ID: 1085385051

View in Genome Browser
Species Human (GRCh38)
Location 11:76152824-76152846
Sequence AAGGAAGCCACCGCATGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085385040_1085385051 30 Left 1085385040 11:76152771-76152793 CCTCTGGCTGCCTCCATAGACTC No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data
1085385041_1085385051 20 Left 1085385041 11:76152781-76152803 CCTCCATAGACTCAGCTTTAGTC No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data
1085385045_1085385051 -2 Left 1085385045 11:76152803-76152825 CCCGGCCCATCCTGCTGGCACAA No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data
1085385042_1085385051 17 Left 1085385042 11:76152784-76152806 CCATAGACTCAGCTTTAGTCCCG No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data
1085385048_1085385051 -7 Left 1085385048 11:76152808-76152830 CCCATCCTGCTGGCACAAGGAAG No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data
1085385049_1085385051 -8 Left 1085385049 11:76152809-76152831 CCATCCTGCTGGCACAAGGAAGC No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data
1085385046_1085385051 -3 Left 1085385046 11:76152804-76152826 CCGGCCCATCCTGCTGGCACAAG No data
Right 1085385051 11:76152824-76152846 AAGGAAGCCACCGCATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085385051 Original CRISPR AAGGAAGCCACCGCATGTGA TGG Intergenic
No off target data available for this crispr