ID: 1085364921

View in Genome Browser
Species Human (GRCh38)
Location 11:75931639-75931661
Sequence CTTTCTATTTTCCCTTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 398}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085364913_1085364921 23 Left 1085364913 11:75931593-75931615 CCAACCTTGACCCAGTCACAGCC 0: 1
1: 0
2: 0
3: 19
4: 233
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364911_1085364921 27 Left 1085364911 11:75931589-75931611 CCTCCCAACCTTGACCCAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 226
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364914_1085364921 19 Left 1085364914 11:75931597-75931619 CCTTGACCCAGTCACAGCCCTTA 0: 1
1: 1
2: 0
3: 27
4: 263
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364918_1085364921 1 Left 1085364918 11:75931615-75931637 CCTTAGTAATAACCACCTTTCAC 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364917_1085364921 2 Left 1085364917 11:75931614-75931636 CCCTTAGTAATAACCACCTTTCA 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364910_1085364921 28 Left 1085364910 11:75931588-75931610 CCCTCCCAACCTTGACCCAGTCA 0: 1
1: 0
2: 1
3: 35
4: 218
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364916_1085364921 12 Left 1085364916 11:75931604-75931626 CCAGTCACAGCCCTTAGTAATAA 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364912_1085364921 24 Left 1085364912 11:75931592-75931614 CCCAACCTTGACCCAGTCACAGC 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398
1085364915_1085364921 13 Left 1085364915 11:75931603-75931625 CCCAGTCACAGCCCTTAGTAATA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG 0: 1
1: 0
2: 6
3: 36
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085364921 Original CRISPR CTTTCTATTTTCCCTTATGA TGG Intronic
901946483 1:12708158-12708180 CTTTATACTCTCCCTGATGAGGG + Intergenic
904570020 1:31456555-31456577 CTTCCTACTTTCCCTGATGAAGG + Intergenic
905738557 1:40349522-40349544 CTTTCTTTTTTCTTTTTTGATGG + Intronic
906046015 1:42831408-42831430 CTTTCTATGCTCCATTATCAAGG + Intronic
906431097 1:45756428-45756450 CTTTCTACCCTCCCTGATGAGGG + Intergenic
907144523 1:52220199-52220221 CTTTCTACCCTCCCTGATGAAGG + Intronic
907361691 1:53921461-53921483 CTTTCTAATTTCCCCCATGGTGG + Intronic
907459237 1:54595463-54595485 CTTTTTATTTTATCTTTTGAGGG - Intronic
907506981 1:54926281-54926303 CTGTCTCTTGTCTCTTATGAAGG - Intergenic
907563166 1:55410016-55410038 TTTTTTTTTTTCTCTTATGAAGG + Intergenic
908276243 1:62474689-62474711 TTCTGTATTTTCCCTTATCATGG + Intronic
909686077 1:78350454-78350476 GTTTCTAATTTCCATAATGAAGG - Intronic
910481843 1:87667322-87667344 TTTTTTATTTTCCCTTCTGCAGG + Intergenic
911006334 1:93228554-93228576 CTGTCTACCTTCCCTTATGAAGG + Intronic
911415620 1:97568729-97568751 GTTACTATTTTCTCCTATGATGG - Intronic
911435516 1:97852224-97852246 CTTTCTATTTTCTCTTAGGTGGG + Intronic
912150245 1:106850576-106850598 CTTCCTATGTTCCCTTAGAATGG + Intergenic
915857479 1:159405196-159405218 CTTTCCATTTTCACCTCTGAAGG + Intergenic
915981542 1:160423378-160423400 CTTTCTTTTTTCCATTTTGATGG + Intronic
916423277 1:164656685-164656707 CTTTCTATTTCACATTAAGAAGG - Intronic
916868844 1:168889689-168889711 CTTTCTAAATTTCTTTATGATGG - Intergenic
916890915 1:169111609-169111631 GTTTCTCTTTTCCCTTTTCATGG - Intronic
917307330 1:173639979-173640001 CTTTCTACCCTCCCTGATGAAGG - Intronic
917775183 1:178326346-178326368 CTTATTATTCTCACTTATGAGGG - Intronic
917873038 1:179259082-179259104 CTTTCTTTTTTGCCTCATAAAGG - Intergenic
918398756 1:184143256-184143278 CTATCTATTGGCCCTTTTGAAGG - Intergenic
918845431 1:189603196-189603218 CTTTTTATTTTCACTGACGAAGG - Intergenic
919341101 1:196307997-196308019 GTTTCTATTTCCCCAGATGATGG - Intronic
919451011 1:197773800-197773822 CTTAATCTTTTACCTTATGATGG - Intronic
919816368 1:201443306-201443328 CTTTCAATTTTTCTTTATTATGG - Intergenic
920803943 1:209215892-209215914 CTTACTCTTTCCCCTTATTAAGG - Intergenic
920833281 1:209484527-209484549 CAGTCTATCTTCCCTTCTGAAGG + Intergenic
921604592 1:217138592-217138614 CTTTCTTTTCTCCCTTTTGTAGG - Intergenic
