ID: 1085373795

View in Genome Browser
Species Human (GRCh38)
Location 11:76039241-76039263
Sequence CTTGGTAAAGCATCAAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085373795 Original CRISPR CTTGGTAAAGCATCAAATGT TGG Intronic
908495399 1:64689390-64689412 ATTGGTAAGTCATCAGATGTGGG - Intronic
909656129 1:78034525-78034547 CTTGGTAAAACATGGATTGTGGG + Intronic
910094509 1:83505652-83505674 CTTGTTAATGAATCGAATGTGGG - Intergenic
911495160 1:98622466-98622488 CTGGGTAAATCATGAAATGAAGG - Intergenic
916148203 1:161760247-161760269 CTTTTTAAATCATTAAATGTTGG - Intergenic
916872632 1:168933437-168933459 CTTTGAAAAGCATCCAATTTAGG + Intergenic
917601068 1:176574459-176574481 CTAGGTAAAAAATCAAATGGTGG - Intronic
920619043 1:207525889-207525911 CTTTCTCAAGCATCAAATGGGGG - Intronic
920620823 1:207544444-207544466 CTTTCTCAAGCATCAAATGGGGG - Intronic
920622605 1:207563001-207563023 CTTTCTCAAGCATCAAATGGGGG - Intronic
920635330 1:207696642-207696664 CTTTCTCAAGCATCAAATGGGGG - Intronic
920944633 1:210516598-210516620 CTTTGTAAAAGAGCAAATGTGGG + Intronic
921445577 1:215242923-215242945 CTAGGTAAAGAAACAAATGTAGG + Intergenic
922916761 1:229264178-229264200 CTTGCTGATGGATCAAATGTGGG + Intergenic
923510719 1:234649940-234649962 GCTGGTAAAGCCTCAAATCTGGG - Intergenic
924004522 1:239593251-239593273 CTAGGTAAAGAATAAAATTTTGG - Intronic
924084068 1:240430398-240430420 CTTGATAAAGTCTCACATGTTGG - Intronic
924828745 1:247570447-247570469 CTGGGTAAATAATAAAATGTAGG - Intronic
1066291782 10:34021034-34021056 CTAAGTAAAGCATCTAATATGGG + Intergenic
1068261725 10:54592022-54592044 CTTGGGATAGCCTCAAGTGTAGG - Intronic
1068842672 10:61632613-61632635 CTGGGTAAAGCCCCAAATGAAGG - Intergenic
1070078980 10:73167462-73167484 CTTGGTAAAGAAAGAAATGGCGG + Intronic
1073092931 10:100958867-100958889 CTTGCTAAACCTCCAAATGTAGG + Intronic
1073927651 10:108535487-108535509 CTGGGTAAATAATCAAATGAAGG + Intergenic
1077581366 11:3419303-3419325 GGTGGTGAAGCATGAAATGTAGG - Intergenic
1082141901 11:48618676-48618698 TTCTGTAAAACATCAAATGTGGG - Intergenic
1084238278 11:67802140-67802162 GGTGGTGAAGCATGAAATGTAGG - Intergenic
1084834133 11:71790692-71790714 GGTGGTGAAGCATGAAATGTAGG + Intronic
1085373795 11:76039241-76039263 CTTGGTAAAGCATCAAATGTTGG + Intronic
1085673534 11:78492274-78492296 AGTGGTTAAGCATCAAATCTTGG + Intronic
1086159702 11:83707931-83707953 CTAGTTAAAGTATCAAAGGTGGG - Intronic
1086496138 11:87406252-87406274 TTTGGTAGAGGATTAAATGTGGG + Intergenic
1086827537 11:91518040-91518062 ACTGTTAAAGCATCAAATTTAGG + Intergenic
1088749129 11:112829008-112829030 GTTTGTAAAGCATGAAATATGGG - Intergenic
1090542177 11:127719664-127719686 CTTTGCAAAGCATCAAATTTTGG - Intergenic
1091545992 12:1501654-1501676 CCTGGCAAAGGATCCAATGTTGG - Intergenic
