ID: 1085370390

View in Genome Browser
Species Human (GRCh38)
Location 11:75998451-75998473
Sequence CATCTTAGGCAGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085370390_1085370398 30 Left 1085370390 11:75998451-75998473 CCTTCCAGCCTCTGCCTAAGATG 0: 1
1: 0
2: 0
3: 26
4: 257
Right 1085370398 11:75998504-75998526 GAATAAAGAAAAAAAAACACTGG 0: 1
1: 2
2: 43
3: 714
4: 8904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085370390 Original CRISPR CATCTTAGGCAGAGGCTGGA AGG (reversed) Intronic
900977782 1:6027964-6027986 CATCTGAGCCAAAGTCTGGATGG + Intronic
901741323 1:11343987-11344009 CACATTAGGAGGAGGCTGGACGG - Intergenic
902478367 1:16699652-16699674 CAGCTTAGGGAGAGGCTGAGGGG + Intergenic
903714373 1:25353180-25353202 CTTCTTATCCAGAGCCTGGAAGG + Intronic
904431214 1:30465706-30465728 CAGCTGAGGCAGAGCCTGAATGG + Intergenic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
907814822 1:57908262-57908284 CATCATAGCCAAAGGCAGGAGGG - Intronic
908142766 1:61204233-61204255 CATCTTAGGCATAGGCTCAAAGG + Intronic
910321823 1:85955036-85955058 CATCCTAGGCACAGGCCTGAGGG - Intronic
911043194 1:93608004-93608026 CTTCTGAGTCAGAGGCTGGATGG + Intronic
912562828 1:110562522-110562544 CAACTAAAACAGAGGCTGGAAGG - Intergenic
915119423 1:153619410-153619432 CATCTCAGGGAGATGCTGCAGGG + Intronic
915446964 1:155979372-155979394 CTTCTTGGGGAGAGGCTGGTTGG - Intronic
915623025 1:157097814-157097836 GATCTTAGCCAGAGGAGGGAGGG - Intronic
915853534 1:159354163-159354185 CATCTTCTCCAAAGGCTGGATGG + Intergenic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
917864160 1:179177328-179177350 CCTCTTTGGCAGAGGCCAGAAGG - Intronic
919938826 1:202272580-202272602 CCTCTTAGGGAAGGGCTGGATGG - Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
923099560 1:230801501-230801523 CTCCTGAGGCTGAGGCTGGAAGG + Intronic
1064670013 10:17703706-17703728 CCTATTTGGGAGAGGCTGGAAGG - Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1067740881 10:48895389-48895411 CACCTTAGGCTGGGGCTGGCAGG + Intronic
1068512595 10:57984960-57984982 CATTTTAGTCAAAGGCTGAATGG + Intergenic
1070048498 10:72863118-72863140 CATCTTAGGCAGAGGAAAGTGGG - Intronic
1070593034 10:77813634-77813656 CATCTAAGGCTGGGGCAGGAGGG - Intronic
1072195790 10:93116296-93116318 CCTCTGAGGAAGAGGCTGGCAGG - Intergenic
1072395393 10:95034033-95034055 TAACTTAGAGAGAGGCTGGAAGG - Intergenic
1072660112 10:97358704-97358726 CACCTAAGGCAGAGGATGAAGGG - Intronic
1073458427 10:103651658-103651680 CATCTTGGCAAGAGGCAGGATGG - Intronic
1073933478 10:108602182-108602204 ATTCTTAGTCAGTGGCTGGAAGG + Intergenic
1075729530 10:124628034-124628056 CTTGTTGGGCTGAGGCTGGACGG - Intronic
1075955772 10:126521456-126521478 GTTCTTTGGCCGAGGCTGGAAGG - Intronic
1076029947 10:127149004-127149026 CTTCTTCGGCAGAGGATTGATGG - Intronic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077184410 11:1229869-1229891 CACCCCAGGCAGAGGCTGGCGGG - Intronic
1078120488 11:8503773-8503795 CATCATAATAAGAGGCTGGAAGG - Intronic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1079826790 11:25205928-25205950 CATATAAGACAGAGGCAGGAGGG + Intergenic