921710306 1:218366938-218366960 CTTTCCATTTTCCCAAATGCAGG + Intronic
924106824 1:240657282-240657304 CTGTCTATTTTCTCTTGTGGTGG + Intergenic
924377672 1:243430342-243430364 CTTTCTGTTTTCCTTTATGTTGG - Intronic
924403767 1:243719721-243719743 CTTTCTCTCTTCCCTTCTGATGG - Intronic
1063192518 10:3709597-3709619 CTTTATCTTTTTCCTTATCAAGG - Intergenic
1063977173 10:11426871-11426893 TTTTTTTTTTTCCCTTAAGATGG + Intergenic
1064332783 10:14409326-14409348 ATTTCTTTTTTCACTTAGGAAGG + Intronic
1064756425 10:18575599-18575621 CTTTCTACTCTCCCTGATGAGGG - Intronic
1064841094 10:19592706-19592728 CTTTATATTTTTCCTTATAGTGG - Intronic
1065019270 10:21489818-21489840 TTTTCTATTTTCCTTTTTAATGG - Intergenic
1065801603 10:29357591-29357613 CTTTCTTTCTTTCCTTTTGACGG - Intergenic
1066305265 10:34134218-34134240 CTGTCTCTTTTGTCTTATGAAGG - Intronic
1066485214 10:35836687-35836709 TTTTCTAATTTGCTTTATGAAGG - Intergenic
1066557442 10:36629981-36630003 GTTTACATTTTCCATTATGAAGG + Intergenic
1066589452 10:36977998-36978020 TTCTCTATTTACACTTATGAGGG + Intergenic
1068076394 10:52260901-52260923 ATTTATAATTTCCCTTATTAAGG - Intronic
1068376252 10:56185316-56185338 TTTTCTATTTTCCCTTTTGGAGG - Intergenic
1068421455 10:56800057-56800079 CTTTGTATTTTCAATAATGAAGG + Intergenic
1068844955 10:61661676-61661698 CTTGTTATTTTCACTTCTGAAGG - Intergenic
1069699425 10:70410703-70410725 TTTCTTATTTTCCCTTATGGGGG + Intronic
1070265058 10:74894085-74894107 CTCTCTTTTTTCCCTTGAGACGG + Intronic
1070280788 10:75046708-75046730 CTTTCCATTTTTCCTTAGAAAGG + Intronic
1070336567 10:75461011-75461033 GTATTTATTTTCCCTTACGAGGG - Intronic
1070707541 10:78651580-78651602 CTTTGTGTTTTCCCTTATTTAGG - Intergenic
1071751319 10:88479705-88479727 CCTTTTATTTGCCCTTTTGAAGG + Intronic
1072147013 10:92650615-92650637 CTTTCAATTATTCCTTAGGATGG + Intronic
1072391746 10:94994354-94994376 CTTCCTACTTTCCTTGATGAAGG + Intergenic
1072866059 10:99062988-99063010 TTTTCTACTTTCCCTTGTCATGG + Intronic
1073569764 10:104569077-104569099 CTTTCTATTTTCAGTTATTTGGG + Intergenic
1074331567 10:112516854-112516876 CCTCCTGTTTTCCCTAATGATGG - Intronic
1074941136 10:118236763-118236785 CTTTTTATTTTCCCTTTCAAGGG + Intergenic
1076376599 10:129992279-129992301 CTTTCTTTCTTTCCTTTTGAGGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078271621 11:9800230-9800252 CTTTTTTTTTTCCTTTAGGATGG - Intronic
1078432740 11:11300396-11300418 CGTTGTTTTCTCCCTTATGATGG - Intronic
1078549083 11:12268243-12268265 GCTTCTATTTTGCCTTCTGAGGG + Intergenic
1078676247 11:13417303-13417325 AAATCTATTTTCCCTTTTGAAGG - Intronic
1079656855 11:22995564-22995586 CTTTCTACTTTCACTGATGTGGG + Intergenic
1079667018 11:23118827-23118849 TTTTCTTTTTTCCCTCATGTTGG + Intergenic
1079779552 11:24583588-24583610 GTGTCTACTTTCCCTTATGAGGG - Intronic
1081142520 11:39520112-39520134 TTATCTATTTCCCCTTGTGATGG + Intergenic
1082728648 11:56768252-56768274 CTTTCTATATTTCCTTCTGTGGG + Intergenic
1083005395 11:59340207-59340229 CTTTGTACTTTTCCTTATAAAGG + Intergenic
1084794090 11:71492612-71492634 TTTTCTGTTTTTCCTTATGCCGG + Intronic
1085249378 11:75132152-75132174 CTTTCTTTTTTCTTTTTTGATGG - Intronic
1085261386 11:75207192-75207214 GTTTCAATTTTCCTTTATGTGGG - Intergenic
1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG + Intronic
1086965219 11:93020311-93020333 TTTTCTATTTTTCCTGATAATGG - Intergenic
1087170266 11:95042917-95042939 CTTTCAATATCCCCTTATCATGG + Intergenic
1087361014 11:97159559-97159581 CTTTTTTTTTTCTCTTATGTGGG + Intergenic
1088002383 11:104897922-104897944 CTTTTTTGTTTCCCTTATCAAGG + Intergenic
1089590440 11:119536988-119537010 CTTTGTGTTTTCCCTCATTAAGG - Intergenic
1089716342 11:120363723-120363745 CTTACCACTTTCCCTTATTATGG + Intronic
1091531556 12:1361516-1361538 AGTTCTAGCTTCCCTTATGAAGG - Intronic
1092006231 12:5072760-5072782 CTTTCTCTTTTCCATTTGGATGG - Intergenic
1092761195 12:11812839-11812861 ATTTCTATTTCCCCTTGTGGTGG - Intronic
1092912136 12:13155246-13155268 CTTTCTTTTTTCACTTGTGAAGG - Intergenic
1093271462 12:17067249-17067271 TTGTCTACTGTCCCTTATGAAGG - Intergenic
