ID: 1085387936

View in Genome Browser
Species Human (GRCh38)
Location 11:76167817-76167839
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085387936_1085387941 -9 Left 1085387936 11:76167817-76167839 CCGTGGGAGCCCAGTTATTTACT No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387936_1085387942 3 Left 1085387936 11:76167817-76167839 CCGTGGGAGCCCAGTTATTTACT No data
Right 1085387942 11:76167843-76167865 AACAGTGAGGGATGAATTCTTGG No data
1085387936_1085387940 -10 Left 1085387936 11:76167817-76167839 CCGTGGGAGCCCAGTTATTTACT No data
Right 1085387940 11:76167830-76167852 GTTATTTACTGGAAACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085387936 Original CRISPR AGTAAATAACTGGGCTCCCA CGG (reversed) Intergenic
No off target data available for this crispr