1080573403 11:33577303-33577325 CTTCTGAGGCAGTTGCTGGAGGG + Intronic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1081589107 11:44408539-44408561 CAGCATAGGTAGACGCTGGAGGG + Intergenic
1082760898 11:57126050-57126072 CATCTAAAGCGGAGGATGGATGG - Intergenic
1083441745 11:62681029-62681051 CATCCTAGGCGGAGACTGGTTGG - Intergenic
1084433720 11:69126032-69126054 CAGCAGAGGCACAGGCTGGAGGG - Intergenic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1086248251 11:84781900-84781922 GGTCTAAGACAGAGGCTGGATGG + Intronic
1087137278 11:94733602-94733624 CATCTAAGGCAGAGGCCTGAGGG - Intronic
1087727771 11:101741761-101741783 CAGCTGAGGCAGAGGCCAGATGG - Intronic
1088781536 11:113138934-113138956 TATGCTAGGCAGAGACTGGAGGG - Intronic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1089194695 11:116687379-116687401 CATTATTGGCACAGGCTGGATGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089541831 11:119193819-119193841 CAGCTGAGGCAGAGGCTGCAAGG - Exonic
1091364537 11:135006789-135006811 GATCGGAGGCTGAGGCTGGATGG - Intergenic
1091566133 12:1649474-1649496 CATCGTAGGCAGAGGAGGGAGGG - Intergenic
1096868127 12:54577277-54577299 CATCTTCGGCAGGGGATGGGGGG - Exonic
1098383924 12:69898445-69898467 CATCTGGGGCAGAGGCAGGTGGG + Intronic
1099710931 12:86223599-86223621 TATCTTAGGCAGGGGCAGGGTGG - Intronic
1101125944 12:101633767-101633789 GATGTCAAGCAGAGGCTGGATGG + Intronic
1101416975 12:104516888-104516910 CAACTTAGGCATAGGATAGAAGG - Intronic
1102466600 12:113134128-113134150 CATCTTAGAAAGAGTCTGGTGGG + Intronic
1103516793 12:121513509-121513531 CATCTTAGCGAGAGCATGGATGG + Intronic
1104034925 12:125091569-125091591 CATCCTGGGCAGGGGCTGCATGG + Intronic
1104170677 12:126277350-126277372 CAAGTTAGGAAGAGGCTGAATGG + Intergenic
1104517316 12:129439910-129439932 CATCTGGGGCAGATGCTTGAAGG + Intronic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1106808255 13:33333507-33333529 CACCTTAGAAGGAGGCTGGAGGG + Intronic
1111584140 13:90262257-90262279 GGTAATAGGCAGAGGCTGGAAGG - Intergenic
1112761175 13:102695149-102695171 GGTCCTAGGCAGAGGCTGGGTGG - Intergenic
1114620720 14:24094537-24094559 CATCCTAGGCGGAGGCGGGCAGG + Intronic
1117435030 14:55707899-55707921 CATCTGAGGCAGAGCCAGTAGGG + Intergenic
1118763754 14:68896360-68896382 CTTCTCAGGCTGAGGCTGGTGGG - Intronic
1119157859 14:72428065-72428087 TAGCTTAGGCAAAGGCTAGATGG + Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1122664542 14:103319382-103319404 CAGGTTAGGGAGAGCCTGGAAGG - Intergenic
1122859290 14:104575318-104575340 CATCTTAGGGGCTGGCTGGAGGG - Intronic
1124169585 15:27360682-27360704 GATCTTATGTAGAGGCTGCAGGG - Intronic
1126444161 15:48723368-48723390 CATATAAGGGAGAGGCTGCAGGG - Intronic
1126937801 15:53730650-53730672 CATCTCAGGGAGAGGATGGTAGG - Intronic
1127508183 15:59614898-59614920 CATCTAAGTCAGAGGCCGGTGGG + Intronic
1129121919 15:73403375-73403397 CCTCTTACTCAGAGGCTGGTGGG + Intergenic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1133783699 16:8958889-8958911 TTGCTTAGGCAGAGGCCGGATGG + Intronic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137549731 16:49429219-49429241 CATATGAGGCAGAAGCTTGAAGG - Intergenic
