTGTCTGGGTATGG + Intronic
1177216600 21:18137787-18137809 ATGAACAATTTCTCACAGTAAGG - Intronic
1180605663 22:17057267-17057289 ATGAACAACCTGTCTGGGGCAGG - Intergenic
1184113045 22:42406338-42406360 ATGGACCCTCTGTCTGAGTGAGG - Intronic
949516578 3:4813094-4813116 ATGAACAATCTGGCAGCATATGG - Intronic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
952127992 3:30324568-30324590 AAGAACAATCTGGCTGACTCAGG + Intergenic
952405082 3:32998090-32998112 ATAAACAATTTCTGTGAGTAGGG + Intronic
953058052 3:39404095-39404117 ATGAAGAGTCTGTCTGGGCATGG - Intergenic
956934457 3:74084164-74084186 ATGAAAAATCTATCTGGGGATGG + Intergenic
957812761 3:85248031-85248053 ATGCACAATCTATCTGAGTGAGG - Intronic
960019519 3:112933008-112933030 ATGCACAATCTGTCAGTCTAGGG - Intronic
960641569 3:119829209-119829231 ATGAACATTTTATCTGAGAAAGG - Intronic
963446706 3:145420387-145420409 AAGAAAAATCTGTTTGATTAAGG + Intergenic
963864310 3:150343797-150343819 ATGAAAACTCTGTCTGACTTGGG + Intergenic
965470813 3:169088241-169088263 ATGAACAATCCGGTTGAGTGTGG + Intronic
965741928 3:171884637-171884659 AAGAAGAATCTGTCTGAGACAGG - Intronic
966257698 3:177936867-177936889 ATGAAAAATCTTTCTGACTACGG + Intergenic
969572725 4:8019407-8019429 ATGAAGGGTATGTCTGAGTAAGG - Intronic
970486946 4:16534328-16534350 ATGAACAAGATGGCTTAGTAGGG + Intronic
970799869 4:19960100-19960122 ATGAACTCTCTGTGTGAGTGTGG - Intergenic
972395950 4:38660068-38660090 ATGAACACTCTCCCTGAGGATGG - Intergenic
973260156 4:48155211-48155233 ATGAACATTGTATCTGACTAGGG + Intronic
975045946 4:69804526-69804548 TTGAAAAATCTGACTGAGTGCGG + Intergenic
976743722 4:88382911-88382933 ATGATCAATCACTCTGAGTTGGG + Intronic
983839042 4:172433228-172433250 ATGAACAATGAAGCTGAGTAGGG - Intronic
987789015 5:22539500-22539522 ATGAAAAATCTTCCTGTGTAAGG + Intronic
989857179 5:46312469-46312491 AAGAACAATTTGACTGAGTGAGG - Intergenic
990636505 5:57733816-57733838 ATAAACAATTTTTCTGAATATGG + Intergenic
991185453 5:63801243-63801265 ATGAAAAGTCTGTCTGAGCATGG - Intergenic
992192684 5:74309328-74309350 ATGAAAAGTCTGTCTGGGCAGGG + Intergenic
994681897 5:102898434-102898456 ATGAACACACTGTCCTAGTAAGG - Intronic
994760970 5:103853606-103853628 ATGATTAATCTTTCTGAGGAAGG - Intergenic
996787614 5:127257168-127257190 ATGAAAAGTCTGTCTGTGTGTGG + Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
999273463 5:150312371-150312393 ATGGTCAATCTGTCTCAGAATGG - Intronic
999417713 5:151414337-151414359 ATGCACAATCTATTTGAGAATGG + Intergenic
1000804386 5:165770990-165771012 AGGAATAACCTGTCTGGGTAAGG + Intergenic
1003253051 6:4449240-4449262 ATGAAAAGTTTGTCTGAATATGG + Intergenic
1003753078 6:9084133-9084155 ATGAAAAATCTGTCTGGGAGTGG + Intergenic
1005258609 6:24032238-24032260 AGGAAAAATCTCTGTGAGTAGGG - Intergenic
1007009801 6:38405175-38405197 ATAGACAATCTATCTGAGGAAGG + Intronic
1008809921 6:55483944-55483966 ATGAACATTTTGTATTAGTAGGG + Intronic
1008909239 6:56715675-56715697 ATGAAAAGTCTGTCTGGGCATGG - Intronic