1093397740 12:18704327-18704349 CTTTCTTTTTTTCAATATGAAGG + Intronic
1093823820 12:23656539-23656561 TATTCTATATTTCCTTATGATGG - Intronic
1094201015 12:27794494-27794516 TTTTCTTTTTTCCCTTGAGATGG + Intronic
1094339088 12:29390127-29390149 CTTTCTATTTTATCATATGTCGG - Intergenic
1094644007 12:32303425-32303447 CTTTCATTGTTCCCTTCTGACGG + Intronic
1095162446 12:38933937-38933959 CTTTCTACTTTCCCTGATGAGGG + Intergenic
1095180684 12:39144461-39144483 CTTTCTATTTTCTTGTATGGTGG + Intergenic
1096378914 12:51138806-51138828 CTTTCTATTTTCACTAGAGACGG + Intronic
1096591494 12:52662915-52662937 CTTCCTATTTTCCATTATTATGG - Intergenic
1096875316 12:54625451-54625473 CTTTCTATTTTCATCTAAGATGG + Intergenic
1097020834 12:56019948-56019970 CTTTCTCTTTTCCCTTTCTAAGG - Intronic
1097464339 12:59903880-59903902 CTTTTTATTTTCCCTATGGATGG - Intergenic
1097906147 12:64921616-64921638 CTTTCTTTCTTCTCTTATTAAGG - Intergenic
1099293188 12:80798015-80798037 GATTCTATTTTTCCTCATGAAGG + Intronic
1099701069 12:86082549-86082571 TTTTCTCTTTTCCCTGAAGATGG - Intronic
1099819061 12:87686384-87686406 CTTTCTAGTTTACCAGATGAGGG + Intergenic
1101013625 12:100476355-100476377 CTTTCCAGTTTCCCTACTGATGG - Intronic
1101128356 12:101662846-101662868 CTTTCCATTTGCCCTTCTGAAGG + Intronic
1102606295 12:114070110-114070132 CTTTCTACTATCCTTGATGAGGG - Intergenic
1104708597 12:130968414-130968436 TTTTCTTTTCTCCCTTAAGAAGG - Intronic
1106165346 13:27240575-27240597 TTTTGTGTTTTCCCTTGTGAAGG - Intergenic
1106444089 13:29808816-29808838 TTTTCTATGTTCCCTTCTTATGG + Intronic
1106759236 13:32851403-32851425 CCTTCTTTTTCCCCATATGATGG + Intergenic
1107083689 13:36403087-36403109 CTTCCTGTCTTCCCCTATGAAGG + Intergenic
1108293886 13:48992155-48992177 CTTTCTACTTTCCATTGAGAGGG - Intronic
1109674402 13:65655208-65655230 CTTTCTTTTTTTCTTTATTACGG - Intergenic
1110419148 13:75285622-75285644 CTTTCTTTTTTCCCTTCCAATGG + Exonic
1111181281 13:84669219-84669241 CTTTCTTTGTTACCTTATGATGG - Intergenic
1111784194 13:92766712-92766734 CTCTCTATTTTGACTTAAGATGG - Intronic
1111910582 13:94307321-94307343 CTTTTTTTTTTCCCTTGAGACGG + Intronic
1112064500 13:95778642-95778664 CATTCTATTTTCTCTTTTTAAGG - Intronic
1112690532 13:101888585-101888607 CTTACTCTGTTGCCTTATGATGG + Intronic
1112693399 13:101919739-101919761 CTCACTTTTTTCCCTCATGATGG + Intronic
1113064930 13:106363280-106363302 TAGTCTATTTTTCCTTATGAAGG - Intergenic
1113974049 13:114213207-114213229 CTACATATTTTTCCTTATGATGG - Intergenic
1114151583 14:20046203-20046225 CTTTTTATTTTTTCTTATCAAGG + Intergenic
1114975742 14:28097202-28097224 ATTTCTATTTCCCTGTATGATGG - Intergenic
1115493134 14:33978044-33978066 CTTTCTTTTTTCCTTCTTGATGG - Intronic
1115615733 14:35092888-35092910 CTTTCCATTTTGCCTTTTTATGG - Intronic
1115956420 14:38785409-38785431 CATTCTGTTTTCCCTTATTTGGG + Intergenic
1116049871 14:39789628-39789650 CTTTATATTTTTCCTTAAGTTGG + Intergenic
1116263739 14:42662119-42662141 CTTTCCATTTTTCCTGAAGATGG + Intergenic
1117503496 14:56377262-56377284 CTTCCTTCTTTCCCTTATAAAGG + Intergenic
1117774273 14:59166362-59166384 CTTTCTTTTTTTCTTTTTGATGG - Intergenic
1118928331 14:70214731-70214753 CTTTTTTTTTTTCCTTAAGAAGG - Intergenic
1119544076 14:75459308-75459330 GTTTCTATTTTCCCAGATGCAGG + Intronic
1122234543 14:100324227-100324249 CTTTTTTTTTTCCCTTGAGATGG + Intronic
1123112028 14:105876571-105876593 CTTTCTACTTGCCATGATGAAGG + Intergenic
1123625747 15:22225805-22225827 CTTTCTATGTTACTTTATGTGGG - Intergenic
1124202250 15:27688411-27688433 CCTGCTATTTTCCAGTATGAAGG + Intergenic
1125053512 15:35329914-35329936 ATTTCTATTTTAACTTCTGATGG + Intronic
1125106650 15:35979487-35979509 GTTTATATTTTCCATTTTGAAGG + Intergenic
1125362958 15:38883861-38883883 CTTTTTATTTTATCTTATTACGG + Intergenic
1125375856 15:39028778-39028800 CTTCCTGTGTTCCTTTATGATGG + Intergenic
1125690233 15:41590203-41590225 CTTTCTACTCTCCCTGATGAGGG - Intergenic
1126281634 15:46958387-46958409 CTTTCTATTTTATATTAGGATGG - Intergenic
1126407827 15:48339951-48339973 CTTTCAATTTTCTCATATAATGG - Intronic
1126726401 15:51636720-51636742 CTCTCTATTTTCCCCTTTGGGGG + Intergenic
