ID: 1085366754

View in Genome Browser
Species Human (GRCh38)
Location 11:75954744-75954766
Sequence CTATTTCACCAGATCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085366754_1085366758 9 Left 1085366754 11:75954744-75954766 CCCAGAAAGATCTGGTGAAATAG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1085366758 11:75954776-75954798 TAAACAGTTGCTGTAAAATAGGG 0: 1
1: 0
2: 1
3: 29
4: 305
1085366754_1085366757 8 Left 1085366754 11:75954744-75954766 CCCAGAAAGATCTGGTGAAATAG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1085366757 11:75954775-75954797 ATAAACAGTTGCTGTAAAATAGG 0: 1
1: 0
2: 0
3: 20
4: 286
1085366754_1085366759 28 Left 1085366754 11:75954744-75954766 CCCAGAAAGATCTGGTGAAATAG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1085366759 11:75954795-75954817 AGGGTCATGTAATATTTTTGTGG 0: 1
1: 0
2: 1
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085366754 Original CRISPR CTATTTCACCAGATCTTTCT GGG (reversed) Intronic
901702410 1:11052782-11052804 CTGTTTCAGCAGATCATCCTGGG + Intergenic
904579773 1:31534095-31534117 CTATTTCCCGAGTTCTTTCTTGG + Intergenic
904582829 1:31560083-31560105 CTATTTCACCACATATGTCTAGG + Intergenic
909134729 1:71783785-71783807 CTATTTTGCCAGATTTTTATAGG - Intronic
909308860 1:74119860-74119882 ATATTTCTTCAGATGTTTCTTGG + Intronic
910956691 1:92714152-92714174 CCATTTCTTCACATCTTTCTGGG + Intronic
913482357 1:119300930-119300952 CCTTTTCACCAGATTTTGCTTGG + Intergenic
916754155 1:167752719-167752741 CTCTTTTGCCAGATTTTTCTAGG + Intronic
917644332 1:177015266-177015288 TTATTTCACCAAATATTTCTAGG + Intronic
918134896 1:181663008-181663030 TTCTTTCACAAGATCTTTCCAGG + Intronic
918352360 1:183670296-183670318 CTATTTTACCAGAGCCTACTGGG - Intronic
920132439 1:203742893-203742915 ATATTGCACAAAATCTTTCTAGG - Exonic
921162904 1:212485701-212485723 CTATTTCATCAGATGGTTATGGG - Intergenic
921761321 1:218918523-218918545 CTGTTTCTCCAGATTCTTCTTGG + Intergenic
922407021 1:225325081-225325103 CTATTTCACCAAATTTCTCTCGG + Intronic
923401324 1:233618001-233618023 CTATTTGTTCAGATTTTTCTTGG + Intronic
1064026408 10:11852293-11852315 ATATTTTACCAGATCTTTTTGGG + Intronic
1065106224 10:22389052-22389074 CAATTTCACCAGTTGTTTTTAGG + Intronic
1066233530 10:33462512-33462534 ATAATTTAACAGATCTTTCTGGG - Intergenic
1068294128 10:55045481-55045503 CTGTTTCACAAGATCTTTGTGGG + Intronic
1069419494 10:68234225-68234247 CTTTGTCAATAGATCTTTCTAGG - Intergenic
1069637563 10:69935090-69935112 CTATTCTTCCAGATTTTTCTTGG - Intronic
1071199598 10:83204283-83204305 TTATTTCACCAGATGTAACTGGG - Intergenic
1072171993 10:92872540-92872562 ATTTTTCACCTGATCATTCTTGG + Intronic
1073889860 10:108088540-108088562 CTATTTCAACAAATGGTTCTGGG + Intergenic
1075032686 10:119036134-119036156 CTTTTTCACCTTCTCTTTCTCGG + Exonic
1075640620 10:124061824-124061846 CTATTTCACCTGATCTGACGAGG - Intronic
1075968571 10:126633477-126633499 CTCCTTCCCCAAATCTTTCTGGG - Intronic
1078141418 11:8695967-8695989 CTATTTCATCAGCTCATTCGAGG - Intronic
1078341096 11:10498500-10498522 ATACTTCACCCGAACTTTCTGGG - Intronic
