ID: 1085370912

View in Genome Browser
Species Human (GRCh38)
Location 11:76004374-76004396
Sequence AACCGCATGTAGAAGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085370912 Original CRISPR AACCGCATGTAGAAGACAGA AGG (reversed) Intronic
903680697 1:25094750-25094772 ACCCACAGGTAGAAGCCAGAGGG - Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
906826316 1:48984336-48984358 AACCCAATGTAGCAGAAAGAGGG - Intronic
912050785 1:105525827-105525849 TGCCCCATGCAGAAGACAGATGG - Intergenic
913218389 1:116639475-116639497 AACCACCTGCAGATGACAGAAGG + Intronic
915283660 1:154839386-154839408 AACAGAATTTGGAAGACAGATGG - Intronic
915341477 1:155179003-155179025 AAGCGCCTGAAGAAGGCAGAAGG - Intronic
919427830 1:197455614-197455636 AATAGCATGTAGAAGACTGTAGG + Intronic
1064165271 10:12980342-12980364 AACAGCATGGGGAAGACAGGAGG + Intronic
1065227991 10:23566479-23566501 AGCAGAATGAAGAAGACAGAGGG - Intergenic
1066435663 10:35395137-35395159 GACCGCAGGGAGAAGACTGAGGG - Intronic
1072288863 10:93943718-93943740 AACAGCATGCAGAAGACATTTGG - Intronic
1072925485 10:99613168-99613190 AACTGCATGAAGAAACCAGAAGG - Intronic
1073522420 10:104145894-104145916 AATAGCATAAAGAAGACAGATGG - Intronic
1075410170 10:122221883-122221905 AGCCCCATGCAGAAGCCAGAAGG - Intronic
1080049674 11:27846845-27846867 ATCCACTTGTAGAACACAGATGG - Intergenic
1084460049 11:69292082-69292104 ATCTGAATGTTGAAGACAGAGGG + Intergenic
1085370912 11:76004374-76004396 AACCGCATGTAGAAGACAGAAGG - Intronic
1085586722 11:77715296-77715318 AACATGATGTAAAAGACAGATGG + Intronic
1086332330 11:85766395-85766417 AATCATATGTAGAAGAGAGACGG + Intronic
1089262082 11:117230345-117230367 AACCTCATGTAGAATCCAGGTGG - Exonic
1090029077 11:123192621-123192643 AGCCCCATGGAGAAGAGAGAAGG - Intronic
1091051058 11:132372690-132372712 AATAGCATCTAAAAGACAGAAGG - Intergenic
1092601454 12:10070797-10070819 AACGGCATGGACAAGGCAGATGG + Exonic
1093488302 12:19676862-19676884 AGCCACATGTAGAAGAATGATGG - Intronic
1094625985 12:32124736-32124758 AACAGCCTGTAGAAGAGGGAAGG + Intronic
1098142237 12:67462079-67462101 AACAGCAGGTAGAAAGCAGATGG - Intergenic
1107649901 13:42534770-42534792 AACCACATGTAGAATAGTGAGGG - Intergenic
1109112925 13:58346197-58346219 AACCTCTTTTAAAAGACAGATGG - Intergenic
1109283299 13:60382069-60382091 AACAGCATGTGGGAGGCAGAAGG - Intergenic
1114331306 14:21639651-21639673 AAACGCATGGAGAAAAGAGACGG + Intergenic
1114772748 14:25447074-25447096 AAACTCATGTAGGAGAAAGAGGG - Intergenic
1114776330 14:25486459-25486481 AACTGTATGTTGAAAACAGAAGG - Intergenic
1117092861 14:52267986-52268008 ACCAGCATGTAGAAGACCGAGGG - Exonic
1120363034 14:83530283-83530305 AACTTAATGTAGAAGATAGAGGG - Intergenic
1125249306 15:37681353-37681375 ATGCGTATTTAGAAGACAGATGG - Intergenic
1126656071 15:50979423-50979445 TACATCATGAAGAAGACAGAAGG - Intronic
1128220945 15:65968154-65968176 AATGGAAAGTAGAAGACAGAAGG + Intronic
1130909752 15:88262907-88262929 AACGGCATTGAGAACACAGAGGG + Intergenic
1131782138 15:95871175-95871197 AATGGCAGGTAGAAGTCAGATGG + Intergenic
1139272920 16:65700192-65700214 AACTGCATGTGGTGGACAGAAGG - Intergenic
1140898435 16:79346674-79346696 CACCCCGTGTAGAAGACATATGG - Intergenic
1143473119 17:7188516-7188538 AAACACATGAAGAAGGCAGAAGG + Intergenic
1143557259 17:7669625-7669647 AAACTCATGTTCAAGACAGAAGG - Exonic
