ID: 1085371943

View in Genome Browser
Species Human (GRCh38)
Location 11:76016180-76016202
Sequence CCACCCTATTTATGTAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085371943_1085371945 -7 Left 1085371943 11:76016180-76016202 CCTATATTACATAAATAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1085371945 11:76016196-76016218 AGGGTGGTATATGAACAGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085371943 Original CRISPR CCACCCTATTTATGTAATAT AGG (reversed) Intronic
910757106 1:90705898-90705920 GCACCCTAATTTTGTATTATAGG + Intergenic
912300482 1:108510837-108510859 CCACCCTTTGTCTGTAAGATGGG + Intergenic
912900747 1:113645460-113645482 CCACCATATTTATTTCATAATGG + Intronic
919225130 1:194688076-194688098 CCACCATATTAATGGAATACTGG + Intergenic
924303688 1:242665492-242665514 CATCCCTGTTTATTTAATATAGG - Intergenic
924418757 1:243887429-243887451 CCACACTATTAATCTAATTTTGG + Intergenic
1070106658 10:73438955-73438977 CCACCTTTTTAATGTTATATTGG - Intronic
1071042373 10:81328362-81328384 GCTCCCAATTCATGTAATATTGG + Intergenic
1072351175 10:94558953-94558975 TCAGCCTATTTATGTAAAATGGG - Intronic
1072387213 10:94943150-94943172 CAACCATATTTATGAAATTTTGG + Intronic
1080002417 11:27364391-27364413 CGACCCTAGTTATTCAATATTGG + Intergenic
1080988635 11:37503444-37503466 CCACCCTATCTTTGAAATTTAGG + Intergenic
1082172116 11:49017625-49017647 CCACCGTATTTGTGTAATTATGG - Intergenic
1083475325 11:62911466-62911488 CAACCCGAGTTATGTAAGATAGG - Intronic
1083511592 11:63213743-63213765 CCACCATATTTATGCAACAGTGG - Intronic
1085371943 11:76016180-76016202 CCACCCTATTTATGTAATATAGG - Intronic
1086693644 11:89818334-89818356 CCACCTTATTTGTGTAATTATGG + Intergenic
1086712502 11:90026235-90026257 CCACCTTATTTGTGTAATTATGG - Intergenic
1090340345 11:126013128-126013150 TCACCCTATTTATTGAATAAAGG - Intronic
1093520309 12:20042387-20042409 CTACCCTTTCCATGTAATATTGG - Intergenic
1094809306 12:34122398-34122420 CCACCGTATTTATGCAACAGTGG + Intergenic
1099077412 12:78128201-78128223 CCTCCTTATTTTTGTAATCTAGG + Intronic
1100818564 12:98409269-98409291 CCAGCTTATTTTTGTATTATTGG - Intergenic
1101795865 12:107973082-107973104 CCACTCTAATAAAGTAATATGGG + Intergenic
1111387116 13:87541295-87541317 GAACCCTATTTATGTAAGAGGGG - Intergenic
1113030942 13:105993029-105993051 CCACCTAATTTTTGTAATTTTGG + Intergenic
1117904575 14:60571126-60571148 CCACAATAGATATGTAATATAGG + Intergenic
1118691212 14:68342129-68342151 ACATCCTATTTCTGTAAGATAGG - Intronic
1119975976 14:79024176-79024198 CCACCCTCTGTATGTAAGAATGG - Intronic
1120629230 14:86869090-86869112 CATCTATATTTATGTAATATTGG - Intergenic
1124706638 15:31972090-31972112 CAACACTGTTTATGTACTATGGG - Intergenic
1130533196 15:84763453-84763475 CCTCCCAATTTATTTACTATTGG + Intronic
1131139202 15:89963485-89963507 CCACCCTATTTCAGTCACATGGG + Intergenic
1131405233 15:92158989-92159011 CCACCTTATTCATGTTAGATAGG - Intronic
1135825453 16:25723414-25723436 CAACCATATTTATCTAACATTGG + Intronic
1135838638 16:25852624-25852646 CAATCCTATTTCTGTCATATAGG + Intronic
1135970604 16:27069354-27069376 CCATCCTATGTATGAAATAGGGG - Intergenic
1140397861 16:74644463-74644485 CCACTCTAATTATGTCCTATTGG - Intronic
1146182073 17:30704930-30704952 CCACACTATTTATTTATTTTTGG - Intergenic
1151865211 17:76797356-76797378 CCTCCCTTTTTAAGCAATATAGG + Intergenic
1154084025 18:11284640-11284662 ACACCCTATAAATGTAATACAGG + Intergenic
1155451703 18:25970185-25970207 CCACCCTGTTTCTATAATAGTGG + Intergenic
1156364801 18:36415809-36415831 CCACCCTTATTATGTAGTCTTGG - Intronic
1165052346 19:33149954-33149976 CCAGCCTATTTTTAAAATATAGG + Intronic
1165532206 19:36413247-36413269 CCAGCTTATTTTTGTATTATTGG - Intronic
929178728 2:39009598-39009620 CCACCTTCTTTGTGTATTATTGG - Intronic
933553507 2:83804728-83804750 CCACCCTTTATATGTAATTTAGG - Intergenic
936852877 2:116922439-116922461 CCTCCCTTTCTGTGTAATATGGG - Intergenic
937407878 2:121647628-121647650 CCACTTTATTTATGTAAAAGAGG - Intronic