1138812604 16:60168381-60168403 CAGTTTAGGCAGATGCTGCAAGG - Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139546314 16:67651449-67651471 CAGCTTGGGCAGAAGCTGGAGGG + Exonic
1140184987 16:72761254-72761276 AAACATGGGCAGAGGCTGGAAGG - Intergenic
1140801047 16:78488650-78488672 CATCTGAGACAGTGGCTGTAGGG + Intronic
1141109825 16:81263041-81263063 AGACTGAGGCAGAGGCTGGAGGG - Intronic
1141457901 16:84156393-84156415 TATCGGAGCCAGAGGCTGGATGG + Intronic
1141602251 16:85133926-85133948 GACCTTAGGCTGAGCCTGGAGGG - Intergenic
1142649521 17:1338584-1338606 AATCTTATGCCCAGGCTGGAGGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143592297 17:7892898-7892920 CACCTGAGGCTGAGGCAGGAGGG - Intronic
1143812530 17:9483860-9483882 CATCTTGGGCACAGGCAGGGTGG + Intronic
1145234803 17:21200941-21200963 CATCTTTGAAGGAGGCTGGAGGG - Intronic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1147433343 17:40388399-40388421 CACCTTAGCCAGAGGCTGTAAGG + Intergenic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1148469810 17:47885865-47885887 CATCTCAGGCCCAGGCTGCATGG + Intergenic
1148758008 17:49984638-49984660 CATCTTGGGCAGAGGCAGCCAGG + Intergenic
1149091399 17:52786757-52786779 CATCTTTGGAGGAGGATGGAAGG + Intergenic
1149422007 17:56520509-56520531 CATCATTGGCAGAGGCCAGAAGG + Intergenic
1149446280 17:56715698-56715720 CAGGTAAGGTAGAGGCTGGAAGG + Intergenic
1150819250 17:68421851-68421873 CTTCTCAGGAAGAGGCTGGTAGG + Exonic
1151207435 17:72518311-72518333 AATGTTTGGCAGGGGCTGGAGGG + Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1157182469 18:45509930-45509952 TCTGTTAGGCAGAGGATGGATGG - Intronic
1160529440 18:79554993-79555015 GAGCTTAGACAGAGGCTGCAAGG + Intergenic
1161540015 19:4844870-4844892 CATGTAAGTCAGATGCTGGAAGG - Intronic
1162332486 19:10038836-10038858 CATCTTGGGCAGTGGCGGGGTGG - Intergenic
1162782524 19:13013703-13013725 CATGTGAGACAGAGGCTGAATGG + Intronic
1164032454 19:21419750-21419772 CATCATAGGCCTGGGCTGGAGGG + Intronic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1165358780 19:35320719-35320741 CATCCTGGGCAGAGGTTGGGGGG + Intronic
1165446797 19:35861048-35861070 AATCTGAGGCGGTGGCTGGAGGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166390795 19:42407777-42407799 CATGTTGGCCAGAGACTGGAGGG + Exonic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1167144840 19:47675558-47675580 CAGCTTGGGCAGAGGCGTGAAGG + Intronic
1168275633 19:55276819-55276841 CATTTTGGACAGGGGCTGGACGG - Intronic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
1168715636 19:58525553-58525575 CAGCTTAGAGAGAGGCTGGAGGG + Intronic
1202712389 1_KI270714v1_random:25483-25505 CAGCTTAGGGAGAGGCTGAGGGG + Intergenic
925201175 2:1968764-1968786 CTCTTTAGGCAGAGGCTGCACGG + Intronic
925624148 2:5825593-5825615 ATTCTTTGGTAGAGGCTGGAGGG - Intergenic
926057045 2:9779899-9779921 CATCACAGGCAGAGGCAGGCTGG - Intergenic
926239517 2:11074417-11074439 CATCTAAGGCAGTGGCCGGCAGG + Intergenic