1152302430 17:79503088-79503110 ATCCTCATGTGGAAGAGAGAGGG + Intronic
1157710529 18:49847010-49847032 AAGGGCAAGTAGGAGACAGAGGG + Intronic
1158341150 18:56468036-56468058 AACAGCATGTGGAAGGAAGAAGG + Intergenic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG + Intronic
927808448 2:26168806-26168828 CACCCCATCTAGAGGACAGATGG - Intergenic
929072121 2:38041987-38042009 AATCTCTTGTAGAATACAGAAGG - Intronic
931230663 2:60372003-60372025 AGCCACTTGTAGAAGAAAGATGG + Intergenic
931717401 2:65039961-65039983 AAACCCAAGTGGAAGACAGAAGG + Intergenic
933856237 2:86417390-86417412 AGCTGCATGCTGAAGACAGAAGG - Intergenic
935870304 2:107441027-107441049 AACCACAGTTACAAGACAGAAGG + Intergenic
941088743 2:161148717-161148739 AACCACATGCAAAAGAAAGAAGG - Intronic
942130873 2:172877810-172877832 AAAGGTATGGAGAAGACAGAAGG - Intronic
946236302 2:218326569-218326591 AACCGCATCTAAAATACACAGGG + Intronic
946714315 2:222537127-222537149 AACAGCATGAAGAATACAGGAGG - Intronic
1169973161 20:11293199-11293221 ACCTGCAATTAGAAGACAGAAGG + Intergenic
1173229368 20:41182176-41182198 AACCCCATGTAAAAAACAAATGG + Exonic
1177409146 21:20707416-20707438 AAGATCATGTAGATGACAGATGG + Intergenic
1178436330 21:32561999-32562021 CACAGCATGTATAAGCCAGAAGG + Intergenic
1180819690 22:18817555-18817577 AACCACCTGCAGATGACAGAAGG + Intergenic
1181205915 22:21252000-21252022 AACCACCTGCAGATGACAGAAGG + Intergenic
1181820145 22:25469073-25469095 AATCCCATGCAGAAGTCAGAGGG + Intergenic
1182196116 22:28520163-28520185 AGCAGCAAATAGAAGACAGAAGG + Intronic
1183473982 22:38025889-38025911 CATCCCATGTAGAAGACAGGAGG - Intronic
1203221006 22_KI270731v1_random:43413-43435 AACCACCTGCAGATGACAGAAGG - Intergenic
1203269819 22_KI270734v1_random:43408-43430 AACCACCTGCAGATGACAGAAGG + Intergenic
949606581 3:5660172-5660194 AAGTGCATGTAGAAGACACATGG - Intergenic
950105677 3:10386794-10386816 AGCCTCATGTAGAAGGAAGATGG - Intronic
952110803 3:30122204-30122226 TATTGAATGTAGAAGACAGAGGG - Intergenic
956694625 3:71907937-71907959 ATCCCCAAGTACAAGACAGAGGG + Intergenic
957670771 3:83299578-83299600 AACCTAATGTATAAGACAAAGGG + Intergenic
960667208 3:120121712-120121734 AACCCCAAGTATAAGACATATGG + Intergenic
962995036 3:140618343-140618365 AGCCACATGTAGAAGAATGAAGG + Intergenic
964875410 3:161361713-161361735 AAATGCATGTAGAAAATAGAAGG - Intronic
965023979 3:163274263-163274285 CTCCCCATGAAGAAGACAGAAGG - Intergenic
965687626 3:171321632-171321654 CACCTCGTGTAGGAGACAGATGG + Intronic
966977456 3:185097735-185097757 TAACGCATGTGGAACACAGAAGG + Intronic
970213379 4:13733550-13733572 AACCGCATGTGCAAGGCAGATGG + Intergenic
970431638 4:15994315-15994337 TAGAGCATGTAGGAGACAGATGG - Intronic
970908082 4:21240404-21240426 AGCTGCCTGTAGAAGACAGGAGG + Intronic
971468095 4:26987308-26987330 GACCGAAAGTAGCAGACAGATGG + Intronic
977276012 4:94978098-94978120 GACAGCATATGGAAGACAGAAGG - Intronic
979236867 4:118410212-118410234 GGCCTTATGTAGAAGACAGATGG - Intergenic
979726406 4:123967545-123967567 AACTTCATTTAGAAGACAAAAGG - Intergenic
980537866 4:134152585-134152607 AATACCATGTGGAAGACAGAGGG + Intergenic
980712199 4:136584393-136584415 AAACACATGGAGAAGACATATGG + Intergenic
981072546 4:140559019-140559041 AACTGCATGCAGAAGAGATAGGG - Intergenic
981971285 4:150665246-150665268 TACAGCATGTACTAGACAGAGGG - Intronic