1172236003 20:33375103-33375125 CCAGCCTCTTTATGTATTCTTGG - Intronic
950745697 3:15086628-15086650 CCACCCTGTTTATTTAACATTGG - Intronic
951331322 3:21372340-21372362 CCACCACATCTATGTAATACAGG - Intergenic
951990286 3:28668941-28668963 CCCTCCTATTTATGTGATCTTGG + Intergenic
952742423 3:36747663-36747685 TCCCCCTATTTATGTAAAAGCGG - Intergenic
952999517 3:38919721-38919743 CCTCCCTAGTTATGTTAAATTGG - Intronic
958890363 3:99776045-99776067 CCACCCTACTTATATCACATTGG + Intronic
960858960 3:122132155-122132177 CCATTCTATTTATTTAATTTTGG - Intergenic
971150844 4:24029879-24029901 CCCCCCAAATTATTTAATATAGG - Intergenic
972432115 4:38993089-38993111 CCACCATATTTGTGTACTAAAGG - Intronic
973707693 4:53596552-53596574 CCACCCTGTTTATGCAAGAATGG - Intronic
975940608 4:79640319-79640341 TCACCCTCTTTTTGTAATAATGG + Intergenic
977566772 4:98588275-98588297 CCACCCCATTCATGTGACATCGG - Intronic
980786791 4:137566345-137566367 CCACTCTACTTAGGAAATATGGG + Intergenic
984070093 4:175100345-175100367 CCACCCAGTTTGTCTAATATAGG + Intergenic
991196641 5:63941938-63941960 TCACCCAATATAAGTAATATAGG - Intergenic
991240248 5:64450690-64450712 ACTCCCAATTTATTTAATATAGG + Intergenic
992250284 5:74869403-74869425 CCAACATATTTATGTCTTATTGG - Intergenic
993718609 5:91299625-91299647 CCAGCCTATTTATTTATTTTTGG + Intergenic
1000573340 5:162942773-162942795 CCACCCTATTTCTAAAATACTGG + Intergenic
1000798815 5:165698358-165698380 CCTACCTAATTATGTAATAAAGG + Intergenic
1004308978 6:14527059-14527081 TCAACCTATTTATATTATATGGG - Intergenic
1006061748 6:31425899-31425921 CCACCTTACTTCTGTAATAGTGG - Intergenic
1010037863 6:71346753-71346775 CCACCTTCTATATATAATATAGG + Intergenic
1010638363 6:78288253-78288275 CCACCTTTTTCATGTATTATTGG + Intergenic
1010962948 6:82167665-82167687 CCTCCCTACTTTTGTAATTTTGG - Intergenic
1014646104 6:123975104-123975126 CAACCCATTTTATGTAATAGGGG + Intronic
1015148804 6:130017328-130017350 CCACCCGATATATCTAATGTTGG - Intronic
1020776061 7:12455312-12455334 CCTCTCTATTTCTGTAAAATAGG + Intergenic
1022411314 7:30140615-30140637 CCACACTAATCATGTAATACAGG - Intronic
1031691679 7:124796087-124796109 CCACCATATTTAGGGAATTTTGG + Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1038203687 8:25442512-25442534 CCACCATCTTTATATAATTTTGG - Intronic
1041659411 8:60386816-60386838 GCCCACTATTTATGTAATGTTGG - Intergenic
1042115223 8:65424339-65424361 GCTTACTATTTATGTAATATTGG - Intergenic
1042125789 8:65536024-65536046 CCTCCCTTTTTAGGTCATATAGG - Intergenic
1043632591 8:82355013-82355035 CCACACTATTGAAATAATATTGG + Intergenic
1046223043 8:111240236-111240258 CCATCCTATTTTTGTATTATAGG + Intergenic
1047678823 8:127232638-127232660 CCACCCTATCCATGTATTTTGGG + Intergenic
1048172118 8:132117276-132117298 CCACTGAATTTATGTAATATAGG - Intergenic
1051553253 9:18354391-18354413 TCACTCTACTTATGGAATATGGG - Intergenic
1054481416 9:65668343-65668365 TCACAGTGTTTATGTAATATCGG + Intergenic
1055009361 9:71547078-71547100 ACACCCTATCTATGCAATTTTGG - Intergenic
1055390189 9:75812807-75812829 CAACCTTTTTAATGTAATATTGG + Intergenic
1188315209 X:28665279-28665301 CAACCCTATTTATCAAGTATGGG - Intronic
1190690921 X:52912400-52912422 CCACCCTGTTAATATAATAGAGG + Intergenic
1190695062 X:52943392-52943414 CCACCCTGTTAATATAATAGAGG - Intronic
1193926383 X:87490870-87490892 CCACCCCATTTATGCCAAATAGG + Intergenic
1196064860 X:111452995-111453017 TCACCATAATTATGTAATCTGGG + Intergenic
1196867704 X:120084881-120084903 CCACCATATTTATGCAACAGTGG + Intergenic
1196875398 X:120151400-120151422 CCACCATATTTATGCAACAGTGG - Intergenic
1196930038 X:120672940-120672962 CCTTCCTATTTTTGAAATATTGG - Intergenic
1201278078 Y:12316782-12316804 CCACCATATTTATGCAACAGTGG - Intergenic
1201755305 Y:17480689-17480711 CCACCGTATTTATGCAACAGTGG + Intergenic
1201846247 Y:18425296-18425318 CCACCGTATTTATGCAACAGTGG - Intergenic
1201955788 Y:19621099-19621121 CCACCCTCTCTATGTAATTTTGG - Intergenic