ID: 1085387938

View in Genome Browser
Species Human (GRCh38)
Location 11:76167826-76167848
Sequence ACTGTTTCCAGTAAATAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085387938_1085387942 -6 Left 1085387938 11:76167826-76167848 CCCAGTTATTTACTGGAAACAGT No data
Right 1085387942 11:76167843-76167865 AACAGTGAGGGATGAATTCTTGG No data
1085387938_1085387943 25 Left 1085387938 11:76167826-76167848 CCCAGTTATTTACTGGAAACAGT No data
Right 1085387943 11:76167874-76167896 CTCCATGCGAAGCAGAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085387938 Original CRISPR ACTGTTTCCAGTAAATAACT GGG (reversed) Intergenic
No off target data available for this crispr