1091805427 12:3352609-3352631 CTTGGTAAAGCATTGCATGTTGG - Intergenic
1094783184 12:33816844-33816866 CTGGGTAAATCATCAAATTAAGG + Intergenic
1100047288 12:90398382-90398404 CTTGGTACAGCAGGAAGTGTTGG + Intergenic
1102291954 12:111708140-111708162 CTTGGCAAAGCAGGAACTGTGGG - Intronic
1102334470 12:112066244-112066266 CTAGTTGAAGCATCAAATGGTGG - Intronic
1106855791 13:33851230-33851252 CTTTGTAAAGCAGGAAATGGGGG - Intronic
1108783419 13:53865746-53865768 CTCTGTAAAGAATCTAATGTAGG - Intergenic
1112048975 13:95626292-95626314 CTTTGTAAAGAACCAAATTTTGG - Intronic
1112358414 13:98694144-98694166 CTTTTTAAAGCATCAAATTATGG + Intronic
1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG + Intronic
1117791477 14:59346374-59346396 CTTGAAAAAGCATCATATTTAGG - Intronic
1126897691 15:53276911-53276933 CTAGGTAAAGAATGAAATGAAGG + Intergenic
1128520915 15:68374411-68374433 CTTGGGCCAGCCTCAAATGTGGG + Intronic
1128929782 15:71693753-71693775 CTTAGAAAATCATCAAATCTCGG - Intronic
1129135847 15:73550313-73550335 CTTGGCAAATTAGCAAATGTGGG - Intronic
1133349931 16:5094589-5094611 GGTGGTGAAGCATGAAATGTAGG - Intronic
1133823216 16:9255211-9255233 CTCTGAAAAGCATCAAATGCTGG - Intergenic
1134234916 16:12458031-12458053 CTTTGAAAAGCATCCAATTTAGG - Intronic
1135897583 16:26422138-26422160 CTTGGTAAATAATGAAATGAAGG + Intergenic
1136285921 16:29241723-29241745 CATGGAAAAGCATGAAATGGAGG - Intergenic
1137372297 16:47918851-47918873 TTTGGTATAGCATCACATGATGG - Intergenic
1137857842 16:51814009-51814031 GTTGGTAAAGCTTCAGATGTGGG + Intergenic
1138642929 16:58400128-58400150 CTTAGTGAATCATCAAATCTGGG - Intronic
1138714691 16:59007546-59007568 CTTGGTAAATCATCATAGGGTGG + Intergenic
1140292884 16:73679748-73679770 CTTGGTAAAGTACCACATGATGG - Intergenic
1142091259 16:88211909-88211931 CATGGAAAAGCATGAAATGGAGG - Intergenic
1143276798 17:5717590-5717612 TTTGGTAAAGTACAAAATGTTGG + Intergenic
1146113476 17:30112905-30112927 CTTGTTAAAGTTTCAAAAGTTGG + Intergenic
1149026240 17:52030594-52030616 CTTGGTAAAGCATTATTTTTAGG + Intronic
1149247698 17:54730538-54730560 TTTGGTAAAGCATGAAATTAAGG + Intergenic
1150332689 17:64307159-64307181 TTTGGTAAAGCATATGATGTTGG + Intergenic
1151538387 17:74751356-74751378 CTACATAAAGCATCAAATGGAGG + Intronic
1152194940 17:78912261-78912283 CTTGGTTAAGCAGCAGCTGTTGG + Intronic
1153794747 18:8611241-8611263 GTTGTTAAACCATCAAATGAGGG + Intronic
1161775412 19:6259469-6259491 CTTGGTCAAGCCTCAGAAGTTGG - Intronic
925007549 2:455911-455933 CTAGGTAGAGCCTGAAATGTTGG + Intergenic
925420706 2:3708646-3708668 CTTGGTAAAAATTTAAATGTCGG + Intronic
926652986 2:15366789-15366811 CTGGGTAAGGCATCAGATGAAGG + Intronic
928696406 2:33854062-33854084 TTTGCTAAAGCATAACATGTGGG + Intergenic