1078554668 11:12312785-12312807 CTGTCTCTTCAGATCTTTCTTGG + Intronic
1079226797 11:18613893-18613915 CTTATTCAGCAGATATTTCTTGG - Intronic
1080807783 11:35670698-35670720 CTATTTCTCTGGATCTTTTTGGG + Intronic
1081104739 11:39051547-39051569 TTACATCTCCAGATCTTTCTAGG + Intergenic
1081264993 11:41009813-41009835 CTACTTCAACATATCTTTTTTGG - Intronic
1081319629 11:41675471-41675493 AGATTTCAACATATCTTTCTTGG + Intergenic
1083640515 11:64142803-64142825 CTTTTTCACCAGCTCCCTCTGGG - Intronic
1085081769 11:73640685-73640707 ATTTTTCACCTGATCTGTCTTGG - Intergenic
1085225556 11:74917523-74917545 CTATTTCACTAGAGGATTCTGGG - Intronic
1085366754 11:75954744-75954766 CTATTTCACCAGATCTTTCTGGG - Intronic
1086220413 11:84436613-84436635 CTAATTCTCCAGTGCTTTCTGGG - Intronic
1086282830 11:85210590-85210612 CTCTTTCAAAAGAACTTTCTTGG + Intronic
1087668306 11:101075825-101075847 CTATTTCTCCACATCTTTTCCGG - Intronic
1087801920 11:102513734-102513756 CTATCTCACATCATCTTTCTTGG + Intergenic
1089689478 11:120178358-120178380 GTAAATCACCAGATCTCTCTAGG + Intronic
1089972642 11:122706444-122706466 CTATTTCTCCAGACCTTTATGGG - Intronic
1090464319 11:126920586-126920608 CTATTTTTCCTGATCTTACTTGG + Intronic
1093721731 12:22450923-22450945 CTCTTTCACCTGCTTTTTCTTGG - Intronic
1098199859 12:68043113-68043135 CGATTTCACCAGAGCTTCCATGG - Intergenic
1098214433 12:68200510-68200532 CTTTTTACCCAGAGCTTTCTGGG - Intergenic
1100809797 12:98326582-98326604 CTATTTGTCCAGATTCTTCTTGG + Intergenic
1104874880 12:132026843-132026865 CTCTTTGACCACATCTTTGTAGG + Intronic
1105815391 13:24031560-24031582 TCATTTCACCAGATTTTTCATGG - Intronic
1108533631 13:51349436-51349458 ATATTTCAACAGATCTCTCAGGG + Intronic
1110120871 13:71879996-71880018 CTATTTCACCAGATCTCTTGGGG + Intergenic
1111661345 13:91216253-91216275 CTATTTCATCACATCCTTCGGGG - Intergenic
1112606771 13:100913998-100914020 CTATTTCAACACATCTTATTGGG + Intergenic
1117212566 14:53515999-53516021 CGATTTCACCAATTCTTTTTAGG + Intergenic
1117525694 14:56600940-56600962 CTGTTTCACCTGATTTTCCTTGG - Intronic
1119591176 14:75889420-75889442 CTATTCCACAAGATCTCTGTAGG - Intronic
1119783948 14:77298544-77298566 TATTTTCACCAGATCTATCTGGG + Intronic
1122359115 14:101148432-101148454 CTCCTTCCCCAGGTCTTTCTTGG + Intergenic
1122452714 14:101823685-101823707 CTCTGTCACCAGCTCCTTCTTGG - Intronic
1125963828 15:43856169-43856191 TTATTTAACCAGATCTCTCTTGG + Intronic
1129307835 15:74681082-74681104 CTATATCTACAGATCTTGCTGGG - Intronic
1130625957 15:85515180-85515202 TTATTTGAGCAGATATTTCTTGG + Intronic
1131309947 15:91281271-91281293 CTATTTCCCCACATCTTTGTTGG + Intronic
1139779103 16:69336060-69336082 CTCTCTCCCCAGATCTTTGTGGG + Intronic
1143660934 17:8324282-8324304 CTCTTTCCCCAGATCTTCCCAGG - Intergenic
1147465214 17:40605642-40605664 GTCTTTCACCACATCTTTTTGGG + Intergenic
1148632679 17:49123826-49123848 CAATTTCCCAAGAGCTTTCTTGG + Intergenic
1148986653 17:51628396-51628418 CAATTTGTCCAGATCTCTCTTGG + Intergenic
1151096765 17:71507695-71507717 TTATTTCAAAAGATCATTCTGGG - Intergenic