927254646 2:21029654-21029676 CATTTTCCGCAGAGCCTGGATGG + Exonic
927430321 2:23021763-23021785 CAGCTCTGGCAGAGGCAGGACGG + Intergenic
928076514 2:28269935-28269957 CATATTAGGAAAATGCTGGAAGG + Intronic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
930689646 2:54347696-54347718 CATCCTAGGCAGAGGTTTGGAGG - Intronic
931110178 2:59101862-59101884 CATCTAAGGCAGGGGCAGTAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
933644503 2:84799425-84799447 CTACTTGGGCAGAGACTGGAGGG + Intronic
934077588 2:88441100-88441122 CGTGTAAGGCAGAGGCAGGAGGG + Intergenic
934708272 2:96499699-96499721 CCACTCAGGCAGCGGCTGGAGGG - Intronic
937111304 2:119368621-119368643 CATCTAGGGCAGAAGCTGAACGG - Intronic
937866017 2:126752466-126752488 CAACTTGGCCAGAGGCTGGATGG - Intergenic
938389374 2:130892994-130893016 CATCCTAGGCAGTGGCTTGCAGG + Intronic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
940479108 2:154205671-154205693 CATCTTATGCAGATGCTGGCAGG + Intronic
945011578 2:205469530-205469552 CTTCTGAAGCAGAGACTGGATGG - Intronic
945948443 2:216016084-216016106 CAGCTAAGCCAGAGGCTGCAGGG - Intronic
947174309 2:227347476-227347498 CATCTTAGAAAGAGGCTAGAAGG - Intronic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
948556584 2:238815427-238815449 CAACTCAAGCAGAGGCTGCATGG + Intergenic
948887854 2:240892923-240892945 CAACTGAGGCAGAGGCCAGAGGG - Intronic
948909195 2:240994520-240994542 CTTCCTGGCCAGAGGCTGGATGG - Intergenic
1168917580 20:1503782-1503804 CATCATAGGCAGACACTAGAGGG - Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1172079972 20:32332463-32332485 CATCTTAGGCTCTGCCTGGAGGG - Exonic
1172307747 20:33893428-33893450 CATCCTAAGTGGAGGCTGGAGGG + Intergenic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1175309736 20:58003491-58003513 CACCCCAGGCTGAGGCTGGAGGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1176268594 20:64223639-64223661 GATCTTCAGGAGAGGCTGGAGGG - Intronic
1177236971 21:18404050-18404072 CATCTGAGTCAGAGGGTAGAAGG - Intronic
1180218215 21:46340125-46340147 CATCTTAGGTGGATGGTGGAAGG + Intronic
1181855343 22:25777531-25777553 CTCCCTAGGCAGTGGCTGGATGG + Intronic
1182602223 22:31474950-31474972 CATCTTGGGGTGAGGATGGAGGG + Intronic
1182602559 22:31478129-31478151 CATCTTAGGATCATGCTGGAAGG - Intronic
1183724436 22:39580642-39580664 CATGTGGGGCAGGGGCTGGATGG + Intronic
1184401468 22:44277000-44277022 CAGCTTAGGCAGAGCCTCGGAGG - Intronic
1184451806 22:44586873-44586895 CACCGTGGGCAGAAGCTGGAAGG + Intergenic
1184902389 22:47456044-47456066 CACCTTTGGCAGAGCCTGGGAGG + Intergenic
1185130922 22:49038149-49038171 CATCTTTGGGAGATGCTGAAAGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949860674 3:8501886-8501908 CTTCTCAGGCAGAGGCGCGAGGG - Exonic
950610229 3:14122072-14122094 CATCCTGGGCAAAGCCTGGAGGG + Exonic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
952292064 3:32026852-32026874 CATCTTTGGCCCAGGATGGAGGG - Intronic
952905975 3:38139251-38139273 CAGCTTAGGCAGAGGCTTTCAGG + Intronic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956473264 3:69592121-69592143 CATCTTGGGCAGAGGTGTGAAGG - Intergenic
