ID: 1085387937

View in Genome Browser
Species Human (GRCh38)
Location 11:76167819-76167841
Sequence GTGGGAGCCCAGTTATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085387930_1085387937 -6 Left 1085387930 11:76167802-76167824 CCCGCCCTGGGATCCCCGTGGGA No data
Right 1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG No data
1085387931_1085387937 -7 Left 1085387931 11:76167803-76167825 CCGCCCTGGGATCCCCGTGGGAG No data
Right 1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG No data
1085387927_1085387937 -2 Left 1085387927 11:76167798-76167820 CCAGCCCGCCCTGGGATCCCCGT No data
Right 1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG No data
1085387932_1085387937 -10 Left 1085387932 11:76167806-76167828 CCCTGGGATCCCCGTGGGAGCCC No data
Right 1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085387937 Original CRISPR GTGGGAGCCCAGTTATTTAC TGG Intergenic
No off target data available for this crispr