928872670 2:35999070-35999092 GTTGGTAAAGCATGAAAAGAGGG - Intergenic
931540061 2:63321563-63321585 CTTCGTAAAGCAGAAATTGTAGG - Intronic
931912137 2:66911622-66911644 CTGGGTAAATAATCAAATGAAGG - Intergenic
932961888 2:76422049-76422071 CTTGGTAAAGCATCATCTTTTGG + Intergenic
934736326 2:96691609-96691631 CTTGGTAAAGCCTCACAGGCTGG + Intergenic
934739954 2:96713034-96713056 CTTGAAACAGCAACAAATGTTGG + Intronic
936318030 2:111442471-111442493 TTTGGTAACGCCTCAAATGAAGG - Intergenic
937666576 2:124494537-124494559 CCTGGTAAAGCATTATTTGTGGG - Intronic
938657154 2:133446250-133446272 CTTGCTGAAGCTTGAAATGTAGG - Intronic
941560929 2:167043084-167043106 CTAGGTAAAGTATGAAATGAAGG + Intronic
943879009 2:193114104-193114126 CTTGGTAAAGCATTTTATGGTGG - Intergenic
944317119 2:198295250-198295272 ATTGGTAAAGCATTGACTGTGGG - Intronic
948232624 2:236362682-236362704 GTTGTTCAAGCATCAACTGTAGG + Intronic
1171102419 20:22397763-22397785 CTTGTTAAAACATCAAGTGCAGG + Intergenic
1172373775 20:34418544-34418566 TTTGGTAAAGCAAAAAATTTAGG - Intronic
1177503791 21:21995442-21995464 ATTGGTCAATCTTCAAATGTAGG + Intergenic
1184828079 22:46966698-46966720 CTTGGGAAAATATCAACTGTGGG - Intronic
950803302 3:15573634-15573656 CTTGATAAACCATAAACTGTAGG + Intronic
951362721 3:21743580-21743602 CTTGCTACAGCCTCAAATGGTGG + Intronic
953766014 3:45743320-45743342 CTTGATAAAGCATCAACTGTTGG - Intronic
954828204 3:53394037-53394059 CTGGGTAAAGAATGAAATGAAGG + Intergenic
955127861 3:56132206-56132228 CTTGGTAAAGCTACAACTCTTGG - Intronic
957054232 3:75431938-75431960 GGTGGTGAAGCATGAAATGTTGG - Intergenic
957304075 3:78433502-78433524 ATTTTAAAAGCATCAAATGTAGG - Intergenic
958068600 3:88579136-88579158 CTTGATAGACCATCAAATTTGGG - Intergenic
959309176 3:104710234-104710256 ATTGTTAAAGAATAAAATGTAGG - Intergenic
960303983 3:116038985-116039007 CTTGGAACTGCATCAAATATAGG - Intronic
961300607 3:125919774-125919796 GGTGGTGAAGCATGAAATGTAGG + Intergenic
961887893 3:130108313-130108335 GGTGGTGAAGCATGAAATGTAGG - Intronic
962451368 3:135520056-135520078 CACGATAAGGCATCAAATGTGGG - Intergenic
967793974 3:193578544-193578566 GTTGGTAAAGCATCACTTCTGGG + Intronic
968997033 4:3952244-3952266 GGTGGTGAAGCATGAAATGTGGG - Intergenic
969816938 4:9694009-9694031 GGTGGTGAAGCATGAAATGTAGG + Intergenic
970059508 4:12015858-12015880 CTTGGGGAAGCATGAGATGTTGG - Intergenic
970701626 4:18747846-18747868 CTTGGGAAAGTATTAGATGTGGG - Intergenic
971712349 4:30130656-30130678 CTTAGTAAAGCATAAAATGAGGG + Intergenic
973124328 4:46565547-46565569 CTTGGTAAAGCTGAAAATGTAGG + Intergenic
974650679 4:64749546-64749568 CTTGCCAAAGCACCAAATTTTGG + Intergenic
975017143 4:69436317-69436339 CTTTGTAAATCATCAGATATGGG + Intergenic
977601020 4:98933700-98933722 ATTGTAAAAGCATAAAATGTTGG - Intergenic
