ID: 1085387927

View in Genome Browser
Species Human (GRCh38)
Location 11:76167798-76167820
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085387927_1085387942 22 Left 1085387927 11:76167798-76167820 CCAGCCCGCCCTGGGATCCCCGT No data
Right 1085387942 11:76167843-76167865 AACAGTGAGGGATGAATTCTTGG No data
1085387927_1085387940 9 Left 1085387927 11:76167798-76167820 CCAGCCCGCCCTGGGATCCCCGT No data
Right 1085387940 11:76167830-76167852 GTTATTTACTGGAAACAGTGAGG No data
1085387927_1085387941 10 Left 1085387927 11:76167798-76167820 CCAGCCCGCCCTGGGATCCCCGT No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387927_1085387937 -2 Left 1085387927 11:76167798-76167820 CCAGCCCGCCCTGGGATCCCCGT No data
Right 1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085387927 Original CRISPR ACGGGGATCCCAGGGCGGGC TGG (reversed) Intergenic
No off target data available for this crispr