1126909794 15:53405695-53405717 CTTCCTATTTTACCGTATTATGG + Intergenic
1127255327 15:57286325-57286347 CTTCCTATCTTCACTTCTGATGG - Exonic
1128805981 15:70531524-70531546 CTTTCCATTTTCTCTGATTAAGG + Intergenic
1129102320 15:73277460-73277482 CTTAGTATGTTCCCTGATGATGG + Intronic
1130263304 15:82376519-82376541 CTTTCTACTCTTCCTGATGAAGG + Intergenic
1130278000 15:82493147-82493169 CTTTCTACTCTTCCTGATGAAGG - Intergenic
1130470329 15:84220332-84220354 CTTTCTACTCTTCCTGATGAAGG - Intergenic
1130477817 15:84334899-84334921 CTTTCTACTCTTCCTGATGAAGG - Intergenic
1130493948 15:84453231-84453253 CTTTCTACTCTTCCTGATGAAGG + Intergenic
1130592618 15:85224960-85224982 CTTTCTACTCTTCCTGATGAAGG - Intergenic
1132486198 16:192802-192824 CTTACTATTTTCTTTTATAACGG + Intronic
1133076714 16:3285698-3285720 CTTTCTCTTTTTCCTCCTGAAGG + Exonic
1133960810 16:10491898-10491920 CTTTCTACTTTCCCTGATGAAGG - Intergenic
1136599063 16:31271998-31272020 CTTCCCCTTTTCCCTTAGGATGG + Intronic
1137441196 16:48499721-48499743 CTTTCAACTTTGCCTTTTGATGG - Intergenic
1137521398 16:49198514-49198536 CTTTGTATTTTTCTTTTTGATGG - Intergenic
1137671043 16:50279336-50279358 CTTTCTGTTCTTCCTTATCAAGG + Intronic
1138284491 16:55798307-55798329 CTTTCTTCTTTCTTTTATGACGG - Intergenic
1138284511 16:55798680-55798702 CTTTCTTCTTTCTTTTATGACGG + Intergenic
1138696051 16:58814547-58814569 TTTTTTCTTTTCCTTTATGAAGG + Intergenic
1138876900 16:60962830-60962852 CTTTCTTTTTTCCAATTTGATGG + Intergenic
1138973355 16:62172797-62172819 CTTTTTATTTTCCAATTTGAGGG + Intergenic
1139496359 16:67322034-67322056 CTTTATATTTATCCTTATGCTGG - Intronic
1139771650 16:69281837-69281859 CTTTCTTTTTTTTCTTAAGATGG - Intronic
1140120807 16:72081608-72081630 CTTTCTGCTTTTCCTGATGAGGG - Intronic
1140445678 16:75025761-75025783 CTTTCCATTTTTCTTTCTGATGG + Intronic
1140638131 16:76940616-76940638 CTTTCTATTTCTCCTTTTGCAGG - Intergenic
1140725668 16:77809345-77809367 CTTTCTAATTTCTCTGATGATGG - Intronic
1140794807 16:78427209-78427231 CTTTCTTTTTTCCCCTAACAGGG - Intronic
1143241398 17:5445907-5445929 CTTTATTTTGTCCTTTATGATGG + Intronic
1143732492 17:8888941-8888963 CCTTCTATATTCCCTTTGGAGGG + Intronic
1146925588 17:36742663-36742685 CCTTCCATTTTCCCTCAGGAGGG + Intergenic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1148560884 17:48605436-48605458 CTTTCATTTTGCCCTTATGCAGG - Intergenic
1148779776 17:50114756-50114778 CTTTCTTCCTTCCCTTATGCTGG - Intronic
1150160392 17:62893274-62893296 GGTTCTATTTTACCTTGTGACGG + Intergenic
1150349356 17:64430801-64430823 CTCTCAATTTTCCCCTTTGATGG + Intergenic
1150980499 17:70136464-70136486 CTTTCTATTTTCCCTTGTAGGGG - Intergenic
1151407352 17:73897641-73897663 GTTTCTCTCTTCCCTTAAGAAGG - Intergenic
1151922860 17:77170753-77170775 CTTTCTACTTTTCCTGATGAGGG + Intronic
1153992849 18:10415274-10415296 CTTTTTATTTTCATTTAAGATGG - Intergenic
1154258097 18:12802990-12803012 CTTTCAAATCTCCATTATGAAGG + Intronic
1154511692 18:15110842-15110864 CTTTCTTTTTTTTCTTATAATGG + Intergenic
1154582879 18:16127854-16127876 ATTTCTTTTTTCCCTTAGGCCGG - Intergenic
1154741136 18:18296971-18296993 ATTTCTTTTTTCCCTTAGGCCGG - Intergenic
1156201481 18:34837144-34837166 TTTTCTATTTTCCATGAAGAAGG + Intronic
1156697036 18:39779608-39779630 ATTTCTATTTTCCTTAATGCAGG + Intergenic
1157349833 18:46874495-46874517 CTTTCTACTCTTCCTGATGAAGG - Intronic
1157397969 18:47359165-47359187 CATACTCTTTTCCCTAATGATGG + Intergenic
1158324586 18:56300494-56300516 CTTTCTGTTTTCCCCTCTGGAGG - Intergenic
1158818740 18:61133984-61134006 CTTCATCTTTTCCCCTATGAGGG - Intergenic
1158991492 18:62873120-62873142 CTCTCTATCATCCCTTATGAAGG - Intronic
1159575723 18:70174043-70174065 CATTCTATTTTCTGTTATGGGGG + Intronic
1159668777 18:71197430-71197452 CTTTCTTTTTTTCTTTTTGACGG + Intergenic
1160713255 19:563224-563246 CTTTCTACCCTCCCTGATGAGGG + Intergenic
1162267904 19:9590999-9591021 CTTTCTACTCTCCCTGATGAGGG + Intergenic
1162273058 19:9631937-9631959 CTTTCTACTTTTCCTTATGAGGG - Intronic
1166903897 19:46090045-46090067 TTTTCTTTTTTCCCCTCTGATGG + Intergenic
