ID: 1085389873

View in Genome Browser
Species Human (GRCh38)
Location 11:76176854-76176876
Sequence CCCTTGCAGGCCTGCGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085389865_1085389873 -5 Left 1085389865 11:76176836-76176858 CCCAACCCAGGAGGGGGCCCCTT No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data
1085389856_1085389873 18 Left 1085389856 11:76176813-76176835 CCTGGGATACAACTGGTCCCTGC No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data
1085389861_1085389873 1 Left 1085389861 11:76176830-76176852 CCCTGCCCCAACCCAGGAGGGGG No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data
1085389866_1085389873 -6 Left 1085389866 11:76176837-76176859 CCAACCCAGGAGGGGGCCCCTTG No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data
1085389867_1085389873 -10 Left 1085389867 11:76176841-76176863 CCCAGGAGGGGGCCCCTTGCAGG No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data
1085389863_1085389873 0 Left 1085389863 11:76176831-76176853 CCTGCCCCAACCCAGGAGGGGGC No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data
1085389864_1085389873 -4 Left 1085389864 11:76176835-76176857 CCCCAACCCAGGAGGGGGCCCCT No data
Right 1085389873 11:76176854-76176876 CCCTTGCAGGCCTGCGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085389873 Original CRISPR CCCTTGCAGGCCTGCGGCCG AGG Intergenic
No off target data available for this crispr