ID: 1085387941

View in Genome Browser
Species Human (GRCh38)
Location 11:76167831-76167853
Sequence TTATTTACTGGAAACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085387934_1085387941 -7 Left 1085387934 11:76167815-76167837 CCCCGTGGGAGCCCAGTTATTTA No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387933_1085387941 1 Left 1085387933 11:76167807-76167829 CCTGGGATCCCCGTGGGAGCCCA No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387932_1085387941 2 Left 1085387932 11:76167806-76167828 CCCTGGGATCCCCGTGGGAGCCC No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387930_1085387941 6 Left 1085387930 11:76167802-76167824 CCCGCCCTGGGATCCCCGTGGGA No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387935_1085387941 -8 Left 1085387935 11:76167816-76167838 CCCGTGGGAGCCCAGTTATTTAC No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387927_1085387941 10 Left 1085387927 11:76167798-76167820 CCAGCCCGCCCTGGGATCCCCGT No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387931_1085387941 5 Left 1085387931 11:76167803-76167825 CCGCCCTGGGATCCCCGTGGGAG No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data
1085387936_1085387941 -9 Left 1085387936 11:76167817-76167839 CCGTGGGAGCCCAGTTATTTACT No data
Right 1085387941 11:76167831-76167853 TTATTTACTGGAAACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085387941 Original CRISPR TTATTTACTGGAAACAGTGA GGG Intergenic
No off target data available for this crispr