1167224536 19:48228785-48228807 CTTTCCCTCTTCCCTTATGTGGG - Intronic
1167820822 19:51926483-51926505 TTTTCTTTTTTTCCTCATGAAGG + Intronic
924983279 2:243966-243988 CTTTCTTTTTTCCCTATTGAGGG + Intronic
925569709 2:5295912-5295934 TTTAGTATTTTCCCTTCTGAGGG - Intergenic
928110087 2:28500362-28500384 CTGACTTTTTTCCCTTGTGAAGG + Intronic
930159268 2:48137712-48137734 CTTTCTAATTTCCCTTTTTGGGG - Intergenic
930998445 2:57751420-57751442 CTTTCTTTTATCCCATTTGATGG - Intergenic
931484148 2:62673043-62673065 CTTTCTTTTTTTCCTTCTCATGG - Intergenic
931827464 2:66016682-66016704 CTTTAAATTTTAGCTTATGATGG + Intergenic
932040986 2:68299441-68299463 CTTTCTCATGTACCTTATGAGGG - Intronic
932705738 2:74023411-74023433 TTTTCTATTTTTCGTAATGATGG + Intronic
934633787 2:95962035-95962057 CTTTCTCCTTCCCTTTATGATGG + Intronic
934799834 2:97143130-97143152 CTTTCTCCTTCCCTTTATGATGG - Intronic
934802581 2:97180234-97180256 CGTTCTCTTTTCCCTCTTGATGG - Intronic
934804903 2:97212040-97212062 CTTTCTCTTTTCCCTCTTGATGG - Intronic
934832581 2:97545345-97545367 CTTTCTCTTTCCCCTCTTGATGG + Intronic
935208474 2:100918297-100918319 CTTTCTATTTTTTCTTCTTATGG - Intronic
935958638 2:108402350-108402372 TTTGCTACTTTCCCTGATGAGGG - Intergenic
936712388 2:115146508-115146530 TTTTCTATGTTCCCTAATTAAGG + Intronic
936716424 2:115192036-115192058 CTTTCTACTTTCCCTGATGAAGG + Intronic
936753091 2:115670136-115670158 CTTTCTTGTTTCTCTTATAAGGG + Intronic
936837838 2:116729088-116729110 CTTTCATTTTTCCTTTATAAGGG - Intergenic
936998773 2:118442367-118442389 ATTTTTTTTTTCCCTGATGAAGG + Intergenic
937815155 2:126243308-126243330 AATTCTATTTTCCCTTTTGGCGG + Intergenic
938287888 2:130133316-130133338 CTTTCTATTTTCTCTGATGTAGG + Intergenic
938511261 2:131947600-131947622 CTTTCTTTTTTTTCTTATAATGG + Intergenic
938837694 2:135124121-135124143 CTTTATTTTTTCCCAAATGATGG + Intronic
938956022 2:136299205-136299227 CTTTCTTTCTTCCTTTTTGACGG + Intergenic
939420130 2:141956239-141956261 CTTTATATTCTCTCTAATGATGG + Intronic
939427095 2:142053022-142053044 CTTTTTATTTTGCCTTATGATGG - Intronic
939996197 2:148922410-148922432 CTCTCTATTCTCCCTTTTCAAGG + Intronic
940091058 2:149917661-149917683 TTTTCTATTTTCTCCTCTGATGG - Intergenic
940159541 2:150696801-150696823 CTTTCTTCTTTCCCTTTTCATGG - Intergenic
940847171 2:158654511-158654533 CTTTCTATTTTGCACTTTGAGGG + Intronic
941158380 2:162006084-162006106 TTCTCAATTTTCCCTTACGATGG + Intronic
941733804 2:168949696-168949718 CTTTGTATATGCCCATATGATGG + Intronic
941875736 2:170430920-170430942 CTCTCTATTTCCACTTCTGAAGG - Intronic
942463669 2:176187449-176187471 CTTTTAATGTTCCCTTTTGAGGG - Intergenic
944685704 2:202115904-202115926 CTTTTTTTTTTTCCTTCTGAAGG - Intronic
944915023 2:204350915-204350937 CTTTCTGCTTTCCTTTCTGAGGG - Intergenic
945432905 2:209785658-209785680 CTGAGTATTTTGCCTTATGAGGG + Intronic
945483493 2:210368352-210368374 CTTCCTACTTTCCCTGATGAAGG + Intergenic
946068818 2:217013404-217013426 CTTTCTATGTTCCCTGATCCAGG + Intergenic
947226790 2:227848382-227848404 CATTCTAGTTTCTCTTATAAAGG - Intergenic
1168824100 20:797515-797537 CTTTCTACTCTCCCTGATGAGGG - Intergenic
1168883896 20:1230328-1230350 ATTTCTAATTTCTCTTATAAAGG - Intronic
1172548860 20:35783418-35783440 CTTTTTTTTTTTCTTTATGATGG + Intronic
1172728553 20:37067121-37067143 TTTTTTTTTTTCCCTTATAAAGG - Exonic
1174449128 20:50609086-50609108 CTGTCCATTTTCCATCATGATGG - Intronic
1175042479 20:56067910-56067932 CCTTCTCTTTTCTCTTCTGAGGG + Intergenic
1175551572 20:59821346-59821368 CCTGCTATTTACCCTTATGCCGG + Intronic
1177309523 21:19371738-19371760 CTGTGTATTCTCCCTTATAAGGG + Intergenic
1177361756 21:20081985-20082007 GGTTCTATTTTCCCTTATAAGGG - Intergenic
1178041507 21:28645021-28645043 CTCTGTAGTTTCCCTGATGAGGG - Intergenic
1178791833 21:35707440-35707462 CTTCCTATTATTCCATATGATGG - Intronic
1179338680 21:40483574-40483596 CTTTTTATTTTCCTGTATAACGG + Intronic
1182163835 22:28151826-28151848 ATTTATATTTTCCCTTTTCATGG + Intronic
1184064430 22:42109208-42109230 CTTTCTACTCTCCCTGATGAAGG + Intergenic
1184073808 22:42163454-42163476 CTTCCTAATTTCCCTACTGAAGG - Intronic