979049722 4:115914695-115914717 TTAGTTAAAGCATCAAATGTGGG + Intergenic
979310777 4:119200558-119200580 CTGGGTAAAGAATGAAATGAAGG + Intronic
980035906 4:127881852-127881874 CTTGGTAAAGGATCATTTGCTGG + Exonic
980095347 4:128484376-128484398 GTTGGTAAATCATCCAGTGTTGG - Intergenic
981206826 4:142051882-142051904 CTTGGTAAAGGATAAAATCTAGG + Intronic
983153404 4:164313819-164313841 CTTGGTAATGGATTGAATGTGGG - Intronic
984413010 4:179419605-179419627 CTTAGTAAATCATTATATGTGGG + Intergenic
985035668 4:185838071-185838093 CTTAGAAAAGCATCATCTGTTGG - Intronic
985917797 5:2937861-2937883 TTTGGGAAATCATCAAATGTGGG + Intergenic
986248557 5:6033411-6033433 CTTGGTATAGCATCACATGACGG + Intergenic
986857622 5:11889096-11889118 CTTGGTAAATAATCAGATGAAGG + Intronic
987057090 5:14203980-14204002 TTAAGTAAAGCAACAAATGTAGG + Intronic
987113236 5:14706425-14706447 CTGGGAAGAGCATCAAAGGTGGG - Exonic
987837754 5:23183177-23183199 CTTGGAGAACCATCAAATGATGG - Intergenic
989243507 5:39227156-39227178 TTTGGAAAAGCATAAAATGATGG + Intronic
990169000 5:53027273-53027295 CTTGCTAAAGAAAAAAATGTAGG - Intronic
990251198 5:53916845-53916867 AATGATAAAACATCAAATGTTGG - Intronic
990562905 5:57001270-57001292 CATGTCAAAGCATCATATGTTGG + Intergenic
991226488 5:64279105-64279127 CTTGGCAAACCATTAAATGTTGG - Intronic
991369378 5:65902546-65902568 CTTGGTAAAGCATCATTTTTGGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994257728 5:97619494-97619516 CTTTGTCAAACATCAAATGATGG + Intergenic
994308516 5:98237927-98237949 CTTGGTAAATAATGAAATGAAGG - Intergenic
995275094 5:110268684-110268706 CTTTTTAAAGCATCAATTGGAGG - Intergenic
995733637 5:115273706-115273728 CTTGGTAAAGCACAGATTGTTGG + Intronic
996512220 5:124329413-124329435 TTTGATAAAGCAGCAAATATAGG + Intergenic
997731426 5:136181821-136181843 TTTGGTAAACCATCCAATTTTGG - Exonic
1001433768 5:171683593-171683615 CTTGGCAAAGAATCAAATGTGGG + Intergenic
1003401573 6:5795189-5795211 CTTGGTTAGGCATCAAGAGTGGG + Intergenic
1008217015 6:48804827-48804849 CTTGCTAAAACAGCAAATGTAGG + Intergenic
1009962168 6:70536739-70536761 CTTGATAATGTATTAAATGTAGG - Intronic
1010362081 6:75006586-75006608 CTGGGTAAATCATGAAATGAAGG + Intergenic
1010992869 6:82499681-82499703 CTGGGTAAAGAATGAAATGAAGG - Intergenic
1011620832 6:89240953-89240975 CCAGGTATAGCATCATATGTAGG - Intergenic
1014468828 6:121789293-121789315 CTTGCTTAATCACCAAATGTGGG + Intergenic
1015864686 6:137716217-137716239 CTTGGAAAAGCAGTAAATGATGG + Intergenic
1018140511 6:160829401-160829423 CTTGGTAAAACACCAATTATTGG - Intergenic
1020740827 7:12015102-12015124 AGTGGTAAAGCATTGAATGTGGG + Intergenic
1021019180 7:15575351-15575373 CATGTTATAGCCTCAAATGTAGG - Intergenic
1021919818 7:25473610-25473632 ATAGGTAAAGGAGCAAATGTGGG - Intergenic
