ID: 1085391138

View in Genome Browser
Species Human (GRCh38)
Location 11:76182906-76182928
Sequence CCCAGCCCTGAGCAAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085391138_1085391147 8 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391147 11:76182937-76182959 CCTTGGTTGTTCCTCTGGCCTGG No data
1085391138_1085391143 3 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391143 11:76182932-76182954 GGGCCCCTTGGTTGTTCCTCTGG No data
1085391138_1085391150 24 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391150 11:76182953-76182975 GGCCTGGCCTGGCCTCCTCACGG No data
1085391138_1085391148 13 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391148 11:76182942-76182964 GTTGTTCCTCTGGCCTGGCCTGG No data
1085391138_1085391142 -9 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391142 11:76182920-76182942 AGGGCTGGGCTTGGGCCCCTTGG No data
1085391138_1085391151 25 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391151 11:76182954-76182976 GCCTGGCCTGGCCTCCTCACGGG No data
1085391138_1085391153 26 Left 1085391138 11:76182906-76182928 CCAGTGGCTTGCTCAGGGCTGGG No data
Right 1085391153 11:76182955-76182977 CCTGGCCTGGCCTCCTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085391138 Original CRISPR CCCAGCCCTGAGCAAGCCAC TGG (reversed) Intergenic
No off target data available for this crispr