1010657562 6:78529644-78529666 GAGAACAATCTTTCTGAGTTTGG - Intergenic
1012742175 6:103031614-103031636 TTTAAAAATCTGTCTGAATATGG - Intergenic
1014828547 6:126074670-126074692 ATGCACATTCTGTCTGATTGAGG - Intergenic
1014976835 6:127897013-127897035 ATGGACACTATTTCTGAGTAAGG + Intronic
1015158726 6:130127149-130127171 ATGAAAAGTCTCTCTGAGCATGG + Intronic
1015669351 6:135671003-135671025 ATGAACCATCTATCTGATAAAGG + Intergenic
1015788436 6:136942119-136942141 AAGAAAAGTCTGTCTGAGCATGG + Intergenic
1017042810 6:150321485-150321507 AAAAACATTCTGTCTCAGTATGG - Intergenic
1022645117 7:32222647-32222669 AAGAATAATCTGTCTGAATTTGG + Intronic
1023377479 7:39572547-39572569 ATGAACAATCTATCCCACTATGG - Exonic
1023545451 7:41313550-41313572 GAGAACAAGCTGTGTGAGTAAGG + Intergenic
1027208543 7:76124362-76124384 ATGAATAATCTGGCTGGGCATGG + Intergenic
1027406298 7:77864961-77864983 CAGAACAATCTGTCTGACAATGG - Intronic
1027594786 7:80159286-80159308 AAGAACTATGTTTCTGAGTATGG - Intronic
1027715519 7:81664505-81664527 ATGAAAAGTCTGTCTGAGCAGGG - Intergenic
1028371360 7:90096216-90096238 ATGAAAATTCTGCCTGTGTAAGG - Intergenic
1031195140 7:118603762-118603784 ATGAGAAATCTGTCTCAGTTTGG - Intergenic
1032328551 7:130955523-130955545 ATGAAGAATGTTTCTGAGTGTGG - Intergenic
1032837391 7:135686764-135686786 ATGAACATTCTGGCTGGGTGAGG + Intronic
1034341393 7:150358776-150358798 ATGAACAATATAGCTGAGTAGGG + Intergenic
1037982500 8:23264370-23264392 ACGAAAAGTCTGTCTGGGTATGG - Intergenic
1040387737 8:46924761-46924783 ATCAACTATCTGTTTGAGTTTGG - Intergenic
1042455786 8:69000742-69000764 ATAAACAAGGTGTGTGAGTATGG + Intergenic
1043908605 8:85834782-85834804 AGGACCAATATGCCTGAGTAGGG - Intergenic
1045719354 8:105089565-105089587 ATGAATAATCTGTCTCTCTATGG + Intronic
1046566638 8:115910465-115910487 ATTTACAACCTGACTGAGTAAGG - Intergenic
1047373633 8:124276366-124276388 ATGAACAATATGGCTGGGCATGG - Intergenic
1047853453 8:128884047-128884069 ATGAACAATCTTTATGACTAGGG - Intergenic
1050267859 9:3909657-3909679 ATGAAAAATCAGTGTCAGTATGG + Intronic
1051692289 9:19728110-19728132 ATGGATAATGTGTCTGACTACGG - Intronic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1055630833 9:78221598-78221620 AGGAACATTCTGTCTGGGTATGG + Intergenic
1055732264 9:79290427-79290449 ATGTACAAGCTGTATGAGTTTGG + Intergenic
1055917504 9:81420808-81420830 ATGAAAAATCTGTCTGGGCCTGG - Intergenic
1186673693 X:11793659-11793681 ATGAAAAGTCTGTCTGGGTCTGG - Intergenic
1186885515 X:13909416-13909438 ATTAACAATATGGCTGAGCACGG - Intronic
1187214477 X:17263280-17263302 ATGATCATTCTGTCCCAGTAGGG + Intergenic
1188102482 X:26106864-26106886 ATCAGCAATCTGGCAGAGTATGG - Intergenic
1188517191 X:31000148-31000170 ATAAAGAATCTGGCTGGGTACGG - Intergenic
1193769840 X:85575447-85575469 ATGAACATTGTATCTGATTAGGG + Intergenic
1194017957 X:88649279-88649301 ATGAACAATGTTTAAGAGTAAGG + Intergenic
1196780292 X:119377439-119377461 ATGGACATTCTTTCTGAATATGG + Intergenic
1199377095 X:147125702-147125724 ATCAACATTCTTTCTAAGTAGGG - Intergenic