1184673938 22:46030114-46030136 CTTTCTATTTTTCCATGTTAGGG + Intergenic
949122554 3:404137-404159 CATTCTATTTTCCCTGCTGTGGG - Intronic
949900902 3:8814118-8814140 CTTTCCAGTCTCCCTTGTGAAGG + Intronic
949978218 3:9480105-9480127 CTTTCTATTTTCTTTTGAGACGG - Intergenic
950227888 3:11250785-11250807 CTTTCGACTCTCCCTGATGAGGG + Intronic
950594399 3:13966068-13966090 CTTTCTACTCTCCCTGATGAAGG + Intronic
950780805 3:15390008-15390030 CTTTTTTTTTTCCCTTGAGATGG - Intronic
950782656 3:15405304-15405326 CAGTCTACTTTCCCTTCTGAAGG - Intronic
950846237 3:16018584-16018606 CTTTCTACTCTCCCTGATGAGGG + Intergenic
951093961 3:18606977-18606999 CTTTCTCTTTTACCTTCTGTAGG + Intergenic
951523238 3:23629032-23629054 CTCCCTATTTTCCCTTATACAGG - Intergenic
952102267 3:30028013-30028035 CTTTCTATTGCCCTTCATGAGGG - Intergenic
952350088 3:32526714-32526736 CTTTCTAATTCCACTTTTGAAGG + Exonic
952543785 3:34396502-34396524 CTTTCTTTTTTCCCATACGGGGG + Intergenic
953622520 3:44545553-44545575 CCTTCTCTTTCCCCTTTTGATGG + Intergenic
957313684 3:78550766-78550788 CTTTCTTCTTTCCCTCATGATGG + Intergenic
957582219 3:82089029-82089051 ATTTCTCTTCTCCCTTATCATGG - Intergenic
957989328 3:87610044-87610066 CTTTCTACTCTTCCTGATGAAGG + Intergenic
958018653 3:87971045-87971067 ATTTCTATTTTCTCTTTGGATGG - Intergenic
958072401 3:88631150-88631172 CTTTATATTTACTCTTCTGAAGG + Intergenic
959931099 3:111984000-111984022 ATTTATATTTTCCTTCATGAAGG + Intronic
959984518 3:112557665-112557687 CTTTCAATTTTCAGTTGTGATGG - Intronic
960212500 3:114987465-114987487 CTTTCTCTTTCCTCATATGAAGG + Intronic
960274622 3:115714198-115714220 TTTTCTTTCTTCCCTTTTGAAGG + Intronic
960490217 3:118308375-118308397 CTTTATATTTTCACTAATGTTGG - Intergenic
960532633 3:118782101-118782123 CTTTTTTTTTCCCCTTAAGAGGG - Intergenic
961214780 3:125150788-125150810 CATTCTATTTTCCCCTGTAAAGG - Intronic
961939812 3:130625268-130625290 TTGTCCATTTTCCCTTATGTTGG + Intronic
964685516 3:159392031-159392053 CTTTCTCTTTTCCCTCCAGAAGG - Intronic
964907797 3:161739376-161739398 CTTTCTATTTTACAATTTGAGGG - Intergenic
965684082 3:171283319-171283341 TTTTCTTTTTTCTCTTTTGATGG + Intronic
967424513 3:189311001-189311023 CATTCTATTTAACCTTATAATGG - Intronic
968271532 3:197407134-197407156 CTGTCTATTTTCCCATGAGAAGG + Intergenic
968889512 4:3360592-3360614 TTTTCTAATTGTCCTTATGAAGG + Intronic
969234165 4:5853397-5853419 CTTTCTTTCTTTCCTTCTGATGG - Intronic
970109551 4:12622433-12622455 CTTTACATTTTGCCTTATGTAGG - Intergenic
970822663 4:20237058-20237080 GTCTCTATTTTCCCATAAGAGGG + Intergenic
971840508 4:31846085-31846107 TTTTCTATTTTCCCTAAAAATGG - Intergenic
972884923 4:43473760-43473782 CTTTCTGTTTTCCATTGTTATGG + Intergenic
973217480 4:47686395-47686417 TCTTATATTTTCCCTTATGGTGG - Intronic
973663234 4:53130191-53130213 GTTTATAATTTCCTTTATGATGG - Intronic
974244060 4:59290789-59290811 CTTGCTATTTTCTCTTCTGGTGG + Intergenic
974434376 4:61838185-61838207 CTTTCTCTCTCCTCTTATGATGG - Intronic
974545683 4:63304336-63304358 CTTTCTCTTTTCTCTCATGTTGG + Intergenic
975442250 4:74424728-74424750 ATTTCTATTTTTCATTAGGAAGG + Intergenic
976226892 4:82801150-82801172 CTTTCTCTTTTCCCTCCTGTGGG + Intergenic
976457230 4:85262310-85262332 CTTTCTATTTTTCTTTGTCATGG - Intergenic
977170449 4:93755038-93755060 CTTGCTATTTTCCATGATAATGG - Intronic
977256278 4:94743771-94743793 CTGTTTATATTCTCTTATGAAGG + Intergenic
977975431 4:103259417-103259439 CTTTCTGTTTTCTTTTTTGATGG + Intergenic
978289646 4:107122287-107122309 ATTTATATGTTCCCTGATGATGG - Intronic
978479209 4:109169773-109169795 TTTGCTCTTTTCCCTTTTGAAGG - Intronic
978636102 4:110809142-110809164 TTTTATATTTCCCCTTATTAAGG + Intergenic
979040501 4:115786101-115786123 CTTTATATTTTCCCTGGTGGAGG - Intergenic
980382552 4:132042684-132042706 CTTCCTATTTTCCGTTATCTTGG + Intergenic
980464977 4:133163045-133163067 CCTTCTTTTGTCCCTTCTGATGG + Exonic
980565921 4:134540648-134540670 TTTAATATTTTCCATTATGATGG - Intergenic
980686186 4:136232684-136232706 CTTTAACTTTGCCCTTATGATGG - Intergenic
982762878 4:159308306-159308328 CTATGGATTTTTCCTTATGATGG - Intronic