982439226 4:155415637-155415659 ATCAGCATGTAGAAGAAAAAAGG + Intergenic
983941642 4:173539033-173539055 AAACGGAGGTAGAAGAGAGAGGG - Intergenic
985584742 5:724717-724739 AACTGCATATAGGAGACAGGTGG - Intronic
985598245 5:809031-809053 AACTGCATATAGGAGACAGGTGG - Intronic
986089672 5:4492292-4492314 ACACCCATGTGGAAGACAGAGGG + Intergenic
986741203 5:10707022-10707044 ACCCACATGGAGAAGTCAGAGGG + Intronic
987569134 5:19632842-19632864 AAGCACCTGTAGAACACAGAGGG - Intronic
988070468 5:26281957-26281979 AACAGGAAGTATAAGACAGAAGG + Intergenic
991449559 5:66737592-66737614 ATCCAGAAGTAGAAGACAGAAGG - Intronic
992727961 5:79628574-79628596 AACTGAGTGTAGAAGAGAGAGGG + Intronic
993041614 5:82821298-82821320 AACCACTTGTAAAACACAGAAGG + Intergenic
995026721 5:107432103-107432125 AACCTCATGGAGGAGACAGTAGG - Intronic
998545697 5:143025574-143025596 ATCCCCATGTAGGAGACAAATGG + Intronic
998894805 5:146788086-146788108 AACGGCATGGAGGAGGCAGAGGG - Intronic
1004376554 6:15095656-15095678 AACAGGAAGTGGAAGACAGATGG - Intergenic
1005040626 6:21596498-21596520 AAACGCGTGATGAAGACAGAAGG + Exonic
1006005582 6:30999385-30999407 AACCGGATGAGGAAGACAAATGG - Intergenic
1011868627 6:91863177-91863199 AAACACATGTAGGACACAGATGG + Intergenic
1015188584 6:130447303-130447325 AACCACATGTACAAGAAGGAAGG + Intergenic
1017349024 6:153418165-153418187 CACAGCATGTATAAGCCAGAAGG + Intergenic
1021350204 7:19583714-19583736 AACAGTATCTAGAATACAGAAGG + Intergenic
1027648550 7:80836251-80836273 AGCTTCATGTAGAAGACAGAAGG + Intronic
1030242481 7:107343646-107343668 ACTCCCACGTAGAAGACAGAGGG + Intronic
1037064598 8:14561972-14561994 CACAGCATGTAGACAACAGAAGG + Intronic
1037370590 8:18173337-18173359 GACCTATTGTAGAAGACAGATGG - Intronic
1040999935 8:53440186-53440208 AACCACTTGAGGAAGACAGAAGG + Intergenic
1041001911 8:53462257-53462279 AGCCGCTTGAGGAAGACAGAAGG - Intergenic
1041453313 8:58031116-58031138 AACTGCATTTGGAGGACAGAAGG + Intronic
1045446914 8:102276028-102276050 ATCCGTATGTAGAATACAGAAGG - Intronic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046654536 8:116878696-116878718 AACAGCATGTAAGAGAAAGATGG - Intergenic
1055014972 9:71606401-71606423 AAGAGAATGCAGAAGACAGAAGG + Intergenic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1056392782 9:86154602-86154624 AACCACTTGAGGAAGACAGAAGG + Intergenic
1057973726 9:99581636-99581658 ACTTGCTTGTAGAAGACAGAAGG + Intergenic
1058622570 9:106898864-106898886 AGCCAGATGTAGAAGACTGAAGG + Intronic
1059476848 9:114554197-114554219 AACCCCCTCTAGAAGACAAATGG - Intergenic
1061160335 9:128890261-128890283 AAACGCATCTGGAAGACAGCAGG - Intronic
1187372980 X:18725802-18725824 AAGAGGAAGTAGAAGACAGAGGG + Intronic
1187561313 X:20406268-20406290 AAACGCAAGTAGAAGCCAGAGGG - Intergenic
1188692943 X:33152919-33152941 AATCCCATTGAGAAGACAGAAGG + Intronic
1192774728 X:74231458-74231480 AACCGCATCTACAATACATAGGG + Intergenic
1193788170 X:85785784-85785806 TACCACATGTAAAAGACACAGGG + Intergenic
1195399640 X:104447682-104447704 AACAGCATGAAGACTACAGATGG - Intergenic
1195515012 X:105764025-105764047 AACCTCCTGTAGAAGAAAAAAGG - Intronic
1196205503 X:112934998-112935020 CAATGCATGTAGAAGACAGGAGG - Intergenic
1196313809 X:114199080-114199102 AACCACTTGGAGAAGAGAGAAGG + Intergenic
1201448806 Y:14087184-14087206 AACCGTGTGTAGATCACAGAAGG - Intergenic