1153152645 18:2112154-2112176 CCATTTCACCACAGCTTTCATGG - Intergenic
1155381223 18:25224669-25224691 AAGTTTCACCAGATCTTGCTTGG + Exonic
1156081670 18:33343121-33343143 CTCTTTCATCAGATCATTATAGG + Intronic
1156549988 18:38005157-38005179 CACTTTCAGCAGTTCTTTCTAGG - Intergenic
1156635788 18:39027826-39027848 CTCATTCACCAGACATTTCTTGG - Intergenic
1158635486 18:59152599-59152621 CTATTTCACCAGCTCTGATTGGG - Exonic
1159887090 18:73919123-73919145 CTATTTCACCTGATTGTTGTAGG - Intergenic
1163106717 19:15127454-15127476 CTCTTTCTCCAGATCCTTGTGGG - Intergenic
1164803106 19:31093872-31093894 CTATTTCCACAGAGATTTCTAGG + Intergenic
1166023700 19:40057497-40057519 ATATTTCAACATATCTCTCTTGG + Intergenic
1166825650 19:45607379-45607401 CTTTTCCAGCAGAACTTTCTTGG + Intronic
926934013 2:18068539-18068561 CTATTTCAACAAATCTTGCATGG + Intronic
930766342 2:55089448-55089470 CTACTTCTACAGTTCTTTCTAGG + Intronic
931487098 2:62705157-62705179 TTATTTCACCAGTTCCTCCTGGG - Intronic
931896910 2:66742601-66742623 CTAATTCACCAGATATCTCTTGG - Intergenic
932117736 2:69068460-69068482 CTATTTGACCAGCTCTTCATGGG - Intronic
933412486 2:81943528-81943550 CTATCTCACCAGATCTCTCATGG - Intergenic
937111552 2:119370632-119370654 CTATTACACCTGTTCCTTCTAGG - Intronic
938158604 2:128962276-128962298 CTATTTCAGCCTAACTTTCTAGG - Intergenic
938336108 2:130499545-130499567 CTATTACAGCATATCTGTCTAGG - Intronic
938353714 2:130621120-130621142 CTATTACAGCATATCTGTCTAGG + Intronic
939794204 2:146621245-146621267 CTATTTCATCATATCTGTCAGGG - Intergenic
939982757 2:148800479-148800501 ATATTTCACCAAATTTTTATTGG + Intergenic
940279677 2:151976413-151976435 CTATTTCACCAAATTCCTCTTGG - Intronic
945278292 2:208010714-208010736 CTACTTCCCCAGCCCTTTCTGGG - Intronic
946164535 2:217856017-217856039 TTATTTCACCAGATCTCCCAGGG - Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
948160839 2:235822779-235822801 CATTCTCACCAGATCTATCTGGG - Intronic
1169394036 20:5214188-5214210 CTATTTCACCTCTTCTTTGTAGG + Intergenic
1169556911 20:6761046-6761068 ATATTTAACCAGAATTTTCTAGG + Intergenic
1169597553 20:7218077-7218099 CTCTTTCTCTAGATCTCTCTGGG + Intergenic
1170296904 20:14836905-14836927 TTATTTCACCAAATAGTTCTTGG - Intronic
1171843060 20:30239321-30239343 CCACAGCACCAGATCTTTCTAGG + Intergenic
1172749633 20:37241717-37241739 ATATTTCTCCAGGCCTTTCTTGG + Intergenic
1172856546 20:38008379-38008401 GTATTTAACCAGTCCTTTCTTGG - Intronic
1174255485 20:49251498-49251520 CTGTCTTACCCGATCTTTCTTGG - Intronic
1182753410 22:32659441-32659463 CTATTTCACAAACTCTTCCTGGG + Intronic
1182871948 22:33655381-33655403 CTGAATCACCAGATCTTCCTGGG + Intronic
1182990033 22:34758865-34758887 CTTTCTCACCAGCTTTTTCTTGG + Intergenic
952292046 3:32026669-32026691 TCATTTCCCCAGATCTCTCTTGG - Intronic
952920555 3:38281134-38281156 CTCTTTCACCAGACCTCCCTCGG - Intergenic
953098579 3:39803735-39803757 ATATTTCACCAAATATTGCTGGG - Intergenic
953315032 3:41919220-41919242 CTATTTATCAAGAACTTTCTAGG + Intronic
955055246 3:55448745-55448767 CTGTTACAACAGATTTTTCTTGG - Intergenic