984098678 4:175462407-175462429 CGTTCTATTTTTCCTGAAGATGG + Intergenic
984208532 4:176816761-176816783 CTTTTTATTTTTCTTTAAGATGG - Intergenic
987779041 5:22408833-22408855 CATTTTATTTTCCCCCATGATGG + Intronic
987943843 5:24578077-24578099 CTTTCCATTGTCCCTTCAGAGGG + Intronic
988268133 5:28978245-28978267 TTTTCTATTTGTACTTATGATGG - Intergenic
988381796 5:30506306-30506328 TTTTCTATTTGCGCTTATGTAGG - Intergenic
989126139 5:38054220-38054242 CTTTGTAGTTTCCCATGTGATGG + Intergenic
991300030 5:65121114-65121136 CCTTCTATTTTTCCTTTTAATGG - Intergenic
991710202 5:69401431-69401453 CATTTTATTTAACCTTATGATGG + Intronic
992216017 5:74525233-74525255 CTTTCTTTGTTCCTTAATGAGGG + Intergenic
993979839 5:94531975-94531997 CTTTCAAGTTTTCCGTATGATGG - Intronic
994305760 5:98202150-98202172 TTTTCTATTTCCCCTTATCGAGG - Intergenic
994635462 5:102340360-102340382 CTTTCTACTTTCCCTGAAGACGG + Intergenic
994975450 5:106798533-106798555 TTGTATATTTTCCATTATGAAGG - Intergenic
995171330 5:109116374-109116396 TTTTCTCTTTTCCCTTTTTATGG + Intronic
996336605 5:122390531-122390553 CTTTCTTTCTTCCTTTTTGAGGG + Intronic
996721742 5:126637543-126637565 CTTTCTTTCTTTCTTTATGAAGG - Intergenic
996758029 5:126955490-126955512 CTTTATTTTTGCCATTATGAAGG + Intronic
997044568 5:130298854-130298876 CTTTTGATTTTCCTTTATAAAGG - Intergenic
998615213 5:143732918-143732940 TTTTTTTTTTTCCCTGATGATGG + Intergenic
998648731 5:144093291-144093313 CTTTCCATTTTCCAGCATGAGGG + Intergenic
998769165 5:145522540-145522562 CTTTTTCTTTTCCCAAATGATGG + Intronic
1000022655 5:157332011-157332033 TTTTAAATTTTCCCTCATGAAGG + Intronic
1000430555 5:161147398-161147420 GTTTTTAATTTCCCTAATGATGG + Intergenic
1000686702 5:164258742-164258764 CTTTGTATTTACACTCATGATGG + Intergenic
1002698542 5:181106388-181106410 TTTGCTATTTTCCCTCATGGAGG + Intergenic
1003954903 6:11153763-11153785 CTTTCCATTTTCAGATATGATGG + Intergenic
1005575228 6:27183875-27183897 CTTTCTACCCTCCCTGATGAGGG - Intergenic
1005691901 6:28314630-28314652 CTTGCTATTTTCCTTTAGGGAGG + Intergenic
1006049635 6:31331817-31331839 CTTTCTACTCTCCCTGATGAAGG + Intronic
1006485569 6:34338223-34338245 CTATCTAGTCTCCCTTATGTGGG + Intronic
1007046347 6:38778849-38778871 CTTTCCATTTTCCCTCCTGAGGG + Intronic
1008103580 6:47418944-47418966 CTTTCTCATATCCTTTATGAAGG - Intergenic
1008910581 6:56728235-56728257 CTTTTTGTTTTTTCTTATGAGGG - Intronic
1009640242 6:66326189-66326211 GTTTTTATTTTCCCTTAAGCTGG - Intergenic
1010468026 6:76191726-76191748 CTTTTTATTATCACTTATGTTGG - Intergenic
1010978182 6:82340367-82340389 CTTTTTTTTTTCCTTTAGGAAGG + Intergenic
1012065331 6:94543298-94543320 ATTCCTATTTTCCTGTATGAAGG + Intergenic
1012365519 6:98434841-98434863 CTTAGAAGTTTCCCTTATGAGGG - Intergenic
1012520512 6:100115822-100115844 ATTGGTATTTTCCCTTCTGATGG - Intergenic
1013470868 6:110462973-110462995 CTTTTTTTTTTCCTTTAAGAAGG - Intronic
1014518706 6:122411390-122411412 CTTTCTTCTTTCCATTCTGAGGG + Intronic
1016276139 6:142355218-142355240 CTTTCAATTTTTCCGTAAGATGG + Intronic
1016780373 6:147951185-147951207 CTTTCTTTTTTTTTTTATGACGG + Intergenic
1019065052 6:169289325-169289347 CTTTCTGTGTTCTTTTATGAAGG - Intergenic
1019088033 6:169500431-169500453 CTATCTGTTTTCTCTTATCAAGG + Intronic
1020745328 7:12072356-12072378 CTTTCTATTCTCCCTGATGAAGG - Intergenic
1020846677 7:13294008-13294030 TTTACTATTTTCACTTTTGAAGG - Intergenic
1020853238 7:13384086-13384108 CTTTCCTTTTTCCCATATGAAGG - Intergenic
1021734494 7:23629588-23629610 CTTTCTATTTTTTTTTTTGAAGG - Intronic
1021788088 7:24172631-24172653 CTTTCCATTTTCCCTTCTCTTGG + Intergenic
1021930191 7:25573023-25573045 ATCTCTACTTTCCCTAATGAAGG - Intergenic
1021994011 7:26162478-26162500 TTTTGTATTTTTCCTTATTATGG - Intronic
1024021630 7:45376330-45376352 CTTTATATTTTTCTTTATGTTGG - Intergenic
1026681828 7:72472779-72472801 CTTTCTTTTTTCTTTTTTGATGG - Intergenic
1027766351 7:82347888-82347910 GTTTCTATTATGCTTTATGAAGG - Intronic
1027861019 7:83581412-83581434 CTATCAATTTTCCCGTTTGAAGG + Intronic
1028066807 7:86394569-86394591 CTCAATATTGTCCCTTATGAGGG - Intergenic