957170238 3:76729711-76729733 CATGGGAGGCAGAGGCTGCAGGG - Intronic
961629957 3:128289349-128289371 CATCTTGGCAAGAGTCTGGAAGG - Intronic
964373662 3:156028451-156028473 AATCTAAGGAAGAGCCTGGATGG + Intergenic
964838633 3:160969291-160969313 CAGCTTAGGAAGTAGCTGGAGGG + Intronic
965987041 3:174766901-174766923 GATCTTGGGCAGAGCCTGCATGG + Intronic
966909209 3:184549238-184549260 CATCCTCGGCAAAGCCTGGATGG + Intronic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968772041 4:2513578-2513600 CATCTTAGGCATAGGTGGGTGGG + Intronic
969112212 4:4851191-4851213 CACCTCATGCAGAGGCTAGAAGG + Intergenic
969222816 4:5772593-5772615 CATCTTGTGGACAGGCTGGATGG - Intronic
969681622 4:8646345-8646367 CAGCTGAGGCCGAGGCTGGAGGG + Intergenic
969851854 4:9963715-9963737 CAGCAAAGGCAGAGGCTGGGAGG + Intronic
971004385 4:22357196-22357218 CCCCTCAGGCAGAGGCTGGCAGG - Intronic
971098632 4:23436819-23436841 TATCATTGGGAGAGGCTGGAAGG + Intergenic
984238536 4:177191410-177191432 CATGTAAGGAAGATGCTGGAAGG + Intergenic
984246362 4:177279296-177279318 CATGTTAGGAAGTGACTGGAAGG - Intergenic
986734785 5:10660838-10660860 CATCTTTAGCCCAGGCTGGAGGG - Intergenic
988336914 5:29919728-29919750 CATCTTAGGAAGACCATGGATGG - Intergenic
989049174 5:37301931-37301953 TATCTTCAGCAGAGGGTGGAAGG - Intronic
989536634 5:42571984-42572006 GATCTCAGGTAGAGGCTGGCTGG - Intronic
996513799 5:124347465-124347487 AATCTCAGGCAGAAGCTGCAAGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
997195253 5:131974911-131974933 CATGTGAGCCAGAGGCAGGAAGG + Exonic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1001068464 5:168560349-168560371 ATTCTTAGGCAGAGGTTTGAAGG - Intronic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001864319 5:175090155-175090177 CATCTTGGGCAGGAGATGGAAGG - Intergenic
1002590418 5:180287611-180287633 CAGCTTAGGCAGAGGCCTGAAGG - Intronic
1003331543 6:5133458-5133480 AATCATTGACAGAGGCTGGACGG - Intronic
1003828516 6:9978608-9978630 CACCTTTGGCAGAGGCCTGAAGG + Intronic
1004053973 6:12115830-12115852 CCTCTGAGGCAGAGGCTCGCGGG + Intronic
1007776638 6:44227682-44227704 CATCTAAGGCAGAGGCCCCAGGG - Intronic
1008251358 6:49243943-49243965 CCTCTTAGTCAGAGAATGGAGGG + Intergenic
1008589398 6:52978069-52978091 AAAATTAGGCAGAGACTGGAGGG + Exonic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1011032228 6:82936171-82936193 AATCTTTGGCAGGGGCAGGATGG - Intronic
1014078878 6:117266259-117266281 CATCTCAGAAAGAGGCTGGCTGG - Intronic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018716624 6:166538077-166538099 CATCTTAGGCACCTGCTGGGTGG + Intronic
1019532086 7:1508705-1508727 AGTCAGAGGCAGAGGCTGGAGGG - Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020381895 7:7556709-7556731 CAGCTGAGGCAGAGCCTAGACGG + Intergenic
1021629830 7:22633766-22633788 CAGCCAAGGCAGAGGCTGGGAGG + Intergenic
1021748384 7:23767850-23767872 AATCTTAGGCAGAGGATGGTTGG - Intronic
1021750474 7:23794556-23794578 CGTCATGGGCAGAGGTTGGAGGG + Intronic
1021912532 7:25400894-25400916 CATCTTAGGGATAGGCAGAAGGG - Intergenic
1022507089 7:30914072-30914094 CATCCGAGGCAGAGGCGGGAGGG + Intronic