1022430316 7:30312935-30312957 CATGATAAAACAACAAATGTAGG + Intronic
1023126010 7:36954878-36954900 CTTGTAAAAACATCAAATATTGG - Intronic
1027758672 7:82249414-82249436 CTTGGTTAAAAAGCAAATGTAGG + Intronic
1027847871 7:83406873-83406895 CTTGGTATAGCTTCAAAAATGGG + Intronic
1027912968 7:84277023-84277045 CTTGGCAAAGCAGCACATTTAGG - Intronic
1029959601 7:104675692-104675714 ATTGCTGAAGAATCAAATGTGGG + Intronic
1031561975 7:123249650-123249672 CTTGGTATAGCATAAACTCTGGG + Intergenic
1032670915 7:134081680-134081702 AGTGGTAAAGCAGCAAAGGTAGG + Intergenic
1033125551 7:138704000-138704022 CATGATAAAGCATCAAAGTTGGG + Intergenic
1033845897 7:145431704-145431726 CAAGGTAAAGCATCAAGTGCTGG - Intergenic
1033893146 7:146040200-146040222 CTGGGTAAATAATGAAATGTAGG - Intergenic
1037033568 8:14139092-14139114 CTGGGTAAATCATGAAATGAAGG + Intronic
1037582976 8:20256663-20256685 CTTGCTAAAGGATCAGATGTAGG + Intronic
1038571596 8:28667287-28667309 CTTGGTAAAGTAACAAGGGTGGG + Intronic
1040657891 8:49533192-49533214 ATAGGTAAAGCATCACATGTAGG + Intergenic
1042131285 8:65589024-65589046 CTTGTTAAAACACCAAATGCTGG + Intergenic
1043306197 8:78799741-78799763 CCTGGTAAAGCAACAAATTCAGG - Intronic
1044933263 8:97270395-97270417 CTTTGTAAACCATGAAGTGTTGG + Intergenic
1045558514 8:103238141-103238163 CTTTGTATAGCATCACATCTTGG + Intergenic
1047768264 8:128007878-128007900 CTTTGTTAAGGATCAGATGTAGG - Intergenic
1048172146 8:132117487-132117509 CTTGGAAAAGCATGAACTTTGGG - Intergenic
1048746721 8:137622739-137622761 TGTTGTAAAGGATCAAATGTGGG + Intergenic
1050346225 9:4690917-4690939 CTTGGTAAAGCAGAAATTGCAGG - Intronic
1051180887 9:14411016-14411038 TTTTTTAAAGCATCAATTGTGGG - Intergenic
1051188915 9:14490156-14490178 TTTGGTAACACATCAAAAGTGGG - Intergenic
1053416926 9:37952688-37952710 TTTGGTAAAGCAACAGATGCTGG + Intronic
1055270617 9:74554072-74554094 CTTGTTAAAGCACCAATTGTTGG - Intronic
1055388094 9:75786323-75786345 TTTGGTCAAGCATCAAGTTTAGG + Intergenic
1057933243 9:99214350-99214372 CTTGATAAAGCATCAGCTCTTGG - Intergenic
1186942113 X:14521191-14521213 ATTGGTAAAGCATTATTTGTGGG + Intergenic
1187028208 X:15457776-15457798 CTTGTTAAACCTTCTAATGTAGG + Intronic
1188441521 X:30218553-30218575 CTGGGTAAACCAAGAAATGTGGG - Intronic
1192756608 X:74052465-74052487 TTTGATCAAGCATCAAATTTAGG - Intergenic
1194819021 X:98483049-98483071 CTTGGTGACACATTAAATGTGGG - Intergenic
1195389372 X:104345314-104345336 CTTAGTAATGCATTGAATGTTGG - Intergenic
1197998691 X:132409302-132409324 TTTGGTAAAGCATGTAAGGTTGG + Intronic
1198622485 X:138529574-138529596 CTTGTTAAAGAATCAAATTTTGG - Intergenic
1200362174 X:155619201-155619223 TTTGGTAAAGTATGAAATTTAGG + Intronic
1202625393 Y:56851972-56851994 CTGGGTAAATCATGAAATGAAGG + Intergenic