956138620 3:66123644-66123666 CTATTTCTTCAGATTCTTCTTGG - Intergenic
956559416 3:70557950-70557972 CTGGATTACCAGATCTTTCTGGG + Intergenic
956908612 3:73793666-73793688 CCATTTGATCAAATCTTTCTTGG + Intergenic
957040877 3:75334574-75334596 CTAAATCAGCAGAACTTTCTAGG + Intergenic
957193990 3:77044340-77044362 CTATTTCAGCAGATATTACTAGG - Intronic
957935526 3:86936948-86936970 TTATTTCACTTGATCTTCCTTGG + Intergenic
960072350 3:113445188-113445210 CTAATTCACAGGATCTTTGTAGG + Exonic
960308336 3:116089828-116089850 CCACTTCTCCAGATCTTTCAGGG + Intronic
960727660 3:120686864-120686886 CTATTTGTCCAGATTCTTCTTGG + Exonic
961041340 3:123680504-123680526 CATTCTCACCAGATTTTTCTTGG + Intronic
961315976 3:126035902-126035924 CTATTTCCCCTGATATCTCTAGG - Intronic
962419397 3:135214871-135214893 CTATTTCACCACACCATGCTGGG - Intronic
963818176 3:149857072-149857094 CTATCTCACCTAAACTTTCTGGG - Intronic
965365394 3:167792581-167792603 ATCTTTCACCAGATCTATTTAGG - Exonic
966083920 3:176043382-176043404 TTAATTCAACAGATCTTTGTGGG - Intergenic
967863310 3:194169864-194169886 GCATTTCAACAGATCTTACTGGG + Intergenic
970280186 4:14446288-14446310 CTAGTTCCTCTGATCTTTCTTGG + Intergenic
971767927 4:30857721-30857743 CTTTTGCACCAGTTCTATCTTGG + Intronic
972359321 4:38313193-38313215 CTATTTCATCATGTCTTGCTTGG + Intergenic
974154361 4:58051790-58051812 CTATTTCTCCTGATTTTTCAGGG - Intergenic
975594415 4:76034984-76035006 CTTTTTCAAAAGATCTGTCTTGG + Intronic
976010639 4:80484111-80484133 TTATTTCACCAGCTCTTTAGGGG - Intronic
976093377 4:81480313-81480335 CTATTTTGGCAGATCTCTCTGGG + Intronic
976264514 4:83177930-83177952 CTGTTTCTTCACATCTTTCTTGG + Intergenic
976993036 4:91393229-91393251 CTATTCTACTAGATCTCTCTAGG + Intronic
977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG + Intergenic
978507081 4:109470309-109470331 CTAATTCACCAGGTCTTTTATGG + Intronic
978944283 4:114476355-114476377 ATTTTTCACCAGGTTTTTCTTGG + Intergenic
986406404 5:7429133-7429155 TTATTTCACCTGCTCTTTCCTGG - Intronic
988101439 5:26684237-26684259 CTATTTTCCTAGATGTTTCTAGG - Intergenic
989009441 5:36853482-36853504 CTGTTTCATCAGATGTTTATAGG + Intergenic
989837948 5:46018309-46018331 CTTTTCCACCATAGCTTTCTAGG - Intergenic
990468359 5:56090341-56090363 ATAGTTCACAAGCTCTTTCTTGG - Intergenic
998303151 5:141045889-141045911 GGATTTCAACATATCTTTCTGGG + Intergenic
998636080 5:143956178-143956200 GTATTTCACCACACCCTTCTGGG - Intergenic
998784203 5:145691000-145691022 CTATTTCATCATAACTTTGTTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1003815780 6:9838527-9838549 CTATTTGTTCAGATCCTTCTTGG - Intronic
1004291724 6:14373763-14373785 CTCTTCCCCCAGATCTTCCTGGG + Intergenic
1005609174 6:27507013-27507035 GGATTTCAACATATCTTTCTGGG - Intergenic
1005951085 6:30631808-30631830 CTCTCTCTCCAGATATTTCTTGG - Intronic
1007377285 6:41465600-41465622 GTGTTACAACAGATCTTTCTGGG + Intergenic
1008303183 6:49868409-49868431 CTATCTCTCAAGATTTTTCTGGG - Intronic
1010141190 6:72616733-72616755 CTATTTAAACATATCTCTCTGGG - Intergenic
1013711278 6:112902541-112902563 TTATTTCCCCTGATGTTTCTGGG - Intergenic