1022516545 7:30978304-30978326 CATCCCAGGCTGAGGCTGGTGGG + Intronic
1022842847 7:34181171-34181193 GATAATAGGCAGAGGCAGGAAGG + Intergenic
1023074490 7:36469485-36469507 CATCTGAGACAGATGCTGGCAGG + Intergenic
1023725343 7:43137405-43137427 CATTTTAGAGAGAGGCAGGAAGG - Intronic
1026419039 7:70213740-70213762 GATCTTAGGAAGAGGCTACATGG + Intronic
1026534695 7:71230014-71230036 TGTGTTAGGCAGAGGCTGCAAGG + Intronic
1026955088 7:74372038-74372060 CATCTTAGGGAGAAGCCAGAGGG - Intronic
1027228193 7:76258034-76258056 CATCTGTGGCAGAGGCTGGCTGG + Intronic
1028108105 7:86904370-86904392 CCTTTTAGGCAAAGGCTAGAGGG + Intronic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1030978372 7:116155449-116155471 CATCTGAGGTAGATGCTGGCAGG - Intronic
1031712384 7:125065244-125065266 CATTTTAGCAAGAAGCTGGATGG - Intergenic
1033470970 7:141648480-141648502 AATCTTAGGCAAAGGCTTTAAGG + Intronic
1035034078 7:155884036-155884058 GATCTGAGACATAGGCTGGAGGG + Intergenic
1038887790 8:31684322-31684344 CACCTTATGAAAAGGCTGGAAGG + Intronic
1039194066 8:35010560-35010582 CATGGTAGGCAGAGGTTGCAGGG + Intergenic
1039380659 8:37081805-37081827 GATATTAGGCAGAGGCTCTATGG + Intergenic
1041897920 8:62947574-62947596 CCTCTTAAGCCCAGGCTGGATGG + Intronic
1044748699 8:95395790-95395812 CATCTTAAGCAGTAGTTGGATGG - Intergenic
1045875577 8:106977188-106977210 CTTCTTTGGAAGAGGCTGGGTGG - Intergenic
1046031823 8:108791409-108791431 CATTTTTGGAATAGGCTGGAGGG + Intergenic
1048298100 8:133230180-133230202 TATCTTATGCAGAGCCCGGAGGG + Exonic
1049021900 8:139962845-139962867 AAACTTATGCAGAGGCTGGAGGG + Intronic
1049446810 8:142635031-142635053 CCCCTTAGGCAGAGGCCAGATGG - Intergenic
1049507161 8:143008897-143008919 CAGCTGAGGCAGAGCCCGGAGGG - Intergenic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1053481427 9:38419341-38419363 GATCTGAGGCAGAGGCTGCAGGG - Intronic
1056934395 9:90904791-90904813 CATCGTGGGCACAGACTGGAGGG - Intergenic
1057567952 9:96181544-96181566 CATCTCCTGCAGAGGCTGCAGGG - Intergenic
1059456494 9:114403229-114403251 AATCCTAGGCAGGGGCTGGCGGG + Exonic
1059623063 9:116030088-116030110 CATCATATGCAAAGGCAGGAAGG - Intergenic
1060724438 9:125997735-125997757 CCTCTTGGGCAGAGTCTGGGAGG - Intergenic
1061899935 9:133667785-133667807 CAGATTAGGACGAGGCTGGAAGG + Intronic
1062093435 9:134690476-134690498 CAGCCCAGGCAGATGCTGGAAGG - Intronic
1185764835 X:2716858-2716880 CAGCCTAGGCAGAGGCCTGACGG + Intronic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1188252412 X:27913686-27913708 CAGATTAGCCATAGGCTGGAAGG - Intergenic
1189559132 X:42174767-42174789 CATCTTTGGAAGAGGCTGCTTGG + Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1195664910 X:107420359-107420381 CCCCTTAGGCAGAGGCCAGAAGG - Intergenic
1196980715 X:121210177-121210199 CAGCTTCTGGAGAGGCTGGAGGG - Intergenic
1197759198 X:130015768-130015790 CATCTTAGGCAGGTTCTGGGGGG - Exonic
1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG + Intergenic
1201884714 Y:18868948-18868970 CATTTTAGGCACAGGGTGCATGG - Intergenic
1201911289 Y:19135819-19135841 AATCTTAGCCAGAGGATGCAGGG + Intergenic