ID: 1085387932

View in Genome Browser
Species Human (GRCh38)
Location 11:76167806-76167828
Sequence GGGCTCCCACGGGGATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085387932_1085387940 1 Left 1085387932 11:76167806-76167828 CCCTGGGATCCCCGTGGGAGCCC No data
Right 1085387940 11:76167830-76167852 GTTATTTACTGGAAACAGTGAGG No data
1085387932_1085387941 2 Left 1085387932 11:76167806-76167828 CCCTGGGATCCCCGTGGGAGCCC No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387932_1085387937 -10 Left 1085387932 11:76167806-76167828 CCCTGGGATCCCCGTGGGAGCCC No data
Right 1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG No data
1085387932_1085387942 14 Left 1085387932 11:76167806-76167828 CCCTGGGATCCCCGTGGGAGCCC No data
Right 1085387942 11:76167843-76167865 AACAGTGAGGGATGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085387932 Original CRISPR GGGCTCCCACGGGGATCCCA GGG (reversed) Intergenic