1014028785 6:116678405-116678427 CTATTCCTCCAGTTCTTTCCTGG + Intergenic
1015094888 6:129403445-129403467 TAATTTCACAAAATCTTTCTGGG - Intronic
1015824770 6:137299913-137299935 CTATTTCAGCTGTACTTTCTTGG + Intergenic
1018848969 6:167574105-167574127 CTCCTTCCCCAGGTCTTTCTGGG - Intergenic
1019026661 6:168971354-168971376 CTACTTCACCAGGTCCTGCTTGG - Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1026411908 7:70132016-70132038 CCTTTTCACCACATTTTTCTTGG - Intronic
1026435501 7:70393441-70393463 GTATTTCACTGGATCTTACTGGG + Intronic
1027682772 7:81241033-81241055 GTCTTCCACCAGAGCTTTCTTGG - Intergenic
1034841088 7:154397883-154397905 CTAGATCTCCAAATCTTTCTAGG + Intronic
1039418651 8:37417648-37417670 CTATACTACCAGATCTTGCTGGG + Intergenic
1039626103 8:39055565-39055587 CTATTTCACTAGTTCCTTCCAGG + Exonic
1041542170 8:58997610-58997632 CTATTTGACAAAATCTTGCTGGG + Intronic
1041676567 8:60545941-60545963 CTAGCTCAACAGATCATTCTAGG + Intronic
1042610076 8:70589035-70589057 CTACTTCACCAAATCTTTTGAGG + Intronic
1044000188 8:86870071-86870093 TTAATTCACCAGACATTTCTAGG + Intronic
1044237354 8:89846272-89846294 CTATGTCATCATTTCTTTCTTGG + Intergenic
1044859806 8:96511966-96511988 CTATCCCACCAGACCTGTCTTGG - Intronic
1050157049 9:2678896-2678918 CTATCTAACCTGATATTTCTGGG + Intergenic
1053183447 9:35993904-35993926 CTATTCCCCCAGATCTATCATGG - Intergenic
1053561842 9:39204372-39204394 CTATTTCAGAATAACTTTCTAGG + Intronic
1053827651 9:42042391-42042413 CTATTTCAGAATAACTTTCTAGG + Intronic
1054135276 9:61414580-61414602 CTATTTCAGAATAACTTTCTAGG - Intergenic
1054602908 9:67145051-67145073 CTATTTCAGAATAACTTTCTAGG - Intergenic
1054740119 9:68797577-68797599 CCATTTCATCTGATCTTTCAGGG - Intronic
1055661260 9:78506233-78506255 CTATTTCCACAGATATTTCCTGG + Intergenic
1056685324 9:88754280-88754302 ATATTTCAACAGAGCTTGCTGGG - Intergenic
1057382555 9:94582191-94582213 GTATATCAAAAGATCTTTCTAGG - Intronic
1186133727 X:6496693-6496715 CTAATTCAAAAGATCTTTCTTGG + Intergenic
1186201878 X:7163269-7163291 AGATATCACCAGATGTTTCTTGG + Intergenic
1188123698 X:26341394-26341416 CTGTTTCAGCAAATATTTCTTGG - Intergenic
1188164913 X:26850457-26850479 CTTTTTCACCATATCAGTCTTGG - Intergenic
1188368513 X:29339933-29339955 TTTTTTCATCAGATGTTTCTGGG + Intronic
1188393961 X:29656988-29657010 CTATCATACCTGATCTTTCTGGG + Intronic
1189544072 X:42023582-42023604 CTACTTCATCAGATCCTCCTTGG + Intergenic
1189606866 X:42687576-42687598 CTATTTAAATAGATTTTTCTAGG - Intergenic
1189646582 X:43139305-43139327 ATATTTCACCAGATATGTCTAGG + Intergenic
1190777415 X:53564199-53564221 CTATAGCACCAGCTCTTGCTGGG - Intronic
1191716802 X:64199363-64199385 CTAATTCACCTGAAGTTTCTTGG + Intronic
1195155066 X:102114906-102114928 TTATTTCAACAGATATTTATTGG + Intergenic
1195239422 X:102936499-102936521 TTATTTCAACACATCTTTCTTGG + Intergenic
1195298282 X:103501554-103501576 TTATTTCAACACATCTTTGTTGG - Exonic
1197619405 X:128730911-128730933 CTTTTTAACCATATTTTTCTTGG - Intergenic
1197881718 X:131173606-131173628 ATATTTCACCTTATCTTTCTAGG - Intergenic