1029788132 7:102813848-102813870 ATTTCTAGTTTCTCTGATGAGGG + Intronic
1031207081 7:118773812-118773834 CTTTTACTTTTCCCTTATAAAGG - Intergenic
1031845245 7:126798196-126798218 CATTCTCTTTGCCCCTATGAAGG - Intronic
1032161305 7:129513089-129513111 CTTTCTTTTTTCTTTTAAGACGG + Intergenic
1032753226 7:134863611-134863633 CTTACTAGTTCCCCTTATAAAGG + Intronic
1032989143 7:137371856-137371878 CTTTCCATTGTCACTGATGATGG - Intergenic
1033097640 7:138444701-138444723 CTTTCTACTCTCCCTGATGAGGG + Intergenic
1033715232 7:143995396-143995418 CTACCTATTTTCTCTTATGTGGG - Intergenic
1033789958 7:144779650-144779672 CTTAACATTTTCCCTTTTGATGG - Intronic
1033790254 7:144784244-144784266 CTTTGTATGTTCCCTTTTGTTGG - Intronic
1035625560 8:1068187-1068209 GTTTATCTGTTCCCTTATGAGGG + Intergenic
1036104506 8:5825459-5825481 CTTTCTACTCTCCCTGATGAAGG + Intergenic
1037628629 8:20631526-20631548 CTCTTTATTTTCCCTTTAGAAGG - Intergenic
1038589756 8:28825742-28825764 CTTTCCACTTTCCCTTCTAAGGG - Intronic
1038861059 8:31389444-31389466 CTCTCTCTTTTCCTTTATCAAGG + Intergenic
1039645846 8:39281934-39281956 GTTTGTATTTTCCCCAATGAAGG + Intronic
1040773113 8:51003305-51003327 CTTATTAATTTCCCTTATAATGG - Intergenic
1040983585 8:53269776-53269798 TTGTCTACTTTCCCTGATGATGG + Intergenic
1041197747 8:55418127-55418149 CTTTCAACTGTCCCTTATTAAGG + Intronic
1042732662 8:71954532-71954554 CTTTCTAGTTATCCTTCTGAGGG - Intronic
1042857672 8:73284517-73284539 ATGTCTTTTTTCACTTATGATGG - Intergenic
1045421513 8:102021488-102021510 CTTTATATTTTCCTTTTTTATGG - Intronic
1045901893 8:107291871-107291893 CTTTCTATTTCCACTGAAGATGG + Intronic
1046429274 8:114102691-114102713 CTTTCTTTTCTGCCTTTTGAAGG - Intergenic
1046843029 8:118882568-118882590 CATTCTATTTTCATTTATGCTGG + Intergenic
1047074593 8:121385969-121385991 CTTTTTTTTTTTCCTTAAGACGG - Intergenic
1050368187 9:4892417-4892439 CTTTGTATTTCCCCTGATTAAGG - Intergenic
1050507933 9:6366686-6366708 CTTTCTCTTTCTCTTTATGATGG - Intergenic
1050507955 9:6366822-6366844 CTTTCTCTTTCTCTTTATGATGG - Intergenic
1051474737 9:17493461-17493483 CTTTTTGTTTTCCCTTAGCACGG - Intronic
1052034833 9:23668765-23668787 CTCTCTATTCTCCCTTGGGAGGG - Intergenic
1052202370 9:25798761-25798783 CTTTCCCTTTTGCCTTCTGAAGG - Intergenic
1055719328 9:79154026-79154048 CTTTTTTTTTTCCCCTAAGACGG - Intergenic
1056542139 9:87581251-87581273 GTTTTCATTTTCCCTTCTGAGGG + Intronic
1057583731 9:96310943-96310965 CTGTCTACTCTTCCTTATGAGGG + Intergenic
1057846249 9:98527392-98527414 CTTTCTATTTTCCAGCATTATGG - Intronic
1058820509 9:108725090-108725112 CTTTCTCTTTTCCCTAACTATGG - Intergenic
1058986010 9:110208633-110208655 CTTTCTATCTTCTCCTATCACGG + Intergenic
1060258773 9:122055626-122055648 CCTCCTATGTTCCCTTGTGATGG - Intronic
1061829350 9:133280999-133281021 CTTTCTACCTTCCCTGATGAGGG + Intergenic
1188538769 X:31226311-31226333 CTTTCTATCTTCCATTTTGTGGG + Intronic
1189309642 X:40010324-40010346 CTCTCTATTTTTCCCTAGGAAGG + Intergenic
1193936193 X:87625222-87625244 ATTTTTATTTTCACTTATCAAGG - Intronic
1194022664 X:88712340-88712362 CTTTCTTTCTTCTCTTTTGATGG + Intergenic
1194330194 X:92573351-92573373 TTTTCTATTTTACTTTATTATGG - Intronic
1195890392 X:109687303-109687325 CATTATATTTTGCCTAATGATGG - Intronic
1197168096 X:123401344-123401366 CTAGCTATTTTCACTAATGAAGG + Intronic
1197260678 X:124313863-124313885 TTTTCTTTTTTCTCTTCTGATGG - Intronic
1198145692 X:133854941-133854963 CTTGCTATTTTCACTTAATATGG - Intronic
1198547477 X:137708017-137708039 TTTTCTCTTTTCCCTTTTAAAGG - Intergenic
1198601635 X:138290607-138290629 CTTGCTATTTTCAATTTTGAAGG + Intergenic
1198770922 X:140129143-140129165 CTTCCTATTTTCTCTCATAAAGG + Intergenic
1199191687 X:144979236-144979258 CTGTCTATTTTGCTATATGAGGG - Intergenic
1200373419 X:155752570-155752592 TTTTCTATTTTTTCTTATTATGG - Intergenic
1200638903 Y:5692533-5692555 TTTTCTATTTTACTTTATTATGG - Intronic
1200802343 Y:7398232-7398254 CTTTGTATCTTCCCTGCTGAGGG - Intergenic
1201277580 Y:12313326-12313348 CTTTCTATTGTACCTTCAGAGGG - Intergenic
1201719048 Y:17077352-17077374 CTTTCTGTTTTCCCCTGTGTGGG + Intergenic